Barley HvPHR1 gene and application of barley HvPHR1 gene in aspect of increasing phosphorus content of barley

Abstract

According to the barley HvPHR1 gene and the application thereof in the aspect of increasing the phosphorus content of barley, rice PHR2 homologous protein serves as bait, homologous comparison means is utilized, it is found that two PHR proteins HvPHR1 and HvPHR2 exist in barley, and it is found that the content of inorganic phosphorus in barley leaves can be remarkably increased through overexpression of the HvPHR1 gene in an HvPHR1 overexpression strain with the normal phosphorus concentration being 200 micrometers NH4H2PO4 and an HvPHR1 overexpression strain with the low phosphorus concentration being 10 micrometers NH4H2PO4 hydroponic culture for three weeks and a wild type control (GP). In conclusion, the function of the HvPHR1 gene in barley low phosphorus stress is defined, and a theoretical basis is provided for cultivation of new phosphorus-efficient barley varieties.

Description

Technical Field

[0001] The invention relates to the research field of barley HvPHR1 gene, in particular to barley HvPHR1 gene and application thereof in improving phosphorus content of barley. Background Art

[0002] Barley is the fourth largest cereal crop in the world. It is tolerant to barrenness, salt and alkali, and has strong adaptability. It is an important raw material for the beer and feed industries. Phosphorus is a macronutrient necessary for the growth and development of barley. Although the soil is rich in total phosphorus, it mainly exists in the form of chelated or organic forms that cannot be directly absorbed and utilized. Inorganic phosphorus (H2PO4 - and HPO4 2- ) accounts for only 1% of soil phosphorus (Shen, Yuan et al. 2011). In production, excessive phosphorus fertilizer is applied to meet barley growth, but the absorption and utilization rate of phosphorus fertilizer by barley is less than 30% (Jez, Lee et al. 2016). The application of excessive phosphorus fertilizer not only causes a waste of resources, but also causes environmental problems. Barley has formed a complex and sophisticated low-phosphorus stress regulatory network in the long-term evolution process (Xia Xue 2023). Exploring and utilizing low-phosphorus stress-resistant genes and cultivating and promoting barley varieties with efficient phosphorus utilization are one of the most effective ways to solve the hazards of low-phosphorus stress.

[0003] Plants have established a phosphorus stress regulation pathway with the MYB family transcription factor PHR1 (Phosphate Starvation Response 1) as the core. PHR1 activates a large number of low-phosphorus stress response PSI (Phosphate Starvation Induced) genes by binding to the P1BS (PHR1 binding sites, GNATATNC) cis-acting element, and comprehensively regulates the plant's low-phosphorus stress response (Wu, Shou et al. 2013, Guo, Ruan et al. 2015). The IPS1 gene promoter contains the P1BS cis-acting element, and the transcription level is regulated by PHR. The gene encodes a long non-coding LncRNA (Martin, del Pozo et al. 2000). Although the low-phosphorus stress regulatory pathway is relatively conserved in plants, since the barley reference genome is approximately 5G and the proportion of repetitive sequences accounts for more than 85% of the genome, its assembly is more difficult than that of general plants. It was not until 2017 that a chromosome-level reference genome was published (Mascher, Gundlachetal. 2017), which was 17 and 15 years later than the model plants Arabidopsis and rice, respectively. This seriously hindered the analysis and utilization of barley low-phosphorus stress functional genes. At present, the complete regulatory pathway of barley low-phosphorus stress has not been established, and only the downstream response genes of the regulatory pathway have been reported, such as phosphorus transporters (Huang, Shirley et al. 2011), microRNA399 / 827 (Hackenberg, Shi et al. 2013), ubiquitin-binding enzyme PHO2 (Sega, Kruszka et al. 2020), etc., while the role of PHR, the core transcription factor of the barley low-phosphorus stress regulatory pathway, in low-phosphorus regulation has not yet been reported.

[0004] The present invention uses rice PHR2 homologous protein as bait, and uses homology comparison means to find that there are two PHR proteins (named HvPHR1 and HvPHR2) in barley, wherein the expression of HvPHR1 in different tissues is significantly higher than that of HvPHR2, suggesting that HvPHR1 plays a major role in the two. The present invention uses molecular biological means, uses barley Golden Promise (GP) leaf RNA as a template, and uses PCR technology to clone the complete HvPHR1 gene coding sequence, and uses Gateway molecular biological technology to construct the complete coding region of the HvPHR1 gene into a binary expression vector pBract214 and a binary expression vector pH7WGF2 containing a GFP gene, and transfers the plasmid (HvPHR1-pBract214) and pSoup plasmid with correct Sanger sequencing into Agrobacterium AGL1, and transfers the plasmid (HvPHR1-pH7WGF2) with correct Sanger sequencing into Agrobacterium AGL1. The HvPHR1 protein fused with GFP was expressed in tobacco leaves via Agrobacterium-mediated transient expression system, and confocal microscopy showed that the HvPHR1 protein was localized in the cell nucleus. The HvPHR1 overexpression vector (HvPHR1-pBract214) and the IPS1 promoter-driven luciferase reporter vector (POsIPS1::Luc) were co-expressed in the tobacco transient expression system mediated by Agrobacterium, and the results of the luciferase test showed that HvPHR1 had transcription factor activity; the HvPHR1 overexpression strain was obtained using the Agrobacterium-mediated barley (GP) immature embryo genetic transformation system; the HvPHR1 overexpression strain and the wild-type control (GP) were hydroponically cultivated for three weeks at normal phosphorus concentrations (200μm NH4H2PO4) and low phosphorus concentrations (10μm NH4H2PO4) and found that overexpression of the HvPHR1 gene can significantly increase the inorganic phosphorus content of barley leaves, and overexpression of the HvPHR1 gene can significantly increase the transcription level of HvIPS1 and significantly reduce the transcription level of the ubiquitin E2 enzyme HvPHO2. In summary, the present invention clarifies the function of the HvPHR1 gene in barley low-phosphorus stress, and provides a theoretical basis for the breeding of new phosphorus-efficient barley varieties. Summary of the invention

[0005] In order to solve the problems existing in the above-mentioned prior art, the object of the present invention is to provide a barley HvPHR1 gene and its application in increasing the phosphorus content of barley

[0006] To achieve the above object, the technical solution of the present invention is:

[0007] The barley HvPHR1 gene is characterized by:

[0008] The barley HvPHR1 gene sequence is shown in SEQ ID NO.1.

[0009] HvPHR1 gene overexpression transgenic intermediate vector HvPHR1-T,

[0010] The primer sequences for HvPHR1 transcript amplification are:

[0011] Transcript-HvPHR1-F:SEQ ID NO.2;

[0012] Transcript-HvPHR1-R: SEQ ID NO. 3.

[0013] Using the preserved HvPHR1-T plasmid as a template, primers for the overexpression vector with a linker were designed to amplify the ORF fragment of the HvPHR1 gene for BP reaction to obtain HvPHR1-pDONR (Zeo). The primer sequences were:

[0014] BP-HvPHR1-F: SEQ ID NO.4

[0015] BP-HvPHR1-R: SEQ ID NO.5

[0016] The Gateway method was used to construct the HvPHR1 gene overexpression vector HvPHR1-pBract214 and the subcellular localization vector HvPHR1-pH7WGF2.

[0017] Application of barley HvPHR1 gene in improving the phosphorus content of barley.

[0018] HvPHR1 regulates phosphorus homeostasis in barley and can increase the inorganic phosphorus content in barley leaves under low-phosphorus stress conditions.

[0019] Compared with the prior art, the beneficial effects of the present invention are:

[0020] The present invention has carried out gene cloning, expression analysis, subcellular localization, transcription factor activity detection and transgenic function verification on barley HvPHR1, proving that HvPHR1 is a transcription factor, which regulates the expression of ubiquitin E2 conjugating enzyme HvPHO2 and long non-coding LncRNA HvIPS1 in the phosphorus signal regulation pathway at the transcriptional level, thereby maintaining the phosphorus homeostasis of barley. Overexpression of the HvPHR1 gene can increase the inorganic phosphorus content of the third to fifth leaves by 4-12 times under low phosphorus stress conditions (the phosphorus content is 5% of the normal conditions), reaching 24%, 40% and 60% of the phosphorus content of the leaves under normal phosphorus culture conditions, respectively, and significantly increasing the inorganic phosphorus content of barley leaves. The present invention provides a theoretical basis and candidate genes for barley phosphorus efficient breeding and production. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1Homology and expression analysis of barley PHR genes. A. Phylogenetic tree analysis of PHR homologous proteins in barley, rice and Arabidopsis. Green, yellow and red colors indicate PHR homologous proteins in barley, rice and Arabidopsis, respectively. B. Expression of barley HvPHR1 and HvPHR2 in different tissues. The left and right Y axes represent the expression levels of HvPHR1 and HvPHR2 relative to the barley housekeeping gene HvACTIN, respectively. E, embryo of 4-day-germinated seeds; I, inflorescence tissue; L, 14-day-old barley leaf tissue; R, 14-day-old barley root tissue; S, filling seeds.

[0022] Figure 2 Transgenic lines overexpressing the HvPHR1 gene significantly increased the phosphorus content in leaves. A. Phenotypes of HvPHR1 overexpression lines and wild type (GP) cultured in water for three weeks at normal phosphorus concentration (200μm NH4H2PO4) and low phosphorus concentration (10μm NH4H2PO4). B. Phenotypes of the third to fifth leaves of HvPHR1 overexpression lines and wild type cultured in water for three weeks at normal phosphorus concentration and low phosphorus concentration. Under normal phosphorus concentration hydroponics, the old leaves of HvPHR1 overexpression showed obvious phosphorus poisoning phenotypes. C. Inorganic phosphorus content in leaves and roots of HvPHR1 overexpression lines and wild type cultured in water for three weeks at normal phosphorus concentration and low phosphorus concentration. The inorganic phosphorus content of leaves of HvPHR1 overexpression lines was significantly higher than that of wild type under normal phosphorus concentration and low phosphorus concentration. Under low phosphorus conditions, the inorganic phosphorus content of the third to fifth leaves was increased by 4-12 times, reaching 24%, 40% and 60% of the phosphorus content of leaves under normal phosphorus culture conditions, respectively. D. Expression levels of HvPHR1, HvIPS1 and HvPHO2 genes in leaves of wild-type GP and HvPHR1 overexpressing strains.

[0023] Figure 3 Nuclear subcellular localization of HvPHR1. Agrobacterium AGL1 containing a plasmid containing GFP-fused HvPHR1 (HvPHR1-pH7WGF2) and a plasmid containing an empty GFP vector (pH7WGF2) were injected into tobacco leaves, and the subcellular localization of the protein was observed using a confocal microscope.

[0024] Figure 4 HvPHR1 has a transcription factor activity detection. A. Luciferase reporter gene activation detection test. B. Luciferase reporter gene activation quantitative test (n=3). Agrobacterium containing HvPHR1 overexpression vector (HvPHR1-pBract214) and Agrobacterium containing Luc luciferase reporter gene vector (POsIPS1-1300-Luc) were mixed with equal concentrations and volumes and injected into tobacco leaves (A upper left and A upper right), with Agrobacterium containing POsIPS1-1300-Luc alone (A lower left) and Agrobacterium containing 1300-Luc empty vector alone (A lower right) as controls. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments:

[0026] like Figure 1-4 As shown,

[0027] Example 1: Identification and tissue expression analysis of barley PHR homologous proteins

[0028] The present invention provides sequence information of Arabidopsis PHR1 and its homologous proteins PHL1, PHL2 and PHL3; protein sequences of rice PHR1, PHR2 (LOC_Os07g25710), PHR3 and PHR4; and barley transcripts, CDS and protein sequence files. A BLAST comparison database is established for barley protein sequences. Rice PHR2 (LOC_Os07g25710) protein is used as a bait protein for comparison and search of barley PHR homologous proteins. In the comparison results, two barley PHR homologous proteins were screened based on the standards that the comparison length with the bait protein was greater than 300 amino acids and the evalue was less than 1e-20. A phylogenetic tree was constructed for the PHR bait protein and the two barley homologous proteins using MEGA7 software ( Figure 1 A), HORVU4Hr1G051080 and HORVU3Hr1G019260 were named HvPHR1 and HvPHR2, respectively, based on their similarity to rice PHR protein.

[0029] Total RNA from germinated seeds, inflorescences, leaves, roots and filling seeds of barley Golden Hope (GP) was extracted using a plant total RNA extraction kit (TIANGEN, China). The extraction steps were described in the reference manual. The purity and concentration of the extracted RNA were determined using NanoDrop 2000 (ThermoFisher Scientific Inc., USA). Reverse transcription was performed using a cDNA first-strand synthesis kit (TIANGEN, China) with total RNA as a template. Real-time fluorescence quantitative PCR primers were designed based on the reference sequences of HvPHR1 and HvPHR2 transcripts. The quantitative results of different tissues showed that both HvPHR1 and HvPHR2 were constitutively expressed and the expression level of HvPHR1 was 100 times that of HvPHR2 in the same tissue ( Figure 1 B), suggesting that HvPHR1 plays a major role. HvPHR1 and HvPHR2 quantitative primers are:

[0030] RT-HvPHR1-F:TCTAGACCTGAAATCGAGCA

[0031] RT-HvPHR1-R:CTTGTTCTTCAATTCGCAAC

[0032] RT-HvPHR2-F:AACTCAACCACAGGCTGGAC

[0033] RT-HvPHR2-R:CGTGTCTTCGAGGTGTTGGA

[0034] Example 2: Cloning of HvPHR1 gene

[0035] The total RNA from leaves of two-week-old hydroponic seedlings of barley Golden Hope (GP) was extracted using a plant total RNA extraction kit (TIANGEN, China). The extraction steps were described in the reference manual. The purity and concentration of the extracted RNA were determined using NanoDrop 2000 (Thermo Fisher Scientific Inc., USA). Reverse transcription was performed using a cDNA first-strand synthesis kit (TIANGEN, China) with total RNA as a template. Primers were designed on the 5' and 3'UTR of the HvPHR1 transcript reference sequence. The PCR product was 1438 bp, including the full-length coding frame CDS (length 1356 bp, encoding 451 amino acids). The target fragment was amplified using a high-fidelity DNA polymerase and ligated into the pGM-T vector. The ligation product was transformed into competent Escherichia coli DH5a and spread on LB solid culture medium containing ampicillin. The cells were cultured at 37 degrees for about 16 hours, and single clones were picked and shaken for PCR verification. The positive clones were sent to the company for sequencing, and the single clones with correct sequencing were expanded. The bacterial solution was stored in glycerol and the plasmid was extracted. The plasmid was named HvPHR1-T and used for the construction of vectors such as HvPHR1 gene overexpression transgene.

[0036] The primers for amplifying HvPHR1 transcripts are:

[0037] Transcript-HvPHR1-F:CTTGATGAGGAGGTGTGATCT

[0038] Transcript-HvPHR1-R:AGCATCGACACGGAATGAAAC

[0039] Example 3: Construction of HvPHR1 overexpression transgene, subcellular localization and transcription factor activity detection vector

[0040] The Gateway method was used to construct HvPHR1 gene overexpression and subcellular localization vectors, namely HvPHR1-pBract214 and HvPHR1-pH7WGF2.

[0041] Using the stored HvPHR1-T plasmid as a template, overexpression vector primers with a linker (underlined) were designed to amplify the ORF fragment of the HvPHR1 gene (with the stop codon TAA). The primer sequences were:

[0042] BP-HvPHR1-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGAGGAGGTGTGATCTGAGA

[0043] BP-HvPHR1-R: GGGGACCACTTTGTACAAGAAAGCTGGGTC TTAACTATCATGCACCCTTCGG

[0044] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the target products were recovered by cutting the gel to determine the concentration of the recovered products. The recovered products were subjected to BP recombination reaction with the entry vector pDONR (Zeo) using Gateway BP Clonase II enzyme mix (Invitrogen, USA). The recombination reaction operation is shown in the reference manual. The recombinant product was transformed into E. coli DH5a competent state, coated with LB solid medium containing bleomycin, and cultured at 37 degrees for about 16 hours. Single clones were picked and shaken, and the bacterial solution was verified by PCR. The positive clones were sent to the company for sequencing, and the single clones with correct sequencing were expanded, and the bacterial solution was stored in glycerol and the plasmid was extracted. The plasmid was named HvPHR1-pDONR (Zeo).

[0045] The HvPHR1-pDONR (Zeo) plasmid was subjected to LR recombination reaction with the target vectors pBract214 and pH7WGF2 respectively using Gateway LR Clonase II enzyme mix (Invitrogen, USA) to construct HvPHR1 overexpression and subcellular localization vectors. The recombination reaction operation is shown in the reference manual. The recombinant product was transformed into Escherichia coli DH5a competent cells, and LB solid medium containing kanamycin and spectinomycin was applied respectively. The cells were cultured at 37 degrees for about 16 hours, and single clones were picked and shaken for PCR verification of the bacterial solution. The positive clones were sent to the company for sequencing, and the single clones with correct sequencing were expanded, and the bacterial solution was stored in glycerol and the plasmids were extracted. The plasmids were named HvPHR1-pBract214 and HvPHR1-pH7WGF2 respectively. The HvPHR1-pBract214 plasmid and the pSoup plasmid were co-transformed into the competent Agrobacterium AGL1, coated with YEP solid medium containing kanamycin + rifampicin, cultured at 28 degrees for about 48 hours, and PCR verified the positive clones. Take 100ul of the positive clone bacterial solution and add it to 10mLMG culture medium (containing 25ug / mL rifampicin, 50ug / mL kanamycin) for culture at 28 degrees, 200rpm / min, shake the bacteria to OD600 = 0.6-0.7, add an equal volume of 30% sterile glycerol, mix well, and quickly freeze in liquid nitrogen, and store at -80 degrees for use. The HvPHR1-pH7WGF2 plasmid was transformed into Agrobacterium AGL1, coated with YEP solid medium containing spectinomycin, cultured at 28 degrees for about 48 hours, and PCR verified the positive clones. Take 100ul of the positive clone bacterial solution and add it to 10mL YEP culture medium (containing 50ug / mL spectinomycin) for culture at 28 degrees and 200rpm / min. Shake the bacteria until OD600=1.0. Add an equal volume of sterile glycerol, mix well, and quickly freeze in liquid nitrogen. Store at -80 degrees for later use.

[0046] Homologous recombination technology was used to construct the HvPHR1 transcription factor activity detection vector, and the 1597bp region of the promoter upstream of the rice IPS1 gene (LOC_Os03g05334) (including the P1BS cis-acting element) was amplified and connected to the luciferase reporter 1300-Luc vector stored in the laboratory. One week after the rice Nipponbare germinated, leaves of about 1 cm were cut, and the rice leaf genome was extracted using an efficient plant genomic DNA extraction kit (TIANGEN, China). Primers were designed for the 1601bp region of the rice IPS1 gene promoter, and the target fragment was amplified using a high-fidelity DNA polymerase and connected to the pGM-T vector. The ligation product was transformed into Escherichia coli DH5a competent cells, spread on LB solid medium containing ampicillin, and cultured at 37 degrees for about 16 hours. Single clones were picked and shaken for bacterial liquid PCR verification. The positive clones were sent to the company for sequencing, and the single clones with correct sequencing were expanded, and the bacterial liquid was stored in glycerol and plasmids were extracted. The plasmid was named POsIPS1-T. The primers for amplifying the rice IPS1 promoter are:

[0047] POSIPS1-F:TCAGCAGCATCGTTCATCAAT

[0048] POsIPS1-R:ACATCCACCGAATAATTGCC

[0049] Using the correctly sequenced POsIPS1-T as a template, primers were designed to amplify homologous recombination primers with vector information + BamHI restriction site (underlined) to amplify the 1597bp region of the IPS1 gene promoter. The primer information is:

[0050] re-POsIPS1-F: CTGCAGGTCGACTCTAGAGGATCC TCAGCAGCATCGTTCATCAAT

[0051] re-POsIPS1-R:

[0052] GTAAAAATAAAGCTTATCGATGGATCC CCACCGAATAATTGCCAAAGGA

[0053] The PCR amplification product was detected by 1% agarose gel electrophoresis, and the target product was recovered by cutting the gel to determine the concentration of the recovered product. The In-Fusion HD Cloning Kit homologous recombination kit (Takara, Japan) was used to carry out a recombination reaction between the recovered product and the 1300-Luc vector cut by BamHI. The recombination reaction operation is shown in the reference manual. The recombinant product was transformed into Escherichia coli DH5a competent state, coated with LB solid medium containing kanamycin, and cultured at 37 degrees for about 16 hours. The single clone was picked and shaken, and the bacterial liquid was verified by PCR. The positive clone was sent to the company for sequencing, and the single clone with correct sequencing was expanded. The bacterial liquid was stored in glycerol and the plasmid was extracted. The plasmid was named POsIPS1-1300-Luc. The POsIPS1-1300-Luc plasmid was transformed into Agrobacterium AGL1, coated with YEP solid medium containing kanamycin, and cultured at 28 degrees for about 48 hours. The positive clone was verified by PCR. Take 100ul of the positive clone bacterial solution and add it to 10mL YEP culture medium (containing 50ug / mL kanamycin) for culture at 28 degrees and 200rpm / min. Shake the bacteria until OD600=1.0. Add an equal volume of sterile glycerol, mix well, and quickly freeze in liquid nitrogen. Store at -80 degrees for later use.

[0054] Example 4: Genetic transformation and phenotypic identification of HvPHR1 gene overexpression

[0055] The creation of HvPHR1 gene overexpression transgenic materials refers to the published barley immature embryo genetic transformation system (Hinchliffe and Harwood 2019). The process is as follows: The immature embryos of cultivated barley Golden Hope (GP) 2-3 weeks after flowering are selected as genetic transformation materials, the grains that meet the standards are peeled from the ears, the awns are removed, the seeds are surface disinfected with 70% alcohol for 30s, washed with sterile water several times, and then soaked in 10% sodium hypochlorite for 4min, washed with sterile water several times, and the immature embryos are separated on sterile filter paper, the embryo axis is removed, and the shield is placed on the callus induction medium with the shield facing up, and cultured in the dark at 23-24℃ for 2-3d. 400μL of the stored HvPHR1 gene overexpression Agrobacterium bacterial solution is added to 10mL of MG liquid medium without antibiotics, and the bacteria are shaken at 28℃, 180rpm / min to OD600=1.3-1.4 for immature embryo infection. The prepared Agrobacterium infection solution is dripped on each immature embryo and dried. Seal the plate with sealing film and co-cultivate in the dark at 23-24℃ for 2 days. Transfer the young embryos to fresh callus induction medium plates for selection culture (containing 50mg / L hygromycin and 160mg / L tricholoma). After 56 days of dark culture at 23-24℃ (the medium plates are changed every 14 days), the callus separated from the young embryos is transferred to the transfer medium and cultured at 24℃ under weak light for 21 days, at which time green spots will be produced. Transfer the green spots to the subculture medium for further culture. When the upper leaves reach 2-3cm, roots begin to form. Transfer the seedlings to the rooting medium without adding any growth regulators and the antibiotics remain unchanged. After that, the seedlings with established roots are taken out, the medium is washed off, and they are transferred to plastic culture pots containing vermiculite and nutrient matrix, and grown in an artificial climate chamber (22℃ / 18℃, day / night) until the T1 generation seeds are harvested.

[0056] The T1 generation HvPHR1 gene overexpression lines (HvPHR1-OE1 and HvPHR1-OE2) and the control (GP) were subjected to normal phosphorus concentration (200 μm NH4H2PO4) hydroponic culture and low phosphorus stress (10 μm NH4H2PO4) hydroponic culture experiments, and the inorganic phosphorus content in leaves and roots was measured. The results showed that the old leaves of the HvPHR1 gene overexpression lines that were hydroponically cultured at normal phosphorus concentrations for 3 weeks showed obvious phosphorus poisoning phenotypes, and the inorganic phosphorus content of the 3rd to 5th leaves was significantly higher than that of the control ( Figure 2 ); Under low-phosphorus stress hydroponic conditions, the old leaves of the HvPHR1 gene overexpression strain did not show obvious phosphorus poisoning phenotypes. Under low-phosphorus conditions, the inorganic phosphorus content of the third to fifth leaves increased by 4-12 times, reaching 24%, 40% and 60% of the phosphorus content of the leaves under normal phosphorus culture conditions, respectively ( Figure 2 ). Overexpression of HvPHR1 significantly increased the expression of HvIPS1 at the transcriptional level and significantly inhibited the expression of HvPHO2.

[0057] Example 5: Detection of HvPHR1 subcellular localization and transcription factor activity

[0058] Take the Agrobacterium of HvPHR1-pH7WGF2, POsIPS1-1300-Luc and HvPHR1-pBract214 stored at -80 degrees, streak on YEP solid medium containing the corresponding antibiotics, culture at 28 degrees for about 48 hours, then pick several single clones and inoculate them into 10mL YEP liquid culture medium containing the corresponding antibiotics, shake the bacteria at 28 degrees until OD600 = about 1.0. Collect the bacteria by centrifugation at 3000g for 10 minutes, wash twice with injection buffer (0.2mMAS, 10mM MES and 1 / 2MS, pH = 5.7), and finally resuspend the bacteria with the buffer to about OD600 = 1.0. The resuspended bacterial solution was drawn up with a 1 mL syringe and injected into tobacco leaves at the 5-6 leaf stage from the back of the leaves (HvPHR1-pH7WGF2 was injected alone for HvPHR1 subcellular localization identification, and POsIPS1-1300-Luc and HvPHR1-pBract214 resuspended bacterial solution was mixed in equal amounts for HvPHR1 transcription factor activity detection). The injected tobacco was continued to be cultured in an incubator (26 degrees / 24 degrees, 16h / 8h, day / night) for 3 days, and then the subcellular localization of HvPHR1 was observed using a laser confocal microscope (LSM710, Carl Zeiss, Germany), and the expression of the luciferase reporter gene was observed using the NightSHADE in vivo PlantImaging System (LB985, Germany). The results showed that HvPHR1 was subcellularly localized in the nucleus and could bind to the rice IPS1 promoter to activate luciferase gene expression.

[0059] in: Figure 1 Homology and expression analysis of barley PHR genes. A. Phylogenetic tree analysis of PHR homologous proteins in barley, rice and Arabidopsis. Green, yellow and red colors indicate PHR homologous proteins in barley, rice and Arabidopsis, respectively. B. Expression of barley HvPHR1 and HvPHR2 in different tissues. The left and right Y axes represent the expression levels of HvPHR1 and HvPHR2 relative to the barley housekeeping gene HvACTIN, respectively. E, embryo of 4-day-germinated seeds; I, inflorescence tissue; L, 14-day-old barley leaf tissue; R, 14-day-old barley root tissue; S, filling seeds.

[0060] Figure 2Transgenic lines overexpressing the HvPHR1 gene significantly increased the phosphorus content in leaves. A. Phenotypes of HvPHR1 overexpression lines and wild type (GP) cultured in water for three weeks at normal phosphorus concentration (200μm NH4H2PO4) and low phosphorus concentration (10μm NH4H2PO4). B. Phenotypes of the third to fifth leaves of HvPHR1 overexpression lines and wild type cultured in water for three weeks at normal phosphorus concentration and low phosphorus concentration. Under normal phosphorus concentration hydroponics, the old leaves of HvPHR1 overexpression showed obvious phosphorus poisoning phenotypes. C. Inorganic phosphorus content in leaves and roots of HvPHR1 overexpression lines and wild type cultured in water for three weeks at normal phosphorus concentration and low phosphorus concentration. The inorganic phosphorus content of leaves of HvPHR1 overexpression lines was significantly higher than that of wild type under normal phosphorus concentration and low phosphorus concentration. Under low phosphorus conditions, the inorganic phosphorus content of the third to fifth leaves was increased by 4-12 times, reaching 24%, 40% and 60% of the phosphorus content of leaves under normal phosphorus culture conditions, respectively. D. Expression levels of HvPHR1, HvIPS1 and HvPHO2 genes in leaves of wild-type GP and HvPHR1 overexpressing strains.

[0061] Figure 3 Nuclear subcellular localization of HvPHR1. Agrobacterium AGL1 containing a plasmid containing GFP-fused HvPHR1 (HvPHR1-pH7WGF2) and a plasmid containing an empty GFP vector (pH7WGF2) were injected into tobacco leaves, and the subcellular localization of the protein was observed using a confocal microscope.

[0062] Figure 4 HvPHR1 has a transcription factor activity detection. A. Luciferase reporter gene activation detection test. B. Luciferase reporter gene activation quantitative test (n=3). Agrobacterium containing HvPHR1 overexpression vector (HvPHR1-pBract214) and Agrobacterium containing Luc luciferase reporter gene vector (POsIPS1-1300-Luc) were mixed with equal concentrations and volumes and injected into tobacco leaves (A upper left and A upper right), with Agrobacterium containing POsIPS1-1300-Luc alone (A lower left) and Agrobacterium containing 1300-Luc empty vector alone (A lower right) as controls.

[0063] In summary, the present invention has carried out gene cloning, expression analysis, subcellular localization, transcription factor activity detection and transgenic function verification on barley HvPHR1, proving that HvPHR1 is a transcription factor, which regulates the expression of ubiquitin E2 binding enzyme HvPHO2 and long non-coding LncRNA HvIPS1 in the phosphorus signal regulation pathway at the transcriptional level, thereby maintaining the phosphorus homeostasis of barley. Overexpression of the HvPHR1 gene can increase the inorganic phosphorus content of the third to fifth leaves by 4-12 times under low phosphorus stress conditions (the phosphorus content is 5% of the normal conditions), reaching 24%, 40% and 60% of the phosphorus content of the leaves under normal phosphorus culture conditions, respectively, significantly increasing the inorganic phosphorus content of barley leaves. The present invention provides a theoretical basis and candidate genes for barley phosphorus efficient breeding and production.

[0064] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that are not conceived through creative work should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope defined in the claims.

Claims

1. A barley HvPHR1 gene, characterized in that: The barley HvPHR1 gene sequence is shown in SEQ ID NO.

1.

2. The barley HvPHR1 gene according to claim 1, characterized in that: HvPHR1 gene overexpression transgenic intermediate vector HvPHR1-T, The primer sequences for HvPHR1 transcript amplification are: Transcript-HvPHR1-F:SEQ ID NO.2; Transcript-HvPHR1-R: SEQ ID NO.

3.

3. The barley HvPHR1 gene according to claim 2, characterized in that: Using the preserved HvPHR1-T plasmid as a template, primers for the overexpression vector with a linker were designed to amplify the ORF fragment of the HvPHR1 gene for BP reaction to obtain HvPHR1-pDONR (Zeo). The primer sequences were: BP-HvPHR1-F: SEQ ID NO.4 BP-HvPHR1-R: SEQ ID NO.5 The Gateway method was used to construct the HvPHR1 gene overexpression vector HvPHR1-pBract214 and the subcellular localization vector HvPHR1-pH7WGF2.

4. Use of the barley HvPHR1 gene according to any one of claims 1 to 3 in increasing the phosphorus content of barley.

5. The application according to claim 4, characterized in that: HvPHR1 regulates phosphorus homeostasis in barley and can increase the inorganic phosphorus content in barley leaves under low-phosphorus stress conditions.

Images