Molecular marker related to fat content of millet grains, KASP primer pair and application of molecular marker and KASP primer pair

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the fat content of millet grains, a KASP primer pair and application of the molecular marker. The molecular marker provided by the invention is located at the 45054761bp position of the fifth chromosome of the millet genome, and the single nucleotide polymorphism is G / A; the molecular marker is related to the grain fat content of millet, and when the genotype is AA or GA, the molecular marker has the character of high grain fat content; when the genotype is GG type, the gene has the character of low grain fat content. A KASP primer pair is developed on the basis of the molecular marker, rapid and high-throughput detection can be carried out on a sample only through DNA extraction, PCR amplification and KASP genetic typing, the millet with the high grain fat content and the millet with the low grain fat content are distinguished, the millet grain fat content character identification is practical and effective, the molecular marker can be applied to millet breeding and high-quality genetic improvement application research, and the application prospect is wide. A new choice is provided for the breeding application of improving the fat content of the millet.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to the fat content of millet grains, a KASP primer pair and an application thereof. Background Art

[0002] The human body can synthesize certain saturated and monounsaturated fatty acids, but cannot synthesize some fatty acids (called essential fatty acids) required for maintaining normal growth, such as linoleic acid and linolenic acid, which can only be obtained from food. With the improvement of living standards, people's nutritional requirements for food are getting higher and higher. The saturated fatty acid content in plants is 40% to 50% less than that in animal fat, which greatly reduces the possibility of people suffering from high blood pressure and coronary heart disease due to long-term intake of large amounts of saturated fatty acids. People's fat intake has gradually shifted from animal fat to vegetable oil, and the demand for vegetable oil with low saturated fatty acid content and high unsaturated fatty acid content has gradually increased.

[0003] Millet, also known as "millet", is called "millet" after shelling. It is an important coarse grain crop. Its grains are rich in balanced protein, carbohydrates and fat. It also contains a variety of nutrients such as amino acids, phosphorus, iron and vitamins (vitamin A, B, C and D) required by the human body. The fat in millet is stored in the germ and endosperm, and the average fat content is 4.05%, which is higher than rice and wheat, and lower than corn. The fat in millet is rich in essential fatty acids such as linoleic acid, linolenic acid and arachidic acid, of which the content of unsaturated fatty acids exceeds 80%, and has multiple effects such as anti-inflammatory, prevention and treatment of arteriosclerosis. Therefore, it is an urgent requirement for breeding to develop effective molecular markers for detecting the fat content of millet and efficiently assist in the selection of millet with high fat content.

[0004] The fat (crude fat) content of millet is a complex quantitative trait that is controlled by multiple genes and various environmental conditions. At present, only a small number of QTLs (Quantitative trait locus) and genes related to soybean oil synthesis and 100-grain weight have been verified, and it is difficult to simply and effectively increase the crude fat content of millet using traditional breeding methods. Discovering the gene loci related to fat in millet grains and developing related molecular markers can not only provide a scientific basis for in-depth understanding of the nutritional characteristics of millet and improving millet quality and human diet, but also provide a theoretical basis for a deeper interpretation of the molecular genetic mechanism of the expression of quality-related traits in millet grains, and provide a theoretical basis for the use of molecular markers in millet variety quality improvement, helping to breed new special millet varieties, and promoting millet breeding and production. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to millet grain fat content, a KASP primer pair and application thereof, to quickly screen and identify the millet grain fat content trait, and to improve the breeding efficiency of millets with high grain fat content.

[0006] The invention provides a molecular marker related to the fat content of millet grains. The molecular marker is located at 45054761 bp on chromosome 5 of the millet genome, and the single nucleotide polymorphism is G / A.

[0007] Preferably, the molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is G / A.

[0008] The present invention also provides a KASP primer pair for identifying the molecular markers described in the above technical solution, comprising a forward primer 1, a forward primer 2 and a reverse primer;

[0009] The forward primer 1 includes the nucleotide sequence shown in SEQ ID NO.2; the 5' end of the nucleotide sequence shown in SEQ ID NO.2 contains a fluorescent marker 1;

[0010] The forward primer 2 includes the nucleotide sequence shown in SEQ ID NO.3; the 5' end of the nucleotide sequence shown in SEQ ID NO.3 contains a fluorescent marker 2;

[0011] The reverse primer comprises the nucleotide sequence shown in SEQ ID NO.4;

[0012] The colors produced by the fluorescent marker 1 and the fluorescent marker 2 are different.

[0013] Preferably, the fluorescent marker 1 is a FAM marker; and the fluorescent marker 2 is a HEX marker.

[0014] The present invention also provides a kit for identifying the molecular markers described in the above technical solution, wherein the kit comprises the KASP primer pair described in the above technical solution.

[0015] The present invention also provides the use of the molecular marker or KASP primer pair or kit described in the above technical solution in one or more of the following:

[0016] (1) Identify or assist in identifying the fat content of millet grains;

[0017] (2) distinguish between millet strains or varieties with high grain fat content and millet strains or varieties with low grain fat content;

[0018] (3) Cultivating or assisting in the cultivation of millet plants, strains, lines or varieties with high or low grain fat content;

[0019] (4) Screening or assisting in the screening of millet plants, strains, lines or varieties with high or low grain fat content traits;

[0020] (5) preparing a product for detecting the fat content trait of millet or millet hybrid progeny;

[0021] (6) preparing a product for distinguishing millet with high grain fat content from millet with low grain fat content;

[0022] (7) preparing products for cultivating or assisting in cultivating individual millet plants, strains, lines or varieties with high or low grain fat content traits;

[0023] (8) Preparing products for screening or assisting in screening millet plants, strains, lines or varieties with high or low grain fat content traits.

[0024] The present invention also provides a method for identifying the fat trait of millet grains, comprising the following steps:

[0025] Using the genomic DNA of the millet to be identified as a template, PCR amplification is performed using the KASP primer pair described in the above technical solution to obtain an amplified product;

[0026] The amplified product is subjected to fluorescence detection, and the following is determined based on the fluorescence signal:

[0027] If only the fluorescent signal corresponding to the forward primer F1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has a low grain fat content trait;

[0028] If only the fluorescent signal corresponding to the forward primer F2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has a high grain fat content trait;

[0029] If the fluorescence signals corresponding to the forward primer F1 and the forward primer F2 are detected at the same time, the genotyping result of the millet to be identified is GA, and the millet to be identified has a high grain fat content trait.

[0030] Preferably, the genomic DNA comprises leaf genomic DNA.

[0031] Preferably, the PCR amplification system, based on 10 μL, includes: 5 μL of HiGeno 2×Probe MixA solution, 0.14 μL of 100 μmol / L SNPPrimerMix solution, 4-50 ng of genomic DNA, and the balance of sterile water;

[0032] The volume ratio of 100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer in the SNPPrimerMix solution is 1:1:3.

[0033] Preferably, the PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 31 cycles.

[0034] Beneficial effects:

[0035] The present invention provides a molecular marker related to the fat content of millet grains, which is located at 45054761bp on chromosome 5 of the millet genome, and the single nucleotide polymorphism is G / A; when the genotype of millet is AA or GA, it has a high grain fat content trait; when the genotype of millet is GG, it has a low grain fat content trait. The molecular marker of the present invention is related to the fat content of millet grains, and can distinguish millet with high grain fat content from millet with low grain fat content.

[0036] The present invention develops a KASP primer pair based on the above molecular markers, which can select millet grain fat content-related factors. Only simple genomic DNA extraction, PCR amplification, and KASP gene typing detection are required to complete rapid and high-throughput detection of samples, distinguish between millets with high grain fat content and millets with low grain fat content, and is effective in identifying the millet grain fat content trait. It can be applied to millet breeding and high-quality genetic improvement application research, providing a new choice for breeding applications to increase millet fat content. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0038] Figure 1 Schematic diagram of the results of QTL mapping in millet in Example 1 of the present invention;

[0039] Figure 2 This is a genotyping diagram of different millet germplasms using the molecular markers of Example 1; wherein, the small circle in the oval encircled 1 represents the millet germplasm with a high crude fat genotype (AA), the small circle in the oval encircled 2 represents the template-free control NTC, the small circle in the oval encircled 3 represents the millet germplasm with a low crude fat genotype (GG), and the small circle in the oval encircled 4 represents the millet germplasm with a high crude fat genotype (GA);

[0040] Figure 3The statistical results of KASP genotyping and crude fat content in 2020; *** indicates p < 0.001; * indicates p < 0.05;

[0041] Figure 4 These are the statistical results of KASP genotyping and crude fat content in 2021; *** indicates p < 0.001; * indicates p < 0.05. DETAILED DESCRIPTION

[0042] The invention provides a molecular marker related to the fat content of millet grains. The molecular marker is located at 45054761 bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is G / A.

[0043] In the present invention, as an embodiment, the molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is G / A. The nucleotide sequence shown in SEQ ID NO.1 of the present invention is specifically: 5'-GTGCGTCCGTCTGCGGCCGCCACCTCCGTGGCCTCC GTCGCCCGCCGCCAGCTCCTAGTCCATCCCCCGCCAGCCCGTCACCTCCCTGCAGTCCCTCTGCCCAGTGCCCAGATCCCATCACGGAACTCGAGGGAACATGCTGCCAACACTYCTTGGAACTTTTAAGAGATGGTGTTCCATTTTTCTGAACAATTTGGCATTCCAGGCAAATTAGAAAGCACTGCAGTTCTCAAAGCAATTTGTGCTCCACCGAGCCTCACGTCTGCCTGACACCAGGTTCACAGCCTCCATAGATGAAATC-3'; wherein, Y is a polymorphic site, and the single nucleotide polymorphism is G / A.

[0044] The present invention uses millet germplasms (Jingu 21 and GBS) with different fat content as parents to construct RIL genetic populations, conducts QTL positioning for millet grain fat content, and detects a new QTL locus qFAT-5 that controls the high and low fat content of millet grains. After identification and screening of markers on both sides, it is clear that the genotype of its tightly linked marker Bin and the phenotypic significance of grain fat content are the highest, and a molecular marker is developed based on this. The molecular marker is located at 45054761bp on chromosome 5 of the millet genome, and the single nucleotide polymorphism is G / A. The molecular marker developed by the present invention can be used for efficient screening of millet grain fat content. When the millet genotype is AA or GA, it has a high grain fat content trait; when the millet genotype is GG, it has a low grain fat content trait. The molecular marker of the present invention is related to the fat content of millet grains and can distinguish millets with high grain fat content from millets with low grain fat content. Screening using the molecular marker can improve the efficiency of selecting high and low grain fat content in millet breeding.

[0045] The present invention also provides a KASP primer pair for identifying the molecular markers described in the above technical solution, comprising a forward primer 1, a forward primer 2 and a reverse primer;

[0046] The forward primer 1 includes the nucleotide sequence shown in SEQ ID NO.2; the 5' end of the nucleotide sequence shown in SEQ ID NO.2 contains a fluorescent marker 1;

[0047] The forward primer 2 includes the nucleotide sequence shown in SEQ ID NO.3; the 5' end of the nucleotide sequence shown in SEQ ID NO.3 contains a fluorescent marker 2;

[0048] The reverse primer comprises the nucleotide sequence shown in SEQ ID NO.4;

[0049] The colors produced by the fluorescent marker 1 and the fluorescent marker 2 are different.

[0050] In the present invention, as an embodiment, the fluorescent marker 1 is a FAM marker. As an embodiment, the fluorescent marker 2 is a HEX marker. As an embodiment, the nucleotide sequence of the forward primer 1 is shown in SEQ ID NO.5. As an embodiment, the nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.6.

[0051] The present invention also provides a kit for identifying the molecular markers described in the above technical solution, wherein the kit comprises the KASP primer pair described in the above technical solution.

[0052] In the present invention, as an embodiment, the kit further comprises other reagents for KASP detection, including but not limited to HiGeno 2×Probe MixA solution (Thermo Fisher Scientific Inc.) and / or sterile water.

[0053] The present invention develops a KASP primer pair based on the above molecular markers, which can select millet grain fat content-related factors. Only simple genomic DNA extraction, PCR amplification, and KASP gene typing detection are required to complete rapid and high-throughput detection of samples, distinguish between millets with high grain fat content and millets with low grain fat content, and is effective in identifying the millet grain fat content trait. It can be applied to millet breeding and high-quality genetic improvement application research, providing a new choice for breeding applications to increase millet fat content.

[0054] In view of the advantages of the molecular marker or KASP primer pair or kit provided by the present invention, the use of the molecular marker or KASP primer pair or kit in one or more of the following also falls within the protection scope of the present invention: (1) identifying or assisting in identifying the fat content of millet grains; (2) distinguishing millet strains or varieties with high grain fat content and millet strains or varieties with low grain fat content; (3) cultivating or assisting in cultivating millet individual plants, strains, strains or varieties with high or low grain fat content; (4) screening or assisting in screening millet strains with high or low grain fat content. (5) Preparation of products for detecting the grain fat content trait of millet or millet hybrid offspring; (6) Preparation of products for distinguishing millet with high grain fat content from millet with low grain fat content; (7) Preparation of products for cultivating or assisting in cultivating millet plants, lines, strains or varieties with high or low grain fat content trait; (8) Preparation of products for screening or assisting in screening millet plants, lines, strains or varieties with high or low grain fat content trait.

[0055] The present invention also provides a method for identifying the fat trait of millet grains, comprising the following steps:

[0056] Using the genomic DNA of the millet to be identified as a template, PCR amplification is performed using the KASP primer pair described in the above technical solution to obtain an amplified product;

[0057] The amplified product is subjected to fluorescence detection, and the following is determined based on the fluorescence signal:

[0058] If only the fluorescent signal corresponding to the forward primer F1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has a low grain fat content trait;

[0059] If only the fluorescent signal corresponding to the forward primer F2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has a high grain fat content trait;

[0060] If the fluorescence signals corresponding to the forward primer F1 and the forward primer F2 are detected at the same time, the genotyping result of the millet to be identified is GA, and the millet to be identified has a high grain fat content trait.

[0061] The present invention uses the genomic DNA of the millet to be identified as a template, and uses the KASP primer pair described in the above technical solution to perform PCR amplification to obtain an amplified product. In the present invention, as an embodiment, the genomic DNA includes leaf genomic DNA. The present invention has no strict requirements on the method of obtaining the genomic DNA, and conventional methods in the art can be used, such as CTAB (cetyltrimethylammonium bromide) extraction method.

[0062] In the present invention, as an embodiment, the PCR amplification system includes 10 μL of HiGeno 2×Probe MixA solution 5 μL, 100 μmol / L SNPPrimerMix solution 0.14 μL, genomic DNA 4-50 ng and the remainder of sterile water. As an embodiment, the volume ratio of forward primer 1, forward primer 2 and reverse primer in the SNP PrimerMix solution is 1:1:3; as an embodiment, the independent concentrations of forward primer 1, forward primer 2 and reverse primer are 100 μmol / L respectively.

[0063] In the present invention, as an embodiment, the program of PCR amplification described in the present invention is: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 20 seconds, extension at 55°C-61°C for 40 seconds, 10 cycles; denaturation at 95°C for 20 seconds, extension at 55°C-61°C for 40 seconds, 31 cycles.

[0064] After obtaining the amplified product, the present invention performs fluorescence detection on the amplified product and determines based on the fluorescence signal:

[0065] If only the fluorescent signal corresponding to the forward primer F1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has a low grain fat content trait;

[0066] If only the fluorescent signal corresponding to the forward primer F2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has a high grain fat content trait;

[0067] If the fluorescence signals corresponding to the forward primer F1 and the forward primer F2 are detected at the same time, the genotyping result of the millet to be identified is GA, and the millet to be identified has a high grain fat content trait.

[0068] In the present invention, as an embodiment, the fluorescence detection adopts a fluorescence quantitative analyzer (ABICo.USA) and Taqman Genotyper Software.

[0069] The method provided by the present invention is simple, can quickly and high-throughput detect the genotype of the millet to be identified, judge the fat content trait of the millet grain, can be applied to millet breeding and high-quality genetic improvement application research, and provide a new choice for breeding applications to increase the fat content of millet. The millet grain fat described in the present invention is millet grain crude fat.

[0070] To further illustrate the present invention, a molecular marker related to the fat content of millet grains, a KASP primer pair and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0071] Example 1

[0072] Screening of SNP loci associated with crude fat content in millet

[0073] (1) A total of 114 RIL populations constructed with Jingu 21 and GBS as parents were used as experimental materials and planted in Taigu in May 2020 and 2021, respectively.

[0074] (2) After the millet matured, the grains of different materials were used as samples and their crude fat content was measured according to the following steps. The results are shown in Table 1.

[0075] Crude fat determination method: Collect mature millet ears from the field, dry them in the shade for 3 to 5 days, separate the grains from the ears, and use a rice husker to remove the impurities and broken grains. Use a 6SXZ-68 color sorter to select millet with full grains and uniform size. Grind the millet grains into powder with a vibrating ball mill, weigh 10g, and pass it through a 100-mesh sieve for later use. Put 3g of millet powder sample in a sample box, compact and flatten it, and use the NIRSTMDS2500 desktop near-infrared quality analyzer produced in Denmark to determine the crude fat content in millet at a wavelength range of 1100-2498nm. Each sample was scanned three times to eliminate the influence of factors such as sample particle size and inconsistent uniformity on the spectrum, and finally the data read by the instrument were exported for analysis.

[0076] Table 1 Statistical results of population names and crude fat content of 114 millet RILs

[0077]

[0078]

[0079] (3) Simplified genome sequencing: Take young, fresh and healthy leaves of the parents and the 114 mature plants mentioned above, and extract DNA using the CTAB method. Use 1% agarose gel electrophoresis to detect DNA quality, and send it to Shenzhen Huada Agricultural Application Research Institute for simplified genome sequencing after passing the test. After data quality testing, sequencing data filtering, alignment of reads with the reference genome, and population variation detection, the window sliding method is used to select 15 to 20 markers as a window, determine the genotype of each window and the exchange site of each progeny material, and construct the parental genotype map of each progeny material. Use MSTmap (http: / / mstmap.org / ) software and the kosambi algorithm to calculate the genetic distance of all BIN markers.

[0080] (4) QTL positioning: The complete interval mapping method in QTL Icimapping 4.2. was used to locate the QTL and analyze the effect of crude fat trait. The LOD threshold was 2.5 and the mapping step was set to 0.1 cM. QTL naming convention: Q+English abbreviation of trait+chromosome+number. One QTL significantly associated with crude fat content was identified by the complete interval mapping method and located on chromosome 5 using bin markers. Within the bin marker segment, SNP variant sites were found and KSAP markers were developed, as shown in Tables 2 to 5 and Figure 1 As shown: Among them, Figure 1 A in the middle is the result of QTL mapping of crude fat trait using bin markers in 2020; Figure 1 Middle B is the crude fat trait result of QTL positioning of KASP markers developed in 2020; Figure 1 Middle C is the QTL positioning result of the bin marker in 2021; Figure 1 Figure D in the middle is the QTL positioning result of the KASP marker in 2021. The results showed that the newly developed KASP was significantly linked to the crude fat trait, and the phenotypic explanation rate was increased.

[0081] Table 2 QTL mapping results of crude fat content in RIL population in 2020 (bin markers)

[0082] chromosome Left Mark Right Mark LOD Explanation rate of phenotypic variation (%) Additive effect 5 scaffold_5_bin198 scaffold_5_bin199 3.7524 7.5257 0.1259 5 scaffold_5_bin198 scaffold_5_bin199 4.5151 8.9929 0.1372

[0083] Table 3 QTL mapping results of crude fat content in RIL population in 2020 (KASP marker)

[0084] chromosome Left Mark Right Mark LOD Explanation rate of phenotypic variation (%) Additive effect 5 scaffold_5_bin198A scaffold_5_bin198B 3.6463 5.2483 0.1244 5 scaffold_5_bin198A scaffold_5_bin198B 3.0523 12.0516 0.1911

[0085] Table 4 QTL positioning results of crude fat content in RIL population in 2021 (bin markers)

[0086] chromosome Left Mark Right Mark LOD Explanation rate of phenotypic variation (%) Additive effect 5 scaffold_5_bin197 scaffold_5_bin198 3.1293 8.4989 0.2602 5 scaffold_5_bin198 scaffold_5_bin199 5.9003 5.3577 0.209 5 scaffold_5_bin198 scaffold_5_bin199 5.1184 6.9962 0.2381

[0087] Table 5 QTL mapping results of crude fat content in RIL population in 2021 (KASP marker)

[0088] chromosome Left Mark Right Mark LOD Explanation rate of phenotypic variation (%) Additive effect 5 scaffold_5_bin197 scaffold_5_bin198A 5.2028 11.0652 0.2735 5 scaffold_5_bin198A scaffold_5_bin198B 6.8761 9.0935 0.2507 5 scaffold_5_bin198A scaffold_5_bin198B 6.1306 10.8875 0.2773

[0089] (5) Development of SNP site variation

[0090] By simplifying genome sequencing, a genetic map of a high-density RIL population was constructed. After composite interval mapping, the QTL was located to the scaffold_5_bin198 and scaffold_5_bin199 marker intervals on chromosome 5 of the millet genome. Further analysis revealed that a SNP variation existed at 45054761bp on chromosome 5 of the millet genome. A sequence of 150bp in length was selected in the upstream and downstream directions of the site to obtain a 301bp sequence. The 301bp nucleotide sequence is shown in SEQ ID NO.1, and the 151st nucleotide is G or A, corresponding to 45054761bp on chromosome 5 of the millet genome, where the nucleotide is G or A.

[0091] (6) For the SNP site variation in step (5), KASP primers were designed on the PolyMarker website according to the KASP design principle. Two forward primers KASP45054761-F1 and KASP45054761-F2 and a reverse primer KASP45054761-R were designed. The nucleotide sequences are as follows:

[0092] KASP45054761-F1: 5'-GGGAACATGCTGCCAACACTG-3' (SEQ ID No. 2);

[0093] KASP45054761-F2: 5'-GGGAACATGCTGCCAACACTA-3' (SEQ ID No. 3);

[0094] KASP45054761-R: 5'-GCTTTCTAATTTGCCTGGAATGC-3' (SEQ ID NO. 4).

[0095] The above KASP primers are designed based on the genotype variation of the high crude fat content and low crude fat content strains at the position of 45054761bp on chromosome 5, wherein the high crude fat genotype is AA or GA, and the low crude fat genotype is GG.

[0096] The FAM fluorescent linker sequence was connected to the 5' end of the KASP45054761-F1 primer, and the HEX fluorescent linker sequence was connected to the 5' end of the KASP45054761-F2 primer to obtain forward primer 1 and forward primer 2. The primer sequences after connecting the fluorescent linker are as follows:

[0097] Forward Primer 1: 5'- GAAGGTGACCAAGTTCATGCT GGGAACATGCTGCCAAC ACTG-3' (SEQ ID NO. 5, wherein the underlined portion is the FAM fluorescent tag sequence);

[0098] Forward Primer 2: 5'- GAAGGTCGGAGTCAACGGATT GGGAACATGCTGCCAA CACTA-3' (SEQ ID NO. 6, wherein the underlined portion is the HEX fluorescent tag sequence);

[0099] The forward primer 1, forward primer 2 and universal reverse primer KASP45054761-R were used as a KASP primer pair for molecular marker detection.

[0100] Example 2

[0101] Genotyping and crude fat content identification

[0102] (1) The leaves of 114 RIL population strains in Example 1 were used as experimental materials, and the genomic DNA of the leaves of the experimental materials was extracted using the CTAB (cetyltrimethylammonium bromide) method.

[0103] (2) using the genomic DNA from step (1) as a template and using the KASP primer pair obtained in Example 1 to perform PCR amplification to obtain an amplified product; wherein,

[0104] The PCR amplification reaction system (10 μL) includes: 5 μL of HiGeno 2x Probe MixA solution, 0.14 μL of SNPPrimerMix solution (primer mixture prepared according to the volume ratio of F1:F2:R=1:1:3), 4-50 ng of DNA sample, and made up to 10 μL with sterile water; negative control was made with ddH 2 O replaces the template DNA for reaction;

[0105] The PCR amplification procedure was as follows: the first stage was pre-denaturation at 95°C for 10 min; the second stage was denaturation at 95°C for 20 s and extension at 55°C-61°C for 40 s, for a total of 10 cycles; the third stage was denaturation at 95°C for 20 s and extension at 55°C for 40 s, for a total of 31 cycles.

[0106] (3) After amplification, KASP detection was performed based on the AQP genotyping system operating instructions (purchased from Beijing Jiacheng Biotechnology Co., Ltd.), and the PCR program on the ABI7500 qPCR instrument was set to 55°C for 30 seconds. The result file was exported, and the genotype was further determined based on the sample cluster. The results were analyzed on the Taqman Genotyper Software software to obtain the relative fluorescence values ​​corresponding to HEX and FAM for each PCR reaction well (the FAM fluorescent label sequence was observed at an excitation light wavelength of 485nm and an emission light wavelength of 520nm, and the HEX fluorescent label sequence was observed at an excitation light wavelength of 528nm and an emission light wavelength of 560nm). The samples were typed and classified and statistically analyzed based on the relative fluorescence values. The results are shown in Tables 6 to 7 and Figures 2 to 4 shown.

[0107] Table 6 Genotyping results of 114 millet RIL populations

[0108] serial number genotype serial number genotype serial number genotype J1 GG J40 GG J79 AA J2 GG J41 AA J81 AA J3 AA J42 AA J82 GG J4 GG J43 AA J83 GG J5 GG J44 AA J84 GG J6 AA J45 #NA J85 GG J7 AA J46 GG J86 AA J8 AA J47 GG J87 GA J9 AA J48 AA J88 AA J10 AA J49 AA J89 GG J11 AA J50 AA J90 AA J12 AA J51 GG J91 GG J13 GG J52 AA J92 GG J14 AA J53 GG J93 AA J15 GG J54 GG J94 GG J16 AA J55 AA J95 GG J17 AA J56 GA J96 AA J18 GG J57 AA J97 AA J19 AA J58 AA J98 AA J20 AA J59 AA J99 AA J21 AA J60 GG J100 AA J22 GG J61 AA J101 #NA J23 GG J62 #NA J102 GG J24 AA J63 AA J103 AA J25 GG J64 AA J104 AA J26 #NA J65 AA J105 GG J27 GG J66 AA J106 AA J28 AA J67 AA J108 GA J29 AA J68 AA J109 GG J30 GG J69 AA J110 AA J31 AA J70 AA J111 AA J32 AA J71 AA J112 AA J33 GG J72 AA J113 AA J34 AA J74 AA J114 AA J35 AA J75 AA J115 GG J36 AA J76 GG J116 GG J38 AA J77 GA J117 GA J39 GG J78 AA J118 AA

[0109] Note: #N indicates invalid data.

[0110] Table 7 Statistical results of KASP genotyping and crude fat content in 114 millet RIL populations

[0111]

[0112] According to Tables 6-7 and Figures 2 to 4 It can be seen that the sample PCR product only detected the fluorescent signal corresponding to the forward primer F1 connected to the fluorescent linker sequence, and the genotype of the detection site was GG, which was determined to be a single plant with low crude fat content; the sample PCR product only detected the fluorescent signal corresponding to the forward primer F2 connected to the fluorescent linker sequence, and the genotype of the detection site was AA, which was determined to be a single plant with high crude fat content; the sample PCR product detected the fluorescent signals corresponding to the forward primers F1 and F2 connected to the fluorescent linker sequence, and the genotype of the detection site was GA, which was determined to be a single plant with high crude fat content.

[0113] Based on the above content, it can be seen that the technical solution provided by the present invention can be related to the fat content of millet grains, can distinguish millets with high grain fat content from millets with low grain fat content, has a genetic linkage relationship with protein content, and can be applied to millet breeding and high-quality genetic improvement application research.

[0114] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A molecular marker related to the fat content of millet grains, characterized in that: The molecular marker is located at 45054761bp on chromosome 5 of the millet genome, and the single nucleotide polymorphism is G / A.

2. The molecular marker according to claim 1, characterized in that The molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is G / A.

3. A KASP primer pair for identifying the molecular marker according to claim 1 or 2, characterized in that: comprising forward primer 1, forward primer 2 and reverse primer; The forward primer 1 includes the nucleotide sequence shown in SEQ ID NO.2; the 5' end of the nucleotide sequence shown in SEQ ID NO.2 contains a fluorescent marker 1; The forward primer 2 includes the nucleotide sequence shown in SEQ ID NO.3; the 5' end of the nucleotide sequence shown in SEQ ID NO.3 contains a fluorescent marker 2; The reverse primer comprises the nucleotide sequence shown in SEQ ID NO.4; The colors produced by the fluorescent marker 1 and the fluorescent marker 2 are different.

4. The KASP primer pair according to claim 3, characterized in that The fluorescent marker 1 is a FAM marker; the fluorescent marker 2 is a HEX marker.

5. A kit for identifying the molecular marker according to claim 1 or 2, characterized in that: The kit comprises the KASP primer pair according to claim 3 or 4.

6. Use of the molecular marker according to claim 1 or 2, or the KASP primer pair according to claim 3 or 4, or the kit according to claim 5 in one or more of the following: (1) Identify or assist in identifying the fat content of millet grains; (2) distinguish between millet strains or varieties with high grain fat content and millet strains or varieties with low grain fat content; (3) Cultivating or assisting in the cultivation of millet plants, strains, lines or varieties with high or low grain fat content; (4) Screening or assisting in the screening of millet plants, strains, lines or varieties with high or low grain fat content; (5) preparing a product for detecting the fat content trait of millet or millet hybrid progeny; (6) preparing a product for distinguishing millet with high grain fat content from millet with low grain fat content; (7) preparing products for cultivating or assisting in cultivating individual millet plants, strains, lines or varieties with high or low grain fat content traits; (8) Prepare products for screening or assisting screening of millet plants, strains, lines or varieties with high or low grain fat content traits.

7. A method for identifying the fat properties of millet grains, characterized in that: The steps include: Using the genomic DNA of the millet to be identified as a template, PCR amplification is performed using the KASP primer pair described in claim 3 or 4 to obtain an amplified product; The amplified product is subjected to fluorescence detection, and a determination is made based on the fluorescence signal: If only the fluorescent signal corresponding to the forward primer F1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has a low grain fat content trait; If only the fluorescent signal corresponding to the forward primer F2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has a high grain fat content trait; If the fluorescence signals corresponding to the forward primer F1 and the forward primer F2 are detected at the same time, the genotyping result of the millet to be identified is GA, and the millet to be identified has a high grain fat content trait.

8. The method according to claim 7, characterized in that The genomic DNA includes leaf genomic DNA.

9. The method according to claim 7 or 8, characterized in that: The PCR amplification system, based on 10 μL, includes: 5 μL of HiGeno 2×Probe MixA solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution, 4-50 ng of genomic DNA, and the balance of sterile water; The volume ratio of 100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer in the SNPPrimerMix solution is 1:1:

3.

10. The method according to claim 9, characterized in that The PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 31 cycles.

Images