Pantothenate synthetase mutants and uses thereof

Abstract

The application relates to the technical field of enzyme engineering, and discloses a pantothenate synthetase mutant and application thereof. The application carries out site-directed mutation on the 62th, 123th and 189th amino acids of pantothenate synthetase derived from Escherichia coli, carries out site-directed and oriented mutation to change the amino acid residues of the protein by adopting an alanine scanning strategy near an active pocket, mutates the 62th bulky alanine into isoleucine and / or the 123th amino acid arginine into glutamine and / or the 189th arginine into isoleucine, improves the efficiency of pantothenate synthetase in catalyzing D-panthenol, and improves the yield of D-panthenol. Finally, when the above sites are simultaneously mutated, the recombinant Escherichia coli of the pantothenate synthetase can improve the efficiency of pantothenate synthetase in catalyzing D-panthenol synthesis by 1.32 times, and the genetically engineered strain carrying the constructed pantothenate synthetase mutant can improve the yield in the panthenol fermentation in a flask by 3.65 times.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to a pantothenic acid synthase mutant and its applications. Background Technology

[0002] Panthenol, also known as provitamin B5, has the chemical formula C9H. 19 NO4, with a relative molecular weight of 205.25, panthenol exists in two conformations: D-form and L-form, with only the D-form possessing biological activity. D-panthenol is rapidly oxidized to D-pantothenic acid in vivo, participating in the metabolism of acetyl-CoA. Therefore, it is often used as a vitamin B5 isoform in animal feed to enhance its nutritional value. Furthermore, D-panthenol has wide applications in numerous other fields, including pharmaceuticals, cosmetics, and hair care products. The D-panthenol market is expected to continue growing.

[0003] Panthenol is synthesized industrially via chemical methods. Currently known methods for synthesizing D-panthenol primarily involve the chemical condensation of D-panthenol and 3-aminopropanol. The synthesis of D-panthenol involves the enzymatic or chemical resolution of racemic D-panthenol. Racemic panthenol is often obtained through multiple chemical reactions involving small molecules, including the aldol-alcohol reaction between isobutyraldehyde and formaldehyde, the addition reaction of hydrogen cyanide with the generated hydroxy aldehyde, the acid hydrolysis of the formed cyanohydrin with the corresponding carboxylic acid, and the lactone formation of D-panthenol. This method is currently the most widely used in industry, but it also has several problems. For example, because the panthenol substrate requires a strict D-conformation, the L-panthenol needs to be racemicized during production, which undoubtedly increases the cost of D-panthenol. Furthermore, this process requires large amounts of organic reagents and toxic cyanides, which does not meet environmental requirements. In contrast, microbial fermentation has the advantages of low cost, environmental friendliness, and sustainability.

[0004] Existing microbial direct fermentation methods for producing D-pantothenic acid mainly include Escherichia coli (Escherichia coli) Escherichia coli ), Corynebacterium glutamicum ( Corynebacterium glutamicum (e.g., etc.). In the bio-fermentation production of D-pantothenic acid, pantothenic acid synthase plays a crucial role, catalyzing the condensation of D-pantolysin and β-alanine into D-pantothenic acid in the presence of ATP. However, currently, the efficiency of pantothenic acid synthase in catalyzing the conversion of D-pantolysin and 3-aminopropanol to D-panthenol is relatively low. Summary of the Invention

[0005] In order to solve the technical problem of low catalytic efficiency of pantothenate synthetase, the application provides a pantothenate synthetase mutant and application thereof. The application improves the efficiency of pantothenate synthetase in catalyzing D-pantothenyl alcohol and the yield of D-pantothenyl alcohol by site-directed mutation of the 62th, 123th and 189th amino acids of pantothenate synthetase derived from Escherichia coli, site-directed mutation of amino acid residues of the protein by an alanine scanning strategy near the active pocket, mutation of the 62th phenylalanine to isoleucine and / or mutation of the 123th amino acid arginine to glutamine and / or mutation of the 189th arginine to isoleucine.

[0006] The specific technical scheme of the application is as follows:

[0007] In a first aspect, the application provides a pantothenate synthetase mutant, which is obtained by single-point mutation or multi-point combination mutation of the following sites of the amino acid sequence shown in SEQ ID NO. 1:

[0008] the 62th phenylalanine is mutated to isoleucine;

[0009] the 123th amino acid arginine is mutated to glutamine;

[0010] the 189th arginine is mutated to isoleucine.

[0011] The application improves the efficiency of pantothenate synthetase in catalyzing D-pantothenyl alcohol and the yield of D-pantothenyl alcohol by site-directed mutation of the 62th, 123th and 189th amino acids of pantothenate synthetase derived from Escherichia coli (the amino acid sequence is shown in SEQ ID NO. 1), site-directed mutation of amino acid residues of the protein by an alanine scanning strategy near the active pocket, mutation of the 62th phenylalanine to isoleucine and / or mutation of the 123th amino acid arginine to glutamine and / or mutation of the 189th arginine to isoleucine.

[0012] As a preferred, the pantothenate synthetase mutant is obtained by multi-point combination mutation of the following sites of the amino acid sequence shown in SEQ ID NO. 1: the 62th phenylalanine is mutated to isoleucine, the 123th amino acid arginine is mutated to glutamine, and the 189th arginine is mutated to isoleucine.

[0013] When the 62th, 123th and 189th amino acids of the pantothenate synthetase are simultaneously mutated, the recombined Escherichia coli of the pantothenate synthetase can improve the efficiency of pantothenate synthetase in catalyzing D-pantothenyl alcohol by 1.32 times, and the yield of D-pantothenyl alcohol in the shake flask fermentation of the genetically engineered strain carrying the constructed pantothenate synthetase mutant is improved by 3.65 times, and the efficiency of D-pantothenyl alcohol synthesis is maximized.

[0014] In a second aspect, the present application provides a gene encoding the pantothenate synthetase mutant.

[0015] In a third aspect, the present application provides a recombinant vector comprising the gene.

[0016] Preferably, the vector is pTrc99a or pET-28a(+).

[0017] In a fourth aspect, the present application provides a genetically engineered bacterium comprising the gene or the recombinant vector.

[0018] Preferably, the genetically engineered bacterium is Escherichia coli.

[0019] In a fourth aspect, the present application provides use of the pantothenate synthetase mutant in the preparation of D-panthenol.

[0020] Compared with the prior art, the present application has the following technical effects:

[0021] 1. The present application improves the efficiency of pantothenate synthetase in catalyzing D-panthenol and the yield of D-panthenol by site-directed mutagenesis of the 62nd, 123rd and 189th amino acids of pantothenate synthetase (amino acid sequence shown as SEQ ID NO. 1) derived from Escherichia coli, site-directed mutagenesis of amino acid residues near the active pocket, mutation of the 62nd phenylalanine to isoleucine and / or mutation of the 123rd amino acid arginine to glutamine and / or mutation of the 189th arginine to isoleucine.

[0022] 2. When the 62nd, 123rd and 189th amino acids of pantothenate synthetase are simultaneously mutated, the recombinant Escherichia coli of pantothenate synthetase can improve the efficiency of pantothenate synthetase in catalyzing D-panthenol synthesis by 1.32 times, and the genetically engineered strain carrying the constructed pantothenate synthetase mutant improves the yield of D-panthenol in shake flask fermentation by 3.65 times, greatly improving the efficiency of D-panthenol synthesis. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 The present application is illustrated by the following gel electrophoresis figures: Figure 1 a is a nucleic acid gel electrophoresis figure when pET-28a(+)-panC and pTrc99a-panC are constructed, Figure 1 In a, M1 is a 250 kb marker, 1 is a linearized pTrc99a vector, 2 is an amplified product of the panC fragment connected with pTrc99a, 3 is a linearized pET-28a(+) vector, and 4 is an amplified product of the panC fragment connected with pET-28a(+); Figure 1 b is a PCR amplification product of the recombinant plasmid pTrc99a-panC,Figure 1 b M1 is 250 kb marker, 1 is single point mutant amplification product, 2 is double point mutant amplification product, 3 is three point mutant amplification product; Figure 1 c is the PCR amplification product of recombinant plasmid pET-28a(+)-panC, Figure 1 c M1 is 250 kb marker, 1 is single point mutant amplification product, 2 is double point mutant amplification product, 3 is three point mutant amplification product.

[0024] Figure 2 Figure is the relative enzyme activity and conversion rate determination results of wild type and mutant.

[0025] Figure 3 Figure is the fermentation ubiquinol production and biomass determination results of ubiquinol production strain. DETAILED DESCRIPTION

[0026] The present application will be further described in conjunction with the following examples. Those skilled in the art will be able to implement the present application based on these descriptions. In addition, the examples of the present application involved in the following descriptions are generally only a part of the examples of the present application, but not all the examples. Therefore, all other examples obtained by those skilled in the art based on the examples in the present application without making creative efforts shall fall within the scope of protection of the present application.

[0027] In the following examples, the determination method of pantothenate synthetase enzyme activity is as follows:

[0028] (1) Enzyme activity determination reaction system: 25 mM pantoic acid, 25 mM 3-aminopropanol, 4.5 mM ATP, 10 mM magnesium chloride, 15 mM potassium chloride, and the pH is adjusted to 8.0.

[0029] (2) Take 20 μL of enzyme solution and add it to 1.1 mL of the reaction system, mix well, and react at 30°C for 24 h, then add 10 μL of 6M hydrochloric acid to the system, centrifuge for 10 min, and take 200 μL of the inner liner tube of the liquid phase bottle, and perform high performance liquid detection. The control group uses deionized water instead of crude enzyme solution.

[0030] (3) 1 enzyme activity unit (U) is defined: under the above conditions, the amount of enzyme required for 1 mL of enzyme solution to produce 1 μg of D-ubiquinol per minute. Prepare D-ubiquinol solutions of different concentrations, and detect the peak area using liquid phase, and calculate the enzyme activity according to the standard curve. Specific enzyme activity (U / mg) = enzyme activity / protein mass.

[0031] In the following examples, the method for purifying pantothenate synthetase is as follows: the nickel column filler is slowly poured into the chromatography column, and is vertically placed. After the filler is completely settled, the nickel column is installed. The AKTA protein purification instrument is used to purify the protein. After the instrument is started, the parameters are set. The distilled water after ultrasonic is used for cleaning, and the 20% ethanol is washed away. Then, the 20 mM PB buffer after ultrasonic is used to balance the column. The crude enzyme solution is placed in ice, and is slowly fed through the sample pipeline at a rate of 1.0 mL / min. The higher the absorption peak, the greater the amount of enzyme. After the feeding is completed, the low-concentration imidazole buffer (10 mM imidazole) is first used to flow through the Ni affinity column at a rate of 2~5 mL / min. About 5 column volumes are used to remove impurities. After the baseline is balanced, the high-concentration imidazole buffer (60 mM imidazole) is used to elute the target protein. The protein is collected and placed in ice. Finally, the ultrapure water is used for cleaning. The nickel column filler is stored in 20% ethanol solution and stored at 4 ℃. The collected enzyme solution is placed in a dialysis bag and dialyzed in 20 mM PB buffer at pH 8.0 overnight. For specific operation details, refer to Enzyme Methods E-Book.

[0032] In the following examples, the information about the primers is shown in Table 1.

[0033] Table 1 Primer sequence list

[0034] Primer name Sequence 5 ， -3 ， ]]> F62I-F CGTTAACCCGATGCAGATTGACCGCCCGGAAGAT F62-R CTGCATCGGGTTAACGAAAATACTGACGACGACCA R123Q-F CCATGCTGGAAGGTGCCAGCCAACCGGGACATTTTCGCGGCG R123-R GCTGGCACCTTCCAGCATGGTCGAAAGGCCAGGAAC R189I-F GGTCTGGCGCTAAGTTCCATTAACGGTTATCTGACGGCGGA R189-R GGAACTTAGCGCCAGACCGTCTTTGGCGC panC-trc-F TTTCACACAGGAAACAGACCGTGTTAATTATCGAAACCCTGCCG panC-trc-R CTCTCATCCGCCAAAACAGCCTTACGCCAGCTCGACCATTTTG pTrc-F GGCTGTTTTGGCGGATGAGAG pTrc-R GGTCTGTTTCCTGTGTGAAATTCC panC-28a-F CCGAATTCGAGCTCCGTCGAGTGTTAATTATCGAAACCCTGCC panC-28a-R TTGTTAGCAGCCGGATCTCATTACGCCAGCTCGACCATTT pET28a-F TGAGATCCGGCTGCTAACAAA pET28a-R TCGACGGAGCTCGAATTCGG

[0035] Example 1 Construction of pantothenate synthetase expression recombinant bacteria

[0036] In this example, the pantothenate synthetase expression recombinant bacteria is constructed, and the following steps are performed:

[0037] The E. coli W3110 (purchased from the American Type Culture Collection (ATCC) website) is inoculated into 10 mL of LB test tube and cultured at 37 ℃ for 12 h with shaking. The bacterial cells are obtained by centrifugation at 12000 rpm. Then, the genomic DNA of E. coli is extracted by using the kit (FastDNA Kit® kit), and the desired target gene— panC pantothenate synthetase encoding gene, whose encoded pantothenate synthetase amino acid sequence is shown as SEQ ID NO. 1) is cloned. After the PCR product is verified by agarose gel electrophoresis, the gel electrophoresis map is shown in Figure 1 a figure, and it is observed that the band position is about 850 bp (lane 4 of Figure 1 a figure), which is consistent with the position of the target band. The one-step cloning is connected with the expression vector pET-28a (+) Figure 1 a3 lane), and is transformed into E. coli DH5α competent cells. The colony PCR product is sent for sequencing, and the sequencing result is consistent with panCThe base sequence of the gene was compared, and the recombinant plasmid was correctly extracted. The plasmid was transformed into E. coli BL21 (DE3) competent cells, and the single colony obtained by transformation was the target constructed engineering bacteria E. coli BL21-pET-28a(+)-panC. The successfully constructed engineering bacteria were preserved in a low-temperature glycerol tube. The preserved strain was streaked on a Kan plate and cultured in a 37°C incubator overnight. Single colonies were picked from the streaked plate and inoculated into a test tube containing 10 mL of sterile LB medium, and Kan resistance was added. The culture was incubated at 37°C and 180 rpm for 12 h. The bacteria in the low-temperature glycerol tube were inoculated into 100 mL of sterile LB medium at a 2% (v / v) inoculation amount, and Kan resistance was added. The culture was incubated at 37°C and 180 rpm until the OD600 value of the bacteria reached 0.7. 10 μL of IPTG stock solution (1M, same below) was added, and the culture was incubated at 28°C and 180 rpm for 12 h. The bacteria were collected and centrifuged at 8000 rpm and 4°C for 10 min to break the cells. The crude enzyme was obtained, and the enzyme activity was determined after purification. The results are shown in Table 2. Figure 2 wherein WT represents the wild-type enzyme activity, i.e., the enzyme activity of the culture of the engineering bacteria E. coli BL21-pET-28a(+)-panC constructed in this example.

[0038] Example 2 Effect of single-point mutation of pantothenate synthetase on expression of pantothenate synthetase enzyme activity

[0039] In this example, single-point mutation was performed on pantothenate synthetase to study the effect of mutation on the expression of pantothenate synthetase enzyme activity, according to the following steps:

[0040] Primers F62I-F and F62-R (as shown in Table 1) were designed, and pET-28a(+)-PanC constructed in Example 1 was used as a template for PCR. The 62nd phenylalanine was replaced with isoleucine. The PCR reaction conditions were 98°C for 5 min, 30 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 4 min, and 72°C for 10 min. The PCR amplification system was as follows: 1 μL of template, 1 μL of each upper and lower primer, 25 μL of Buffer, 1 μL of dNTP, 1 μL of enzyme, and 20 μL of ddH2O. The band size was verified by gel electrophoresis, and the results of agarose gel electrophoresis are shown in Figure 1Lane 1 in Figure c, and then the original template was digested. The obtained plasmid was named pET-28a(+)-panC(F62I). Then it was transformed into BL21 competent, coated on Kan plate, and positive colonies were picked up to obtain the mutant strain with site-directed mutation, named BL21-pET-28a(+)-panC(F62I) after overnight culture at 37℃ in a shaking incubator. The plasmid pET-28a(+)-panC(F62I) carried by the mutant strain was extracted. A single colony was picked up from the streak plate and inoculated into a test tube containing 10 mL sterile LB medium, and Kan resistance was added. The test tube was cultured at 37℃ with 180 rpm shaking for 12 h. The bacterial liquid in the test tube was inoculated into 100 mL sterile LB medium at a 2% (v / v) inoculation amount, and Kan resistance was added. The culture was incubated at 37℃ with 180 rpm shaking until the OD600 value of the bacterial liquid reached 0.7. Then 10 μL of IPTG stock solution was added, and the culture was incubated at 28℃ with 180 rpm shaking overnight. After the bacterial liquid was collected, cell disruption was performed by centrifugation at 8000 rpm and 4℃ for 10 min, and the crude enzyme was obtained. After purification of the crude enzyme, enzyme activity and product conversion rate were determined, and the relative enzyme activity was calculated. The results are shown in Figure 1. Figure 2 wherein F62I represents a mutant enzyme in which the phenylalanine at position 62 of pantothenate synthetase is mutated to isoleucine, i.e., the determination results of the pantothenate synthetase mutant expressed by the recombinant bacteria constructed in this example.

[0041] As shown in Figure 1, the enzyme activity of pantothenate synthetase was slightly improved when the phenylalanine at position 62 of the genetically engineered enzyme pantothenate synthetase was mutated to isoleucine, which was 1.07 times that of the starting strain (WT). Figure 2

[0042] Example 3 Effect of double-point mutation of pantothenate synthetase on expression of pantothenate synthetase enzyme activity

[0043] In this example, double-point mutation was performed on pantothenate synthetase to study the effect of mutation on the expression of pantothenate synthetase enzyme activity, according to the following steps:

[0044] Primers R123Q-F and R123-R (as shown in Table 1) were designed, and pET-28a(+)-panC(F62I) constructed in this example was used as a template for PCR to mutate the arginine at position 123 to glutamine. The PCR reaction conditions were 98℃ for 5 min, 30 cycles of 95℃ for 30 s, 55℃ for 30 s, 72℃ for 4 min, and 72℃ for 10 min. The PCR amplification system was as follows: 1 μL of template, 1 μL of each of the upper and lower primers, 25 μL of Buffer, 1 μL of dNTP, 1 μL of enzyme, and 20 μL of ddH2O. The band size was verified by gel electrophoresis as shown in Figure 2. Figure 1 ​As shown in lane c2, the original template was then digested. The resulting plasmid was named pET-28a(+)-panC(F62I / 123Q). It was then transformed into BL21 competent cells, plated on Kansas, and positive colonies were picked and cultured overnight at 37°C with shaking to obtain a site-directed mutant strain, named E. coli BL21-pET-28(+)-panC(F62I / R123Q). The plasmid pET-28a(+)-panC(F62I / 123Q) carried by the mutant strain was extracted. A single colony was picked from the streak plate and inoculated into a test tube containing 10 mL of sterile LB medium, Kansas antibiotic was added, and the culture was incubated at 37°C and 180 rpm for 12 h with shaking. The bacterial culture from the test tube was inoculated into 100 mL of sterile LB medium at a 2% (v / v) inoculation rate. Kansin antibiotic was added, and the culture was incubated at 37°C with shaking at 180 rpm until the OD600 value reached 0.7. Then, 10 μL of IPTG stock solution was added, and the culture was incubated overnight at 28°C with shaking at 180 rpm. After collecting the bacterial culture, the cells were lysed by centrifugation at 8000 rpm and 4°C for 10 min to obtain crude enzyme. The crude enzyme was purified, and its activity and product conversion rate were measured. The relative enzyme activity was calculated, and the results are shown in the table below. Figure 2 F62I / R123Q represents the mutant enzyme of pantothenic acid synthase, in which phenylalanine at position 62 is mutated to isoleucine and arginine at position 123 is mutated to glutamine. This is the measurement result of the pantothenic acid synthase mutant expressed by the recombinant bacteria constructed in this embodiment.

[0045] Depend on Figure 2 The results showed that when the phenylalanine at position 62 of the genetically engineered pantothenic acid synthase was replaced with isoleucine and the arginine at position 123 was mutated to glutamine, the pantothenic acid synthase activity was slightly increased, reaching 1.13 times that of the starting strain.

[0046] Example 4: Effect of three-point mutation of pantothenic acid synthase on pantothenic acid synthase activity expression

[0047] This embodiment involves a three-point mutation of pantothenic acid synthase to investigate the effect of the mutation on the expression of pantothenic acid synthase activity. The procedure is as follows:

[0048] Primers R189I-F and R189-R (as shown in Table 1) were used. PCR was performed using the constructed pET-28a(+)-panC(F62I / R123Q) as a template, mutating arginine at position 189 to isoleucine. The PCR reaction conditions were 98℃ for 5 min, 30 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 4 min), and 72℃ for 10 min. The PCR amplification system consisted of: 1 μL template, 1 μL each of forward and reverse primers, 25 μL buffer, 1 μL dNTP, 1 μL enzyme, and 20 μL ddH2O. The band size was verified by gel electrophoresis. Figure 1 As shown in lane c3, the original template was then digested. The resulting plasmid was named pET-28a(+)-panC(F62I / R123Q / 189I). It was then transformed into BL21 competent cells, plated on Kansas, and positive colonies were picked and cultured overnight at 37°C with shaking to obtain a site-directed mutant strain, named *E. coli* BL21-pET-28(+)-panC(F62I / R123Q / R189I). The plasmid carried by the mutant strain, pET-28a(+)-panC(F62I / R123Q / 189I), was extracted. A single colony was picked from the streak plate and inoculated into a test tube containing 10 mL of sterile LB medium, Kansas antibiotic was added, and the culture was incubated at 37°C and 180 rpm for 12 h with shaking. The bacterial culture from the test tube was inoculated into 100 mL of sterile LB medium at a 2% (v / v) inoculation rate. Kansin antibiotic was added, and the culture was incubated at 37°C with shaking at 180 rpm until the OD600 value reached 0.7. Then, 10 μL of IPTG stock solution was added, and the culture was incubated overnight at 28°C with shaking at 180 rpm. After collecting the bacterial culture, the cells were lysed by centrifugation at 8000 rpm and 4°C for 10 min to obtain crude enzyme. The crude enzyme was purified, and its activity and product conversion rate were measured. The relative enzyme activity was calculated, and the results are shown in the table below. Figure 2 F62I / R123Q / R189I represents the mutant enzyme in which phenylalanine at position 62 of pantothenic acid synthase is mutated to isoleucine, arginine at position 123 is mutated to glutamine, and arginine at position 189 is mutated to isoleucine. This is the measurement result of the pantothenic acid synthase mutant expressed by the recombinant bacteria constructed in this embodiment.

[0049] The results showed that when the phenylalanine at position 62 of the genetically engineered pantothenic acid synthase was replaced with isoleucine, the arginine at position 123 was mutated to glutamine, and the arginine at position 189 was changed to isoleucine, the pantothenic acid synthase activity was greatly improved, reaching 1.32 times that of the starting strain.

[0050] Example 5 Construction of engineered bacteria for D-panthenol production

[0051] This embodiment constructs engineered bacteria for D-panthenol production according to the following steps:

[0052] Escherichia coli W3110 was inoculated into 10 mL LB tubes and cultured at 37°C with shaking for 12 h. The bacterial cells were obtained by centrifugation at 12000 rpm. The genome of the E. coli was extracted using a kit (FastDNA Kit®), from which the desired target gene was cloned. panC After verification by agarose gel electrophoresis, the gene and PCR product showed a band position of approximately 850 bp, consistent with the target band position. One-step cloning was performed, ligating the gene into the expression vector pTrc99a, and transforming it into *E. coli* DH5α competent cells. Colony PCR verification was then performed. The colony PCR product was sent for sequencing, and the sequencing results were consistent with... panC The gene's base sequence was compared, and the recombinant plasmid pTrc99a-panC was correctly extracted. This plasmid was then transformed into *Escherichia coli* DPA12 to obtain the engineered bacterium DFC-panC. The strain *Escherichia coli* DPA12 is disclosed in patent application publication number CN109868254A, entitled "A Genetically Engineered Bacterium with High Pantothenic Acid Production, Construction Method, and Application."

[0053] Primers F62I-F and F62-R (as shown in Table 1) were designed. Using the constructed pTrc99a-panC as a template, PCR was performed, mutating the phenylalanine at position 62 to isoleucine. The PCR reaction conditions were 98℃ for 5 min, 30 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 4 min), and 72℃ for 10 min. The PCR amplification system consisted of: 1 μL template, 1 μL each of forward and reverse primers, 25 μL buffer, 1 μL dNTP, 1 μL enzyme, and 20 μL ddH2O. The band size was verified by gel electrophoresis, and the agarose gel electrophoresis results are shown below. Figure 1 As shown in lane b, the original template was then digested. The cells were then transformed into Escherichia coli DPA12 competent cells, plated on Kansas, and positive colonies were picked and cultured overnight at 37°C on a shaker to obtain a site-directed mutant strain, named DFC-F62I. The plasmid carried by the mutant strain was extracted to obtain pTrc99a-panC(F62I).

[0054] Primers R123Q-F and R123-R (as shown in Table 1) were designed. Using the constructed pTrc99a-panC(F62I) as a template, PCR was performed, mutating arginine at position 123 to glutamine. The PCR reaction conditions were 98℃ for 5 min, 30 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 4 min), and 72℃ for 10 min. The PCR amplification system consisted of: 1 μL template, 1 μL each of forward and reverse primers, 25 μL buffer, 1 μL dNTP, 1 μL enzyme, and 20 μL ddH2O. The band size was verified by gel electrophoresis. Figure 1 As shown in lane b, the original template was then digested. The cells were then transformed into Escherichia coli DPA12 competent cells, plated on Kansas, and positive colonies were picked and cultured overnight at 37°C on a shaker to obtain a site-directed mutant strain, named DFC-F62I / R123Q. The plasmid carried by the mutant strain was extracted to obtain pTrc99a-panC(F62I / R123Q).

[0055] Primers R189I-F and R189-R (as shown in Table 1) were designed. Using the constructed pTrc99a-panC(F62I / R189I) as a template, PCR was performed, mutating arginine at position 189 to isoleucine. The PCR reaction conditions were 98℃ for 5 min, 30 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 4 min), and 72℃ for 10 min. The PCR amplification system consisted of: 1 μL template, 1 μL each of forward and reverse primers, 25 μL buffer, 1 μL dNTP, 1 μL enzyme, and 20 μL ddH2O. The band size was verified by gel electrophoresis. Figure 1 As shown in lane b, the original template was then digested. The cells were then transformed into Escherichia coli DPA12 competent cells, plated on Kansas, and positive colonies were picked and cultured overnight at 37°C on a shaker to obtain a site-directed mutant strain, named DFC-F62I / R123Q / R189I. The plasmid carried by the mutant strain was extracted to obtain pTrc99a-panC(F62I / R123Q).

[0056] Example 6: Shake-flask fermentation of engineered bacteria for D-panthenol production

[0057] In this embodiment, the engineered bacteria constructed in Example 6 were used for shake-flask fermentation, and the following steps were followed:

[0058] (1) Strain activation: the strain (DFC-panC, DFC-F62I, DFC-F62I / R123Q, DFC-F62I / R123Q / R189I) was streaked and inoculated on the activation medium (solid LB medium) and cultured at 37°C overnight;

[0059] (2) Seed culture: the activation seed was picked up with a inoculating loop and inoculated in a test tube containing 10 mL of seed culture medium (LB medium), and cultured at 37°C, 200 rpm overnight;

[0060] (3) Shake flask fermentation: the seed liquid was inoculated into a 250 mL conical flask containing 50 mL of fermentation medium at a 5% inoculation amount (volume ratio), and cultured at 37°C, 200 rpm shaking, and the fermentation time was 52 h. The yield and conversion rate of the product D-panthenol after fermentation were determined, and the results are shown in Table 1. Figure 3 wherein: the determination results of WT, F62I, F62I / R123Q, F62I / R123Q / R189I are the fermentation determination results of DFC-panC, DFC-F62I, DFC-F62I / R123Q, DFC-F62I / R123Q / R189I strains, respectively.

[0061] wherein, the composition of the shake flask fermentation medium is: glucose 20 g / L, ammonium sulfate 16 g / L, yeast powder 2 g / L, KH2PO41 g / L, MgSO40.2 g / L, CaCO315 g / L, trace metal salt solution 1 mL / L. (Salt solution: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O).

[0062] According to the fermentation results, the shake flask yield of the production strain DFC-panC carrying the wild-type panC recombinant plasmid pTrc99a-panC is 0.178 g / L, the shake flask yield of the production strain DFC-panC (F62I) carrying the single-point mutant panC recombinant plasmid pTrc99a-panC (F62I) is 0.380 g / L, the shake flask yield of the production strain DFC-panC (F62I / R123Q) carrying the double-point mutant panC recombinant plasmid pTrc99a-panC (F62I / R123Q) is 0.5 g / L, and the shake flask yield of the production strain DFC-panC (F62I / R123Q / R189I) carrying the triple-point mutant panC recombinant plasmid pTrc99a-panC (F62I / R123Q / R189I) is 0.65 g / L. Compared with the wild-type panC, the D-panthenol yield of the engineering strain is increased to 3.65 times of the original.

[0063] The raw materials and equipment used in the present application are common raw materials and equipment in the art, unless otherwise specified; the methods used in the present application are conventional methods in the art, unless otherwise specified.

[0064] The above is only the preferred embodiment of the present application, and does not limit the present application in any way. Any simple modification, change and equivalent transformation of the above embodiment based on the technical essence of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A pantothenic acid synthase mutant, characterized in that: The amino acid sequence shown in SEQ ID NO.1 is mutated to one of the following: (1) The phenylalanine at position 62 is mutated to isoleucine; (2) The amino acid arginine at position 123 was mutated to glutamine, and the amino acid arginine at position 189 was mutated to isoleucine; (3) Phenylalanine at position 62 is mutated to isoleucine, amino acid arginine at position 123 is mutated to glutamine, and arginine at position 189 is mutated to isoleucine.

2. The encoding gene of the pantothenic acid synthase mutant as described in claim 1.

3. A recombinant vector, characterized in that: It includes the coding gene as described in claim 2.

4. The recombinant vector as described in claim 3, characterized in that: The carrier is pTrc99a or pET-28a(+).

5. A genetically engineered bacterium, characterized in that: It contains the coding gene as described in claim 2 or the recombinant vector as described in claim 3.

6. The genetically engineered bacteria as described in claim 5, characterized in that: The genetically engineered bacteria is Escherichia coli.

7. The application of the pantothenic acid synthase mutant as described in claim 1 in the preparation of D-panthenol.

Images