Application of Art3 gene in preparation of medicine for treating heart failure and myocardial remodeling

Abstract

The invention relates to application of an Art3 gene in preparation of a medicine for treating heart failure and myocardial remodeling. The Art3 gene is a myocardial cell maturation marker, is specifically expressed in normal myocardial cells, and is down-regulated under pathological conditions of heart failure, myocardial remodeling and the like. Knockout of the Art3 gene can cause decompensation of myocardial hypertrophy, and an animal with the gene knockout can be used as a myocardial hypertrophy and heart failure model. By activating the downstream target ITGA7 protein of the Art3 gene, myocardial hypertrophy caused by down-regulation of the Art3 gene can be rescued. These findings provide a new target for the treatment of myocardial diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a biomarker of myocardial cell maturation, and specifically to an application of the Art3 gene in the preparation of a drug for treating heart failure and myocardial remodeling. Background Art

[0002] Myocardial cells are the basic functional units of the heart, and their mature state is crucial to maintaining cardiac function. Myocardial hypertrophy is a compensatory mechanism of the heart under chronic load. During the occurrence of pathological myocardial hypertrophy, the geometric shape of the heart changes, the sarcomere assembly is disordered and the structure changes, myocardial cells hypertrophy and die, and the metabolism and electrophysiology of the myocardial tissue also change. The composition of the extracellular matrix-collagen network changes, myocardial interstitial and perivascular fibrosis occurs, protein and mitochondrial quality control is impaired, and angiogenesis is insufficient. This series of pathological and physiological processes is called myocardial remodeling, which is the phenomenon of compensatory myocardial hypertrophy evolving into decompensated myocardial hypertrophy. Heart failure and myocardial remodeling are the main pathological manifestations of heart disease, and there is currently a lack of effective treatments and biomarkers. Pathological myocardial hypertrophy and myocardial remodeling are key factors in the occurrence and development of heart failure.

[0003] Therefore, research on effective treatments and biomarkers for heart failure and myocardial remodeling is urgently needed. Summary of the invention

[0004] Based on the lack of effective treatment methods and biomarkers for heart failure and myocardial remodeling in the prior art, the purpose of this application is to provide the use of Art3 (ENSG00000156219) gene in the preparation of drugs for treating heart failure and myocardial remodeling.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] One of the technical solutions of the present invention provides the use of the Art3 gene in the preparation of a drug for treating heart failure and myocardial remodeling. The Art3 gene is specifically expressed in normal cardiac myocardial cells and can be used as a marker for cardiac myocardial cell maturation. The ART3 protein expressed by the Art3 gene belongs to the ADP-ribosyltransferase family and can cleave NAD + N-glycosidic bond to generate nicotinamide and ADP-ribose, and add single or multiple ADP-ribose groups to protein amino acid residues or other substrates to form ADP-ribosylation modification.

[0007] In some specific embodiments of the present invention, the relationship between the expression of Art3 gene and myocardial hypertrophy, heart failure, and myocardial remodeling is determined; the relationship between the expression of Art3 gene and myocardial hypertrophy, heart failure, and myocardial remodeling includes:

[0008] 1. The transcription level of the Art3 gene is down-regulated in cardiomyocytes with heart failure and myocardial remodeling, and the expression level of the ART3 protein is down-regulated in cardiomyocytes with heart failure and myocardial remodeling;

[0009] 2. Knockout of the Art3 gene will lead to decompensated myocardial hypertrophy;

[0010] 3. The ART3 enzyme (i.e., ART3 protein) expressed by the Art3 gene has a downstream target, the ITGA7 protein. After being activated, the ITGA7 protein can rescue myocardial hypertrophy.

[0011] Furthermore, in the application, the expression level of Art3 gene is used to distinguish normal cardiomyocytes from cardiomyocytes suffering from heart failure and myocardial remodeling; the expression level of Art3 in cardiomyocytes of patients is 50% lower than that in normal group.

[0012] Furthermore, the relationship between the Art3 gene and the downstream target ITGA7 protein is as follows: the ART3 enzyme catalyzes the ADP-ribosylation modification of the amino acid at position R129 of the ITGA7 protein, activating its activity in the cell; the active ITGA7 will interact with laminin, thereby activating its downstream JNK and p38 signaling pathways, preventing the overactivation of NFAT transcription factors, exerting a myocardial protective effect, and thus rescuing myocardial hypertrophy (the mechanism of action is as follows Figure 5 shown).

[0013] The laminin, also known as laminin, is composed of a 400kD α chain and two 200kD β chains. It is a non-collagen sugar that constitutes the intercellular matrix. It is mainly synthesized by endothelial cells and fat storage cells in the liver, and together with collagen, it constitutes a component of the basement membrane. Its biological function is to act as a medium for cell adhesion to the matrix, and it combines with a variety of basement membrane components to regulate cell growth and differentiation. Laminin exists in various basement membranes of embryonic and adult tissues of various animals, becoming one of its main components; laminin mainly exists in the transparent layer of the basement membrane, close to the surface of the cell base, and usually does not exist on the top and side surfaces of normal cells.

[0014] The p38 is a type of mitogen-activated protein kinase (MAPK) that is involved in cell differentiation, apoptosis and autophagy. MAPKs are a family of serine / threonine kinases that include three major subgroups, namely ERK (extracellular signal-regulated kinase), p38 and JNK. Cellular responses to many external stimuli involve the activation of the MAPK signaling pathway.

[0015] The JNK (c-Jun N-terminal kinase) is also known as stress-activated protein kinase (SAPK). The JNK pathway is an important branch of the MAPK signaling pathway in mammalian cells. It plays an important role in various physiological and pathological processes such as cell cycle, reproduction, apoptosis and cell stress.

[0016] The p38 signaling pathway and the JNK signaling pathway can respectively produce p-JNK and p-p38, thereby regulating NFAT and preventing excessive activation of NFAT transcription factors.

[0017] The NFAT transcription factor is a nuclear factor of activated T cells, and the main regulation mode of NFAT transcription activity is phosphorylation / dephosphorylation; excessive activation of dephosphorylated NFAT transcription factor in the cell nucleus will lead to increased expression of myocardial hypertrophy genes (such as ANP, BNP, MYH7, MB), thereby leading to myocardial hypertrophy; p-JNK and p-p38 can promote the phosphorylation of NFAT transcription factor and transport it out of the cell nucleus, thereby preventing excessive activation of NFAT transcription factor.

[0018] The second technical solution of the present invention provides the use of ITGA7 protein activator in the preparation of treatment for heart failure and myocardial remodeling.

[0019] Furthermore, the ITGA7 protein activator is a small molecule compound; the small molecule compound is preferably Ciclopirox ethanolamine, CAS 41621-49-2, and the concentration of Ciclopirox ethanolamine in the pharmaceutical preparation is 1 μM to 10 μM.

[0020] The ITGA7 protein activator can activate the expression of ITGA7 protein, a downstream target of the Art3 gene, thereby rescuing symptoms of myocardial hypertrophy and treating heart failure and myocardial remodeling.

[0021] The third technical solution of the present invention is based on the relationship between the above-mentioned Art3 gene and cardiomyocyte hypertrophy, heart failure, and myocardial remodeling, and provides a drug for treating heart failure and myocardial remodeling, including active ingredients and excipients.

[0022] Furthermore, the active ingredient is an ITGA7 protein activator; and the excipient is a pharmaceutically acceptable carrier used to improve the processing properties of the ITGA7 protein activator.

[0023] Furthermore, the pharmaceutically acceptable carrier includes at least any one of a filler / diluent, a lubricant, a binder or a disintegrant.

[0024] The filler / diluent is used to increase the weight / volume of the tablet and improve the processing properties and performance of the product, such as powder flowability, compressibility, granulation performance, uniformity, content uniformity, disintegration, dissolution, tablet integrity, friability, and physicochemical stability; the filler / diluent is preferably any one of lactose, mannitol, microcrystalline cellulose, monocalcium phosphate, cellulose lactose or microcrystalline cellulose colloidal silicon dioxide co-processed products or a mixture thereof.

[0025] The lubricant is used to: ① improve the electrostatic distribution of the ion surface; ② improve the roughness of the ion surface and reduce friction; ③ improve the selective adsorption of gas and weaken the van der Waals force between particles. The lubricant is preferably any one of stearic acid, magnesium stearate, calcium stearate, sodium stearyl fumarate, hydrogenated vegetable oil or glyceryl behenate or a mixture thereof.

[0026] The binder is an auxiliary material that gives appropriate viscosity to a non-viscous or insufficiently viscous material by virtue of its own viscosity, which not only helps the formation and fluidity of particles during the manufacturing process, but also helps the integrity of the tablet when the particles are compressed. The binder is preferably any one of pregelatinized starch, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone, copovidone, microcrystalline cellulose, ethyl cellulose or methyl cellulose, or a mixture thereof.

[0027] The disintegrant is used to eliminate the binding force generated by the binder or high compression, so that the tablet is quickly broken into fine particles in the gastrointestinal fluid, so that the active ingredient is quickly dissolved and absorbed to exert its effect. The disintegrant is preferably any one of sodium starch glycolate, calcium silicate, crosslinked sodium carboxymethyl cellulose or low-substituted hydroxypropyl cellulose or a mixture thereof.

[0028] A fourth technical solution of the present invention provides the use of the above-mentioned drug for treating heart failure and myocardial remodeling, in which the activator needs to be mixed with at least one pharmaceutically acceptable carrier to prepare a pharmaceutical composition.

[0029] Furthermore, the pharmaceutical composition is any one of an oral preparation, an intravenous injection preparation, an intramuscular injection preparation, a topical preparation for the skin, or an inhalation preparation for the respiratory system.

[0030] The fifth technical solution of the present invention provides a method for constructing a mouse animal model of myocardial hypertrophy and decompensation, wherein the mouse animal model is obtained by specifically knocking out the Art3 gene by transcribing miR30-shRNA through the cTNT promoter mediated by the AAV9 virus, and is used to study myocardial hypertrophy and heart failure, and to screen drugs for treating myocardial hypertrophy and heart failure.

[0031] Compared with the prior art, this application has at least the following beneficial effects:

[0032] (1) This application is the first to study the mechanism of Art3 gene and cardiomyocyte maturation, proving that it can be used as a marker for cardiomyocyte maturation.

[0033] (2) This application studies the relationship between the Art3 gene and cardiomyocyte hypertrophy, heart failure, and myocardial remodeling.

[0034] (3) Based on the function of Art3 gene, the present application prepares a drug for treating heart failure and myocardial remodeling. The drug can activate ITGA7 protein, a downstream target of Art3 gene, and thus rescue myocardial hypertrophy, which is of great clinical significance.

[0035] (4) The present application also provides a mouse animal model in which Art3 gene knockout leads to myocardial hypertrophy and decompensation, which is used to study myocardial hypertrophy and heart failure, and to screen drugs for the treatment of myocardial hypertrophy and heart failure, providing support for subsequent research. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The expression and distribution of Art3 gene in the whole tissue single-cell sequencing database; the marks in the figure indicate: A: THPA single-cell database; B: the distribution of the expression abundance of Art3 gene in various cardiac tissue cell types; C: the expression heat map of Art3 in various cardiac tissue cell types; D: the expression changes of Art3 transcripts in the GSE51483 dataset during the development of mouse heart;

[0037] Figure 2Figure 2 shows the expression changes of Art3 gene in high-throughput myocardial remodeling and heart failure datasets; the labels in the figure indicate: A to E are the transcriptome data of Art3 transcripts in patients with heart failure (HF) (GSE135055), hypertrophic cardiomyopathy (HCM) (GSE89714), dilated cardiomyopathy (DCM) (GSE3586), idiopathic dilated cardiomyopathy (IDCM) (GSE1145), and hypertrophic cardiomyopathy (HCM) (GSE130036); F to H are the transcriptome data of Art3 in TAC-induced mouse heart failure models (GSE112055, GSE1621, and GSE101977). Gene expression; I is a volcano plot of differentially expressed proteins in high-throughput mass spectrometry data (PXD018678) between patients with dilated cardiomyopathy (DCM) and healthy subjects (Healthy, n=15; DCM, n=14; p<0.05); J is a volcano plot of differentially expressed proteins in high-throughput Ribo-seq data between patients with dilated cardiomyopathy (DCM) and healthy subjects (Healthy, n=15; DCM, n=65; p<0.05); I~J indicate the expression of Art3 and heart failure-related differentially expressed genes SAA1, MYL7, MYH7, NPPA, NPPB, and FBLN5;

[0038] Figure 3The effects of knocking down Art3 on cardiac function in heart failure mouse models were detected by echocardiography; the symbols in the figure indicate: A: Experimental scheme for analyzing cardiac function of NC and shART3 mice after sham or TAC surgery by echocardiography; B: PW mode of echocardiography was used to measure the maximum blood flow velocity in the aortic arch of NC and shART3 mice undergoing sham or TAC surgery; C: M mode of echocardiography was used to observe cardiac function of NC and shART3 mice 5 weeks after sham or TAC surgery; D to L are: Peak velocity and Peak gradient of aortic arch in NC and shART3 mice 1 week after TAC surgery; Left ventricular (LV) volume in systole (LV vols), left ventricular ejection fraction, left ventricular shortening fraction, and left ventricular end-diastolic internal dimension in NC and shART3 mice 5 weeks after TAC surgery. The measurement values ​​of left ventricular end-diastole (LVIDd), left ventricular internal dimension in end-Systole (LVIDs), left ventricular posterior wall thickness in end-diastole (LVPWd), and left ventricular posterior wall thickness in end-Systole (LVPWs);

[0039] Figure 4 The effect of knocking down Art3 on the downstream signaling pathway of ITGA7; the marks in the figure indicate: AB: The rescue effect of Ciclopiroxolamine on the PE-induced cardiac hypertrophy model; C: The effect of PE treatment on the downstream signaling pathway of ITGA7 after knocking down Art3; D: The effect of knocking down Art3 on the apoptosis rate of NRCM48h cells.

[0040] Figure 5 Schematic diagram of the mechanism by which Art3 antagonizes the cardiac hypertrophy signaling pathway by modifying ITGA7 with ADP-ribosylation. DETAILED DESCRIPTION

[0041] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below in conjunction with specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, several variations and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0042] All raw materials of the present invention are not particularly limited to their sources, and can be purchased on the market or prepared according to conventional methods known to those skilled in the art. The kit involved in this embodiment is not limited to a certain manufacturer, and those skilled in the art should know that any commercially available one that can meet the corresponding functions can be used.

[0043] Example 1 Specific expression of Art3 gene in cardiomyocytes

[0044] This example uses a single cell data analysis method to prove that the Art3 gene is specifically expressed in cardiomyocytes and is related to the mature state of cardiomyocytes. The results are as follows Figure 1 As shown. The THPA single cell database and GEO dataset (Gene Expression Omnibus Series) used below are commonly used databases in this field, and the data retrieval method and acquisition method are all known to those in this field. After obtaining the GEO dataset, data processing was performed using the OmicVerse multi-omics data analysis method.

[0045] Figure 1 middle, Figure 1 A represents the expression abundance distribution of Art3 transcripts (during transcription, the precursor of mRNA, Pre-mRNA, is formed first, and then mature mRNA, i.e., transcripts, is formed after shearing) in the whole body tissue cell types in the THPA (The Human Protein Atlas database) single-cell database. The blue band Spermatocytes on the far left in the figure represents spermatocytes, and the second red band Cardiomyocyte represents cardiomyocytes, indicating that the transcription of Art3 in cardiomyocytes is second only to spermatocytes, and is much higher than other types of cells, indicating that the expression of Art3 gene in cardiomyocytes is specific.

[0046] Figure 1 B shows the expression abundance distribution of Art3 in various cardiac tissue cell types. Among them, the Cardiomyocytes c-3 circled in red are the most mature cardiomyocytes, and their Art3 transcription level is also the highest, indicating that the transcription level of the Art3 gene is positively correlated with the maturity of cardiomyocytes.

[0047] Figure 1 C is the expression heat map of Art3 in various cardiac tissue cell types. Among them, MYH7, MYL2, MYL7, and TTN are the marker genes of cardiomyocytes. The expression levels of MYL7 and TTN are proportional to the maturity of cardiomyocytes. It can be seen that Cardiomyocyte c-3 is the most mature cardiomyocyte and has the highest expression level of Art3. Figure 1 B is consistent.

[0048] Figure 1 D shows the expression changes of Art3 transcripts during mouse heart development in the GSE51483 dataset (Gene Expression Omnibus Series, GSE for short), indicating that the expression level of Art3 gradually increases with the development and maturation of the mouse heart.

[0049] Example 2 Downregulation of Art3 gene in heart failure and myocardial remodeling

[0050] In this example, samples from patients with heart failure and myocardial remodeling are analyzed. The samples can be retrieved from a database according to the data set number. The database is the THPA single cell database and the GEO data set (Gene Expression Omnibus Series) mentioned in Example 1. The results are as follows: Figure 2 shown.

[0051] 1. Sample source and analysis method:

[0052] In this example, the OmicVerse multi-omics data analysis method was used to analyze the differentially expressed genes in the heart failure and myocardial remodeling samples (GSE135055, GSE89714, GSE3586, GSE1145, GSE130036, GSE112055, GSE1621, GSE101977, PXD018678) in the accessible high-throughput data of mouse and human heart disease, and the changes in Art3 expression levels between the disease group and the control group were observed.

[0053] The expression level of Art3 gene is generally measured by the amount of mRNA transcribed by the gene, that is, the relative content of its mRNA is detected; the expression level of Art3 gene can also be measured by protein expression level and ribosome translation level. The mRNA extraction method is a conventional operation in this field, generally using an mRNA extraction kit and operating according to the steps provided by the kit; the protein expression level is measured by protein mass spectrometry; the ribosome translation level is measured by ribosome imprint sequencing (Ribo-seq); since this embodiment only involves analysis of the database and does not involve wet experiments, specific experimental operation methods and steps are not provided.

[0054] (II) Sample testing method and data calculation:

[0055] Figure 2 AH is RNA-seq (i.e., transcriptome sequencing technology, which uses high-throughput sequencing technology for sequencing analysis to reflect the expression level of mRNA); the calculation formula in the figure is: Expression level fold = log2 (1 + count), where count refers to the number of reads mapped to each gene.

[0056] I is the protein mass spectrum, which is detected on a mass spectrometer (Orbitrap mass analyzer).

[0057] J stands for Ribo-seq, which sequences the translating RNA fragments (RPFs) and analyzes the translation efficiency at the post-transcriptional translation level, revealing the inconsistency between the transcriptome and proteome results.

[0058] The statistical methods for the above data are as follows: all results are presented as mean ± SD; Figure 2 AH was analyzed using T test.

[0059] (III) Experimental results

[0060] Figure 2 I and Figure 2 In J, each point represents a detected gene, red indicates up-regulated gene expression, and green indicates down-regulated gene expression; the horizontal axis is Log 2 (fold change), the further the point is from the center, the greater the difference; the vertical axis is -Log 10 (P-value), the closer the point is to the top of the graph, the more significant the difference.

[0061] Figure 2 The results showed that the expression level of Art3 gene was significantly downregulated in the cardiomyocytes of the samples, which was correlated with heart failure and myocardial remodeling. These data sets all confirmed that Art3 gene was downregulated at the transcriptional and translational levels when myocardial remodeling occurred ( Figure 2 AJ).

[0062] Example 3 Knockout of Art3 gene leads to myocardial hypertrophy and decompensation

[0063] In this example, mice with knockdown of Art3 gene were prepared by adeno-associated virus, and the manifestations of myocardial hypertrophy and heart failure were observed. For the specific experimental process, please refer to Figure 3 A.

[0064] (I) Construction of Art3 gene knockdown mouse model

[0065] (1) AAV9 virus construction: This example first designed and packaged an AAV9 virus based on the miR30-shRNA interference system. The upstream of miR30-shRNA is the cTNT (Troponin T2, Cardiac Type, TNNT2) promoter. This design can achieve the effect of specifically knocking down Art3 expression in cardiomyocytes. The shART3 sequence refers to SEQ.ID.No.1; the NC control sequence refers to SEQ.ID.No.2. Taking the shART3 group as an example, the specific steps for constructing the AAV9 virus based on the miR30-shRNA interference system are as follows:

[0066] 1) Gene synthesis is performed on the insert fragment according to the reference sequence, and both ends of the synthesized sequence have homology arms that can undergo homologous recombination with the plasmid vector after enzyme digestion.

[0067] 2) Double enzyme digestion of plasmid vector: Take about 5 μg of vector and target gene fragment respectively and perform double enzyme digestion reaction.

[0068] The enzyme digestion reaction system and conditions are as follows: 10×Buffer: 2 μL; restriction endonuclease 1 (Nhe I): 1 μL; restriction endonuclease 2 (Sal I): 1 μL; vector: 1-2 μg; ddH2O: make up to 20 μL. Digestion at 37°C for 3 hours, heat inactivation at 80°C for 10 minutes.

[0069] 3) The purified enzyme-cut vector and the insert fragment were mixed at an appropriate molar ratio (1:3), and then homologous recombinase was added to react at 50°C for 15 min.

[0070] 4) Transformation: Transform the ligation product into competent cells. The specific steps are as follows:

[0071] a) Take 100 μL competent cells and add the pre-cooled ligation product. The volume should not exceed 10% of the competent cells. Gently rotate the EP tube to mix. b) Place on ice for 30 minutes to fully incubate the DNA and competent cells. c) Heat shock at 42°C for 90 seconds. d) Place on ice for 5 minutes. Do not shake the EP tube at this time, otherwise the transformation efficiency will be reduced.

[0072] 5) Add 1000 μL of LB medium and culture at 37°C with shaking at 250 rpm for 1 h.

[0073] 6) Spread the transformed bacteria on LB plates containing the corresponding antibiotics, place them in a humidified box, and culture them at 37°C overnight.

[0074] 7) Use a 10 μL pipette tip to carefully pick 4-5 single clones for colony PCR identification to confirm the positive clones.

[0075] 8) Finally, the positive clones were verified by Sanger sequencing (Sanger method) to confirm the successful construction of AAV9 virus.

[0076] (2) AAV9 virus injection mouse model construction: 40 6-week-old C57BL / 6 mice were selected for AAV9 virus injection. Each mouse was injected with 5×10 11 AAV9 virus was used to construct the Art3 gene knockdown mouse model shART3; except for the injection operation, the other steps of the control group were the same, and the Art3 gene was not knocked down, that is, the NC group.

[0077] (3) Virus expression and TAC surgery: Four weeks after virus expression, mice underwent aortic arch constriction (TAC) surgery. Five weeks after TAC surgery, echocardiography was performed using a small animal ultrasound device (Vevo F2 LT Imaging System, Fujifilm VisualSonics, Toronto, Canada) to detect cardiac function. The sham group was used as a control. The TAC surgery was a routine operation in the field, and the surgical instruments required for the operation were sterilized by high temperature or 75% ethanol immersion before use.

[0078] (II) Post-test data calculation method

[0079] Figure 3 In D, the formula for calculating the peak velocity of the aortic arch is:

[0080] Vpeak=ΔP / ρ; wherein ΔP represents the pressure difference and ρ represents the blood density.

[0081] Figure 3 In E, the calculation formula for the maximum pressure gradient (Peak Gradient) of the aortic arch is:

[0082] ΔG=4×(Vmax) 2 ; Wherein, ΔG represents the pressure gradient (unit: mmHg), and Vmax represents the maximum flow velocity of the aortic arch (unit: m / s).

[0083] Figure 3In G, the left ventricular ejection fraction (EF) is calculated as:

[0084] EF (%) = (LVEDV - LVESV) / ​​LVEDV x 100%; wherein LVEDV is the left ventricular end-diastolic volume, and LVESV is the left ventricular end-systolic volume.

[0085] Figure 3 In H, the calculation formula for the fraction shortening (FS) is:

[0086] FS=(LVDd-LVDs) / LVDd×100%; wherein LVDd represents the left ventricular end-diastolic diameter, and LVDs represents the left ventricular end-systolic diameter.

[0087] The above LVEDV, LVESV, LVDd, LVDs, and other data for which no formula is provided can be read directly from the instrument results.

[0088] (III) Experimental results

[0089] The results of this example are summarized in Figure 3 Statistical methods: All results are presented as mean ± SD; DL was analyzed by 2-way ANOVA. Figure 3 The PW mode in B is the pulse spectrum mode; Figure 3 The M mode in C is a motion mode, which records motion data along one or more lines.

[0090] comprehensive Figure 3 The data showed that the TAC group mouse models used in this study had similar aortic arch pressure states, with the peak velocity of the aortic arch being about 4000 mm / s and the peak gradient of the aortic arch being 60 mmHg (see Figure 3 B, Figure 3 DE), which were significantly improved compared with the sham operation group (sham).

[0091] In this example, echocardiography was further used to evaluate the left ventricular function and structure of Art3 knockdown mice in the TAC group, and it was found that the left ventricular volume in systole (LV vols) increased, the ejection fraction (EF) decreased, the fraction shortening (FS), the left ventricular end-systolic diameter (LVIDs) decreased, the left ventricular end-diastolic diameter (LVIDd) increased, the left ventricular posterior wall end systole (LVPWs) increased, and the left ventricular posterior wall end diastole (LVPWd) increased (see Figure 3 C, Figure 3 FL).

[0092] In summary, the results of the present study showed that five weeks after TAC surgery, the cardiac hypertrophy of mice in which the Art3 gene was knocked down was aggravated and the cardiac function was impaired compared with that in the NC group.

[0093] Example 4 Activating the downstream target of Art3 gene ITGA7 protein to rescue myocardial hypertrophy

[0094] This example activates the downstream target ITGA7 protein of Art3 gene by drugs or gene therapy to observe its rescue effect on myocardial hypertrophy. This example is mainly divided into three parts of experimental content, including the detection of the levels of myocardial hypertrophy marker genes Nppa and Nppb, Western Blot detection and cell apoptosis experiment.

[0095] (1) Detection of the levels of myocardial hypertrophy marker genes Nppa and Nppb. The culture of mouse myocardial cells and drug treatment methods are as follows:

[0096] a. In primary cultured neonatal rat cardiomyocytes (NRCM), Art3 gene was silenced by siRNA transfection for 24 h; the transfection here is a routine laboratory operation, mainly including cell seeding (ensuring that the confluence is about 70% during transfection), preparation of transfection complex solution, transfection and cell culture;

[0097] b. The primary cultured cells were treated with 1 μM Ciclopirox olamine (Ciclopirox olamine, a small molecule compound, namely Ciclopiroxethanolamine, as an activator of ITGA7 protein) and 50 μM Phenylephrine (PE, hereinafter referred to as PE, stands for phenylephrine), respectively, and samples were collected after 24 hours of induction;

[0098] c. The levels of myocardial hypertrophy marker genes Nppa and Nppb were detected by qPCR, respectively. Figure 4 A and Figure 4 B.

[0099] (2) Western Blot

[0100] a. In primary cultured neonatal rat cardiomyocytes (NRCM), Art3 gene was silenced by siRNA transfection for 24 h; the transfection procedure was the same as in (1);

[0101] b. Treat primary cells with 50 μM PE for 10 min and collect samples for Western Blot detection. Figure 4 C.

[0102] (3) Cell apoptosis experiment

[0103] a. In primary cultured neonatal rat cardiomyocytes (NRCM), Art3 gene was silenced by siRNA transfection for 24 h; the transfection procedure was the same as in (1);

[0104] b. After culturing Art3 knockdown neonatal rat cardiomyocytes (NRCM) in serum-free culture for 48 h, the apoptosis rate of NRCM cells was observed by TUNEL staining. Figure 4 D.

[0105] In the above steps, the siRNA transfection operation, qPCR detection operation, Western Blot, and TUNEL staining are all routine operations in the art, and can be performed with reference to the kit and its instructions, or according to commonly used methods in the art.

[0106] (4) Experimental results

[0107] The results of this example are summarized in Figure 4 Statistical methods: All results are presented as mean ± SD; A, B, C were analyzed by two-way ANOVA, and D was analyzed by T-test.

[0108] The levels of myocardial hypertrophy marker genes Nppa and Nppb in all treatment groups in A to B were significantly decreased. In the figure: PE group is the group treated with PE, and PBS group is the group treated with an equal amount of PBS buffer as a control. siART3 is the experimental group that silences the Art3 gene, and NC group is the control group that does not silence the Art3 gene; each group is divided into Ciclopiroxolamine treatment group and vehicle control group. At least 3 parallels are performed for each group to reduce errors.

[0109] In C, the calculation formula is p-p38 / T-p38 ratio=expression level of p-p38 / expression level of total p38;p-JNK / T-JNK ratio=expression level of p-JNK / expression level of total JNK. p-p38 represents phosphorylated p38, T-p38 represents the total amount of p38 protein (total p38), p-JNK represents phosphorylated JNK, and T-JNK represents the total amount of JNK protein (total JNK). The results show that knocking down Art3 will hinder the activation of p38 and JNK signaling pathways; in the corresponding statistical graph on the right, p-p38 / T-p38ratio and p-JNK / T-JNKratio will increase under PE treatment, but p-p38 / T-p38 ratio and p-JNK / T-JNK ratio will no longer increase after knocking down Art3.

[0110] In D, red indicates TUNEL signal, and blue indicates DAPI signal. TUNEL Stained (%) = number of red cells in the visual field / number of blue cells in the visual field × 100%. The above results show that activation of ITGA7 protein, a downstream target of Art3 gene, can rescue cardiac hypertrophy.

[0111] Finally, this application provides a schematic diagram of the mechanism by which Art3 antagonizes the cardiac hypertrophy signaling pathway by modifying ITGA7 with ADP-ribosyl groups, see Figure 5 . Art3 expression is downregulated during myocardial hypertrophy, blocking the ADP-ribosylation of ITGA7, resulting in decreased integrin activity, inhibiting the FAK-p38 / JNK signaling pathway, and then activating NFAT transcription factors, increasing the expression of myocardial hypertrophy genes (such as ANP, BNP, MYH7, MB), and promoting the occurrence and development of heart failure. When the ITGA7 activator is used to simulate the normal expression level of the Art3 gene, ITGA7 protein is activated, integrin activity is increased, and the FAK-p38 / JNK signaling pathway is activated, thereby inhibiting the overactivation of NFAT transcription factors and rescuing myocardial hypertrophy.

[0112] In summary, several embodiments of the present application firstly prove, through database comparison analysis, that the Art3 gene is specifically expressed in cardiomyocytes and is related to the mature state of cardiomyocytes; then, through patient sample analysis, it is confirmed that the Art3 gene is downregulated in heart failure and myocardial remodeling; based on a mouse model, it is confirmed that knocking out the Art3 gene can lead to myocardial hypertrophy decompensation; finally, through drug therapy or gene therapy, the downstream target ITGA7 protein of the Art3 gene is activated to rescue myocardial hypertrophy.

[0113] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0114] The gene sequences involved in this application are:

[0115] SEQ.ID.No.1 (shART3 sequence in Example 3):

[0116] acgtgggaaagtttcttaataatagtgaagccacagatgtattattaagaaactttcccacgg;

[0117] SEQ.ID.No.2 (the sequence of the NC control group in Example 3):

[0118] ccctaaggttaagtcgccctcgtagtgaagccacagatgtacgagggcgacttaaccttaggt.

Claims

1. Application of Art3 gene in the preparation of drugs for the treatment of heart failure and myocardial remodeling.

2. The use according to claim 1, characterized in that: The Art3 gene is specifically expressed in normal cardiac myocardial cells and serves as a marker for cardiac myocardial cell maturation; the expression level of the Art3 gene is downregulated in myocardial cells with heart failure and myocardial remodeling; normal myocardial cells and myocardial cells with heart failure and myocardial remodeling are distinguished by the expression level of the Art3 gene; heart failure and myocardial remodeling are determined by the expression level of the Art3 gene in diseased myocardial cells being 50% lower than the expression level in the normal group.

3. The use according to claim 1, characterized in that: The Art3 gene has a downstream target ITGA7 protein, and the ART3 enzyme mediates ADP-ribosylation modification of the ITGA7 protein gene; after ITGA7 is modified by ADP-ribosylation, the expression of ITGA7 protein is activated, thereby rescuing myocardial hypertrophy.

4. Use of an ITGA7 protein activator in the preparation of a drug for treating heart failure and myocardial remodeling, characterized in that: The ITGA7 protein activator is a small molecule compound; the small molecule compound is Ciclopiroxethanolamine, and its concentration in the pharmaceutical preparation is 1 μM to 10 μM; the ITGA7 protein activator can activate the expression of ITGA7 protein, a downstream target of the Art3 gene, thereby rescuing symptoms of myocardial hypertrophy and treating heart failure and myocardial remodeling.

5. A drug for treating heart failure and myocardial remodeling, characterized in that: The medicine comprises an active ingredient and an auxiliary material; the active ingredient is an ITGA7 protein activator, and the auxiliary material is a pharmaceutically acceptable carrier.

6. A drug for treating heart failure and myocardial remodeling according to claim 5, characterized in that: The pharmaceutically acceptable carrier includes: at least any one of a filler / diluent, a lubricant, a binder or a disintegrant; The filler / diluent is any one of lactose, mannitol, microcrystalline cellulose, calcium dihydrogen phosphate, cellulose lactose or microcrystalline cellulose colloidal silicon dioxide co-processed product or a mixture thereof; The lubricant is any one of stearic acid, magnesium stearate, calcium stearate, sodium stearyl fumarate, hydrogenated vegetable oil or glyceryl behenate or a mixture thereof; The binder is any one of pregelatinized starch, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone, copovidone, microcrystalline cellulose, ethyl cellulose or methyl cellulose, or a mixture thereof; The disintegrant is any one of sodium starch glycolate, calcium silicate, cross-linked sodium carboxymethyl cellulose or low-substituted hydroxypropyl cellulose or a mixture thereof.

7. The use of a drug for treating heart failure and myocardial remodeling according to claim 5, characterized in that: In the application, the activator needs to be mixed with at least one pharmaceutically acceptable carrier to prepare a pharmaceutical composition.

8. The use of a drug for treating heart failure and myocardial remodeling according to claim 7, characterized in that: The pharmaceutical composition is any one of an oral preparation, an intravenous injection preparation, an intramuscular injection preparation, a topical preparation for skin application or an inhalation preparation for the respiratory system.

9. A method for constructing a mouse animal model of myocardial hypertrophy decompensation, characterized in that: The construction method is to knock out the Art3 gene of mice.

10. The method for constructing a mouse animal model of myocardial hypertrophy decompensation according to claim 9, characterized in that: The model is used to study cardiac hypertrophy and heart failure, and to screen drugs for treating cardiac hypertrophy and heart failure.

Images