Oral vaccine composition

Abstract

The oral vaccine composition for porcine circovirus-related diseases comprises pupae or cells of baculovirus-infected insects, said pupae or cells being obtained by subjecting a recombinant baculovirus into which DNA encoding a porcine circovirus type 2 protein has been introduced to an infection treatment and a freeze-drying treatment.

Description

Technical Field

[0001] The present invention relates to an oral vaccine composition for porcine circovirus-related diseases and a method for preparing the same. Background Art

[0002] Porcine circovirus-related diseases are diseases caused by porcine circovirus type 2 (PCV2). The most common period is 7 to 16 weeks of age, and symptoms such as lethargy, stunted growth, emaciation, difficulty breathing, swollen lymph nodes, jaundice, and stillbirth can be seen. Therefore, for pig farmers and veterinarians, it is necessary to develop effective prevention or treatment methods for porcine circovirus-related diseases.

[0003] In addition, baculovirus is a nuclear polyhedrovirus (NPV) that uses insects as its main host and infects the host. During the proliferation process, a protein with a crystalline structure called polyhedrin is formed in the nucleus of the infected cell. Therefore, as one of the methods for producing a target protein using the baculovirus-silkworm system, there is the following method: a gene encoding a target protein is introduced into a baculovirus, and the recombinant baculovirus is inoculated into the larvae or pupae of a silkworm to produce the target protein in the silkworm (Non-Patent Document 1). When the baculovirus-silkworm system is used to produce a protein in this way, it is useful in being able to mass-produce the target protein.

[0004] Prior art literature

[0005] Non-patent literature

[0006] Non-patent document 1: Maeda et al., "Production of human α-interferon in silkworm using a baculovirus vector." Nature, 315, 592-594 (1985) Summary of the invention

[0007] Problem that the invention aims to solve

[0008] Under the above background, it is desired to develop a method for producing oral vaccines against porcine circovirus-related diseases more simply and in large quantities using the baculovirus-silkworm system.

[0009] Solutions for solving problems

[0010] The present inventors surprisingly found that immunogenicity can be maintained by infecting silkworm pupae with a recombinant baculovirus introduced with a DNA encoding a PCV2 protein and then freeze-drying the pupae, thereby completing the present invention.

[0011] That is, the present invention is as follows, for example.

[0012] [1] An oral vaccine composition for porcine circovirus-related diseases, comprising pupae or cells of baculovirus-infectious insects, wherein the pupae or cells have been infected with a recombinant baculovirus into which a DNA encoding porcine circovirus type 2 protein has been introduced and freeze-dried.

[0013] [2] The oral vaccine composition according to [1], wherein the DNA encoding porcine circovirus type 2 protein is the DNA represented by sequence number 1.

[0014] [3] The oral vaccine composition according to [1], further comprising a solution containing an adjuvant.

[0015] [4] The oral vaccine composition according to [1], comprising at least 0.001% by weight of pupae relative to the total weight of the composition.

[0016] [5] The oral vaccine composition described in [1], wherein the porcine circovirus-related disease is at least one selected from the group consisting of post-weaning multisystemic wasting syndrome, porcine dermatitis and nephropathy syndrome, porcine respiratory disease syndrome and reproductive failure.

[0017] [6] A method for producing an oral vaccine against porcine circovirus-related diseases, comprising the steps of: infecting larvae or pupae of baculovirus-infectious insects with a recombinant baculovirus introduced with DNA encoding porcine circovirus type 2 protein, and freeze-drying the pupae formed by pupation of the infected larvae or the infected pupae.

[0018] [7] A method for producing an oral vaccine against porcine circovirus-related diseases, comprising the steps of infecting baculovirus-infectious cells with a recombinant baculovirus introduced with a DNA encoding a porcine circovirus type 2 protein, and freeze-drying the infected cells.

[0019] [8] The oral vaccine composition according to [6] or [7], wherein the DNA encoding porcine circovirus type 2 protein is the DNA represented by sequence number 1.

[0020] [9] The method according to [6], wherein the insect is a silkworm.

[0021]

[10] The method according to [7], wherein the cells are derived from Echinops fulgens, Antheraea pernyi, Bombyx mori, Spodoptera frugiperda or Trichoplusia ni.

[0022]

[11] A method for immunizing pigs against porcine circovirus, comprising the step of administering the composition described in any one of [1] to [5] to pigs.

[0023] Effects of the Invention

[0024] According to the present invention, an oral vaccine composition for porcine circovirus-related diseases and a method for producing the same are provided. The produced oral vaccine composition can be directly used for administration and can be included in pig feed, for example. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Figure 2 is a diagram showing the design of the challenge experiment.

[0026] Figure 2 It is a graph showing the transition of the PCV2 viral genome copy number in serum.

[0027] Figure 3 It is a graph showing the PCV2 viral genome copy number in organs.

[0028] Figure 4 This is a graph showing the transition of body weight change.

[0029] Figure 5 This is a graph showing the antibody titers of IgG and IgA in colostrum of sows at farrowing.

[0030] Figure 6 This is a graph showing the antibody titers of IgG and IgA in the serum of piglets at 1 day of age.

[0031] Figure 7 This is a graph showing a comparison of the increased amounts 4 weeks after the virus challenge (at the end of the experiment).

[0032] Figure 8 This is a graph showing the temporal change in the amount of PCV2 gene after virus challenge.

[0033] Fig. 9 This is a graph showing the transition of the amount of antigen-specific IgG antibodies from the start of immunization to before virus challenge.

[0034] Fig.10 This is a graph showing the temporal transition of antigen-specific IgG antibody response. DETAILED DESCRIPTION

[0035] 1. Summary

[0036] When using the silkworm heterologous protein expression system to produce vaccine antigens for infectious diseases, by making a recombinant baculovirus having inserted the vaccine antigen gene of the target pathogenic microorganism (virus, etc.) source and inoculating it into silkworm larvae or pupae, the virus is multiplied in the silkworm individual to produce vaccine antigens. In the case of vaccines that are usually administered by injection, it is necessary to purify the vaccine antigen protein. In addition, when purifying, it is necessary to combine multiple chromatography methods such as affinity purification, ion exchange purification, and ammonium sulfate precipitation. However, if the silkworm pupa itself expressing the vaccine antigen can be administered as the vaccine antigen, the cost of purification can be reduced, and it is also possible to expect to reduce the labor associated with injection administration.

[0037] In the present invention, DNA encoding porcine circovirus type 2 (PCV2) protein was introduced into pupae or cells of baculovirus-infected insects, and the pupae or cells of recombinant baculovirus-infected insects into which the DNA was introduced were freeze-dried, thereby successfully obtaining pupae and cells with high antigenicity. Furthermore, these pupae or cells were ingested by pigs to verify whether the antibody production response was enhanced. As a result, it was confirmed that the antibody production response to PCV2 antigen was significantly enhanced.

[0038] The present invention is based on the above findings.

[0039] The present invention provides an oral vaccine composition for porcine circovirus-related diseases, the oral vaccine composition comprising pupae or cells of baculovirus-infective insects, the pupae or cells being infected with a recombinant baculovirus into which a DNA encoding a PCV2 protein is introduced and / or freeze-dried. The recombinant baculovirus includes not only infection treatment and freeze-drying, but also a combination of the two.

[0040] In addition, the present invention provides a method for producing an oral vaccine against porcine circovirus-related diseases, which comprises the steps of infecting larvae or pupae of baculovirus-infectious insects with a recombinant baculovirus introduced with a DNA encoding a PCV2 protein, and freeze-drying pupae obtained by pupation of the infected larvae or the infected pupae.

[0041] Furthermore, the present invention provides a method for producing an oral vaccine against porcine circovirus-related diseases, comprising the steps of infecting baculovirus-infectious cells with a recombinant baculovirus introduced with a DNA encoding a PCV2 protein, and freeze-drying the infected cells.

[0042] 2. Recombinant baculovirus containing DNA encoding PCV2 protein

[0043] In this specification, as antigens, circovirus antigens such as porcine circovirus antigen (PCV) can be listed. As more specific examples of antigenic proteins, ORF2 (1-233) of PCV2a (GenBank accession number #AF055392), an isolate of porcine circovirus type 2 (PCV2; porcine circovirus type 2), or PCV2 KU08-1 strain (PCV2a: GenBank accession number, LC381288, etc. can be listed. In the present invention, the base sequence of the DNA recorded in the above accession number can be optimized according to the silkworm codon. The optimized base sequence of the base sequence of accession number LC381288 is shown in sequence number 1.

[0044] The size of the antigen is not particularly limited, and may be, for example, 5 to 1000 kDa, 10 to 500 kDa, or 30 to 200 kDa.

[0045] Immunogenicity refers to the property of an antigen to induce antibody production and cellular immunity. The presence or absence of immunogenicity can be evaluated, for example, by the presence or absence of antibody production after antibody administration. The expression of antibodies can be confirmed by methods known to those skilled in the art, such as enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, flow cytometry, and immunohistochemical staining.

[0046] The method of introducing the DNA encoding the PCV2 protein into the baculovirus can be carried out by methods known to those skilled in the art, for example, by the methods described in Maeda et al., Nature 315, 592-594 (1985), Y. Matsuura et al., Virology, (1989) 173, 674-682, etc. For example, the above DNA (including cDNA) is cloned and integrated into a baculovirus transfer vector to obtain a recombinant baculovirus transfer vector. Then, using the recombinant baculovirus transfer vector, a recombinant baculovirus DNA is obtained by homologous recombination or transposon transfer. The recombinant baculovirus DNA is introduced into insect culture cells by a known method such as liposome transfection to obtain a recombinant baculovirus.

[0047] The baculovirus transfer vector is obtained by subcloning a DNA fragment containing the polyhedron gene of the baculovirus genomic DNA into a plasmid, and can be prepared by a known method, or a commercially available vector can be used. Examples of commercially available vectors include pAcYM1, pAcG2T, pAcGP67, and VL1392 (all from Pharmingen), and pDEST8 (Invitrogen).

[0048] In the present invention, the types of baculovirus used to prepare the recombinant baculovirus include Autographa californica multiple nucleopolyhedrovirus (AcNPV), Bombyx mori nucleopolyhedrovirus (BmNPV), Orgyia pseudotsugata multiple nucleopolyhedrovirus (OpNPV), Lymantria disper multiple nucleopolyhedrovirus (LdNPV), etc., and Bombyx mori nucleopolyhedrovirus (BmNPV) is preferred.

[0049] 3. Infection of larvae or pupae of baculovirus-infected insects

[0050] In the present invention, the recombinant baculovirus is used to infect larvae or pupae of baculovirus-infectious insects or baculovirus-infectious cells (these are also collectively referred to as "hosts") serving as hosts.

[0051] Insects that can be used as hosts include Lepidoptera insects, which are not particularly limited as long as they are suitable for protein expression and can be infected with baculovirus, and include, for example, Spilosoma imparilis, Antheraea pernyi, Bombyx mori, Spodoptera frugiperda, etc. The insects may be in the form of either pupae or larvae.

[0052] In addition, the host cell is not particularly limited as long as it is suitable for protein expression and is a baculovirus-infective cell line. Here, "baculovirus-infective" means that it can be infected with baculovirus, and one of the characteristics of baculovirus-infective is that a glycoprotein called GP64 is expressed on the cell surface. Therefore, as long as it has such a property, the type of cell is not limited, and cultured cells such as insect cells can be mentioned.

[0053] Examples of insect cells include the following cells.

[0054] Spilosoma imparilis source cells: SpIm

[0055] Antheraea pernyi-derived cells: Anpe

[0056] Bombyx mori-derived cells: BmN, BmN4, Oyanagi-2, Bme21

[0057] Spodoptera frugiperda-derived cells: Sf9, Sf21

[0058] The method of infecting the insect or cell that becomes the host with the recombinant baculovirus can be carried out by a method known to those skilled in the art. For example, the recombinant baculovirus obtained in the above step is injected into pupae or larvae. When infecting host cells, the liquid containing the recombinant baculovirus can also be added to the cell culture medium.

[0059] After the host insect or host cell is infected with the recombinant baculovirus and then cultured for 1 to 9 days, the antigen protein is expressed in the host insect or host cell.

[0060] Here, when the target protein is produced using the conventional baculovirus-silkworm system, the target protein is expressed in the pupae or larvae of silkworms infected with the recombinant baculovirus, and then the pupae are crushed and suspended or the body fluid is collected from the larvae, and various purifications are performed to purify the target protein. In contrast, in the method of the present invention, such extraction and purification of the target protein is not required, and the pupae or cells expressing the PCV2 protein can be used directly after freeze-drying.

[0061] 4. Freeze-drying of Host Cells Infected with Recombinant Baculovirus

[0062] As for the timing of freeze-drying the pupae or cells of the host infected with the recombinant baculovirus, it is preferably after a sufficient amount of PCV2 protein is expressed in the host (for example, in the body of the silkworm pupae). In addition, when the larvae are infected with the baculovirus, they are allowed to develop into pupae. Therefore, regarding the timing of freeze-drying, when the infected silkworms are larvae, it is after pupation, and when the infected silkworms are pupae, freeze-drying can be performed at any time after infection. Freeze-drying can be performed directly on the pupae infected with the recombinant baculovirus without cutting or crushing them, in the shape of pupae, or after the pupae are cut or crushed.

[0063] In this specification, the expressions using the pupa "directly" and "directly in the shape of a pupa" mean: substantially directly using or including in the shape of a pupa, etc. For example, if a part is accidentally missing during the manufacturing process, as long as more than 90%, more than 80%, more than 70%, more than 60%, or more than 50% of the pupa shape is maintained, it can also be judged to maintain the shape of a pupa.

[0064] Freeze drying is a method of drying a substance under reduced pressure (e.g., maintained under a vacuum state) in a frozen state. Freeze drying can be performed by methods known to those skilled in the art, for example, using a commercially available freeze dryer. The freezing treatment temperature can be appropriately set by those skilled in the art, for example, at -90°C to -5°C, -80°C to -10°C, or -50°C to -10°C. In addition, the reduced pressure conditions can also be appropriately adjusted by those skilled in the art, for example, at 2Pa ​​to 20Pa, 3Pa to 20Pa, or 10Pa to 20Pa. The freeze drying time is, for example, 1 hour to 168 hours, preferably 8 hours to 96 hours. In addition, in one embodiment of the present invention, the freeze drying time is, for example, 8 hours to 36 hours.

[0065] By freeze drying, the moisture of the pupa and the cells is mostly removed and the pupa and the cells are dried. The moisture contained in the freeze-dried pupa can be, for example, less than 1% by weight, less than 0.5% by weight, less than 0.1% by weight, less than 0.01% by weight or less than 0.001% by weight relative to the total weight of the pupa or the cells. From the viewpoint of easily maintaining immunogenicity, the closer the moisture contained in the pupa is to 0% by weight, the more preferred.

[0066] Here, in the present invention, the pupae or cells can be optionally subjected to liquid treatment, immersion treatment, light treatment, gas treatment, plasma treatment, heating treatment, or pressurized heating treatment. The timing of liquid treatment, immersion treatment, light treatment, gas treatment, plasma treatment, heating or pressurized heating treatment can be before or after freeze drying, for example, preferably after the pupae and cells are fully dried by freeze drying. The process of freeze drying the host infected with the recombinant baculovirus and the process of liquid treatment, immersion treatment, light treatment, gas treatment, plasma treatment, heating treatment or pressurized heating treatment can also be carried out continuously, that is, liquid treatment, immersion treatment, light treatment, gas treatment, plasma treatment, heating treatment or pressurized heating treatment are carried out without inserting other treatment processes after freeze drying. The timing after freeze drying can be appropriately adjusted according to the condition of the dried silkworm pupae, for example, it can be carried out within 1 to 24 hours after freeze drying, for example, within 24 hours, within 12 hours, within 3 hours or within 1 hour. The freeze-dried pupae are preferably subjected to a liquid agent treatment, an immersion treatment, a light treatment, a gas treatment, a plasma treatment, a heat treatment or a pressurized heat treatment in the shape of pupae without being cut or broken.

[0067] The pupae and cells produced by the production method have immunogenicity. Therefore, the PCV2 protein does not need to be extracted in the present invention and can be directly used for oral administration.

[0068] Furthermore, in one mode of the present invention, the pupa that has been freeze-dried is dried and spongy, so that the liquid can be easily infiltrated into the inside by being immersed in the liquid. Therefore, the manufacturing method involved in the present embodiment may also include the following steps: the pupa that has been freeze-dried or the pupa that has been pressurized and heated as required is immersed in the liquid. As the liquid for immersion, in order to easily improve the effect as a vaccine, a solution containing an adjuvant is preferably used. By immersing the pupa that has been freeze-dried in a solution containing an adjuvant, the solution containing the adjuvant can be easily infiltrated into the inside of the pupa. The cultured cells are freeze-dried to become a powdered composition, so the cells after freeze drying can be immersed in a solution containing an adjuvant when using the cells. In addition, the pupa of this manufacturing method can be mixed with other solids or liquids. For example, it is preferably a solid containing an adjuvant.

[0069] The pupae or cells produced by the present invention can be used directly, or cut, crushed, liquefied and used. The crude extract can be recovered from the pupae and then re-infiltrated into the pupae. The pupae can be used by infiltrating the liquid as described above, or mixed with other solids.

[0070] Examples of the method of direct use include a method of orally administering the pupae as a vaccine and a method of ingesting the pupae by eating them directly.

[0071] As the method of using after cutting or crushing, for example, the method of directly administering the pupa after cutting or crushing, the method of mixing the pupa after crushing with other materials that can be orally administered and administering, and the method of mixing the crushed material into feed and ingesting it in an edible manner can be listed. For example, in order to adjust the dosage in consideration of the immunogenicity of the pupa, it can be cut into, for example, 1 / 2, 1 / 3, 1 / 4, etc. The degree of crushing is not particularly limited as long as it shows immunogenicity, and for example, it can be made into powder. Cutting can be carried out, for example, using scissors for food and scissors for experimental animals, and crushing can be carried out, for example, using a mixer, a manual grinder and a pulverizing device. When using cells, it can be treated in the same way as when the pupa is crushed.

[0072] As oral administration, for example, oral administration and sublingual administration can be cited. In this specification, administration also includes the situation that pigs ingest by themselves. When the pupa is administered in its original form, oral administration is preferred, and it can also be included in feed so that pigs can eat it by themselves.

[0073] As the additive that can be administered orally, for example, food materials, beverage materials, excipients, thickeners, stabilizers, preservatives, pH adjusting agents, sweeteners, coloring agents, emulsifiers, spices, pharmaceutical additives described later, etc. can be enumerated. It is also possible to mix with food materials or beverage materials and administer in the form of functional food or beverage. As the liquid that comprises the material that can be administered orally, as long as the oral administration has immunogenicity with pupa, is not particularly limited for the liquid that is suitable for oral administration, and for example, can be water or an aqueous solution.

[0074] 5. Oral vaccine composition

[0075] The pupae or cells obtained as described above contain PCV2 proteins and have immunogenicity, and thus can be used as an oral vaccine composition.

[0076] Diseases that are the targets of the oral vaccine of the present invention include porcine circovirus-related diseases, post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephropathy syndrome (PDNS), porcine respiratory disease complex (PRDC), reproductive disorders, weight loss, increased mortality, diarrhea and other digestive tract diseases, and one or more of these can be the target.

[0077] In addition to the original shape of the pupa, the oral vaccine composition can also be in any dosage form such as liquid (syrup, jelly, etc.), powder, granule, tablet, powder, capsule, mashed feed, granule feed, crushed feed, expanded feed, and flake feed. When the cells are used as an oral vaccine composition, it can also be in any dosage form such as powder, granule, tablet, powder, capsule, mashed feed, granule feed, crushed feed, expanded feed, and flake feed.

[0078] The above dosage form can be usually formulated with a pharmaceutical additive using a method carried out in this field. As a pharmaceutical additive, for example, adjuvants, oral administration carriers, diluents, excipients, disintegrants, binding agents, lubricants, fluidizing agents, coating agents, solubilizers, dissolution aids, thickeners, dispersants, stabilizers, preservatives, pH regulators, osmotic pressure regulators, wetting agents, sweeteners, and spices can be cited. From the viewpoint of improving the effect as a vaccine, the pharmaceutical additive preferably contains an adjuvant.

[0079] Examples of adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, pertussis adjuvant, Ribi adjuvant, lipid A, liposomes, aluminum hydroxide, silica, enterotoxins (cholera toxin, cholera toxin α subunit, cholera toxin β subunit), Toll-like receptor (TLR) ligands (Poly (I: C), lipopolysaccharide, flagellin, CpG), mucosal adhesives (chitosan, lectin), cytokines, artificial synthetic adjuvants, oil adjuvants, high molecular weight polysaccharides, and the like.

[0080] The present invention may further include a step of mixing pupae or cells having immunogenicity with a pharmaceutical additive or a liquid containing the same. The oral vaccine composition of the present invention contains PCV2 protein expressed in pupae or cells. Here, it can be set as: relative to the total weight of the vaccine composition, for example, 0.001% by weight or more, 0.01% by weight or more, 0.1% by weight or more, 1% by weight or more, 2% by weight or more, 5% by weight or more, 10% by weight or more, 20% by weight or more, 30% by weight or more, 40% by weight or more, 50% by weight or more, 60% by weight or more, 70% by weight or more, 80% by weight or more, or 90% by weight or more of the immunogenic pupae or cell component (for example, freeze-dried pupae powder).

[0081] The liquid used as the pharmaceutical additive is not particularly limited as long as the oral vaccine composition has immunogenicity and is pharmaceutically suitable for oral administration, and examples thereof include water, physiological saline, and aqueous solutions such as phosphate buffered saline (PBS).

[0082] The pupae having immunogenicity may be used directly, cut or crushed, or liquefied, or a crude extract may be recovered from the pupae and then impregnated into the pupae. When cells are used, they may be crushed.

[0083] In the present invention, when the pupa is directly used in the form of a pupa, the step of mixing with the liquid containing the drug additive may include the step of immersing the freeze-dried pupa in the liquid. For example, by immersing the pupa in a solution containing an adjuvant, the solution containing the adjuvant can be easily infiltrated into the interior. The pupa impregnated with the liquid inside can be further cut or crushed to prepare an oral vaccine composition. In the case of cultured cells, it can also be used based on the crushed pupa.

[0084] When using cut or broken pupae, the step of mixing with a liquid containing a pharmaceutical additive may include a step of dispersing the cut or broken pupae in the liquid.

[0085] The vaccine composition of the present invention is administered to pigs, and the breed is not particularly limited. Examples of the breed include Middle Yorkshire, Large Yorkshire, Berkshire, Landrace, Duroc, Hampshire, and the like.

[0086] The vaccine for oral administration of the present invention exhibits immunogenicity even when directly orally administered in the form of pupae, but it may be administered after being cut or crushed, or may be used after being impregnated with a liquid as described above.

[0087] Examples of the method of directly administering in the form of pupae include a method of orally administering the pupae for oral administration as a vaccine and a method of directly ingesting the pupae for oral administration as food.

[0088] As a method of administration after cutting or crushing (including crushed cells), for example, there can be mentioned: a method of directly orally administering the cut or crushed pupae or cells; a method of mixing the cut or crushed pupae or cells with other orally administrable materials and then administering; and a method of mixing the crushed material in feed and ingesting it as food. For example, in order to consider the immunogenicity of the pupae, the dosage can be adjusted, for example, it can be cut into 1 / 2, 1 / 3, 1 / 4, etc. There is no particular limitation on the degree of crushing as long as it shows immunogenicity, and for example, it can be made into powder.

[0089] The dosage can be appropriately set in consideration of the administration target, the amount of antigenic protein expressed in pupae or cells, etc. For example, 0.01 to 100 pupae (0.001 g to 30 g) can be administered per time, and 0.1 to 10 pupae (0.01 g to 3 g) can be administered per time. The amount of PCV2 protein expressed is 0.2 mg to 10 mg relative to the weight of about 800 mg of pupae, and 0.025 wt% to 1.25 wt% relative to one pupa. As described above, one pupa for oral administration contains more than 10 times the amount of PCV2 protein per dose of a conventional injectable vaccine.

[0090] The number and duration of administration can be appropriately set in consideration of the subject of administration, the amount of PCV2 protein expressed in pupae or cells, etc. For example, the administration may be performed 1 to 5 times per day, 1 to 3 times per day, or once per day. In addition, for example, the administration may be performed 1 to 7 days per week, 1 to 5 days per week, or 1 to 4 days per week. In addition, these administrations may be repeated, for example, for 2 to 24 weeks, 1 to 7 weeks, 2 to 5 weeks, or 2 to 4 weeks.

[0091] When administering the vaccine, the age of the pig is not particularly limited, and can be any age from piglets to adult pigs. It should be noted that adult pigs also include pregnant sows.

[0092] It should be noted that when administering the vaccine, the subject may fast for about 1 to 3 hours before administration (before eating).

[0093] Specifically, for example, the drug can be administered to pigs in the following manner: Dosage: 0.1 to 5 pupae (0.01 g to 1.5 g), administered (ingested) once a day

[0094] Duration: 1 to 5 times per week, repeated for 3 to 4 weeks

[0095] Furthermore, booster immunization can be performed by similarly administering the vaccine thereafter, for example, every 1 to 4 weeks, preferably every 1 to 2 weeks.

[0096] By administering the composition of the present invention to pigs, immunity of pigs against porcine circovirus-related diseases can be induced.

[0097] The vaccine composition of the present invention may also be used in combination with other vaccines. The other vaccines may be vaccines that are immunogenic to PCV2 proteins or vaccines that are immunogenic to different antigenic proteins. In the case of vaccines that are immunogenic to the same antigenic proteins as pupae or cells, the pupae of the present invention may be administered, for example, for additional immunization with the other vaccines.

[0098] Furthermore, in the present invention, IgG and IgA responses were observed in the colostrum of pregnant sows that ingested the vaccine composition of the present invention. This indicates that the vaccine effect is also obtained through breast milk. In addition, when piglets received colostrum from sows, IgG and IgA responses were unexpectedly observed in the serum of one-day-old piglets. This indicates that piglets inherit the vaccine effect through breast milk.

[0099] Example

[0100] The present invention will be described in more detail below by way of examples, but the technical scope of the present invention is not limited to these examples.

[0101] [Example 1]

[0102] Confirmation trial of the efficacy of a new vaccine against PCV2 administered orally to piglets-1

[0103] Materials and Methods

[0104] (1) Silkworm culture cells and strains

[0105] The preparation of silkworm culture cells was carried out according to the method described in the existing literature (Masuda et al., 2018). The silkworm pupae strain used was Jinqiu Zhonghe (Atsumaru HD, Kumamoto, Japan).

[0106] (2) Preparation of recombinant baculovirus

[0107] The recombinant baculovirus was prepared according to the method described in the existing literature (Masuda et al., 2018). Specifically, the PCV2 genotype used was the PCV2 KU08-1 strain (PCV2a; Kagoshima University) (GenBank Accession No., LC381288). The region corresponding to the full length of PCV2 ORF2 (amino acid positions 1 to 233) was optimized according to the silkworm codon, and a DNA having the optimized base sequence (sequence number 1) was synthesized. The synthesized DNA was amplified and then subcloned into the pENTR11 vector to produce pDEST8-PCV2 ORF2 (1-233). The base sequence optimized according to the silkworm codon is shown in sequence number 1 (described below), and the amino acid sequence encoded by the base sequence is shown in sequence number 2.

[0108] ATGGGCACTTATCCGAGGAGGCGTTACCGCAGAAGAAGACACAGACCCCGTAGTCACCTGGGACAAATACTCAGAAGGAGACCGTGGCTGGTCCACCCGCGTCATAGGTATAGATGGAGACGCAAAAACGGAATCTTCAATACGAGGCTGAGCAGAACTTTTGGCTACACCGTCAA GGCAACAACTGTACGCACTCCGTCCTGGGCGGTCGACATGATGCGTTTCAACATTGACGATTTTGTACCTCCAGGTGGAGGCACCAACAAAATCTCGATTCCCTTCGAATACTATCGCATTCGTAAAGTGAAGGTTGAGTTTTGGCCTTGCTCGCCAATAACGCAAGGTGACCGTG GTGTGGGAAGTACAGCTGTTATCCTGGACGATAACTTCGTGACCAAGGCTACGGCCTTGACATACGATCCTTATGTTAATTACTCATCTAGGCACACAATTCCTCAACCATTCAGCTATCATTCCCGCTACTTTACGCCGAAACCCGTACTCGACTCTACAATCGATTACTTCCAG CCAAACAATAAGAGAACTCAACTGTGGTTGCGCCTCCAGACCTCACGTAACGTCGACCACGTAGGCCTGGGTACTGCCTTTGAAAACTCTATCTACGACCAAGATTACAACATCAGGGTGACCATGTACGTTCAGTTCAGAGAGTTCAACCTCAAGGATCCGCCCCTTAAGCCTTAA

[0109] For the recombinant baculovirus, BmNPV-T3ΔPE3P was used, in which six genes (chitinase A, cathepsin, egt, p26, p10 and p74) were deleted from the BmNPV-T3 strain to improve protein expression and prolong the survival of silkworms after infection.

[0110] (3) Expression of PCV2 capsid protein in insect culture cells and silkworm pupae

[0111] The PCV2 capsid protein was expressed according to the method described in the literature (Masuda et al., 2018). The recombinant baculovirus was used to infect pupae at a rate of 1×105 The infection period was 4 days.

[0112] (4) Preparation of oral vaccine antigens from silkworm pupae expressing PCV2 capsid protein

[0113] The infected silkworm pupae were stored frozen at -80°C. When preparing the powder, the pupae were taken out from -80°C and powdered using a mill mixer (Iwatani Sangyo, Osaka).

[0114] (5) Preparation of PCV2 virus

[0115] Serum samples from 10-12 week-old pigs (several specimens) that were confirmed to have PCV2 viremia and excrete the virus in their feces (PCV2 gene count: 5 × 10 5 The PCV2 challenge strain was prepared by 3-4 subcultures.

[0116] (6) Immunization schedule and sample collection for pig trials

[0117] Nine domestic pigs (4 weeks old) confirmed to be PCV2 negative by PCR and ELISA kits (including one reserve animal) were introduced to the Miwa Farm of Kyoto Animal Inspection Center Co., Ltd. for the experiment.

[0118] Domestic pigs were randomly divided into two groups: an oral vaccine administration group and a control (no drug administration) group.

[0119] The test schedule is as follows Figure 1 shown.

[0120] 1) Administration of test substances

[0121] From the introduction of 3 days later, 4 weeks of age, for the oral vaccine administration group, 5 times / 7 days cycle was carried out 3 times and oral administration was carried out based on feed addition. Regarding the new vaccine dosage, it was set to 1g silkworm pupa powder per 1 time. In addition, a non-administered control group was set. It should be noted that each group of 4 heads, a total of 8 heads were provided for the test.

[0122] 2) Attack Method

[0123] 21 days after the start of immunization (7 weeks of age), 5 mL of porcine PCV2 (KDK field isolate: PCV2) culture solution was sprayed into the nasal cavity of the test pigs once a day for 2 days for challenge. The challenge bacterial count was measured by real-time PCR (qPCR).

[0124] 3) Feeding of experimental pigs

[0125] During the test period, the piglets were given standard test feed SDS No. 2 (manufactured by FEED ONE CO., LTD) that did not contain antimicrobial substances.

[0126] 4) Observation period

[0127] The period was assumed to be 6 weeks from the first administration.

[0128] 5) Body weight measurement

[0129] Body weight was measured at the time of introduction, at the start of the first administration (4 weeks of age), at the time of the first challenge (7 weeks of age), and thereafter once a week.

[0130] 6) Quantification of PCV2 viral genome copy number

[0131] Quantification was performed using real-time PCR.

[0132] 7) Autopsy and lesion observation

[0133] Necropsy was performed 21 days after the first challenge.

[0134] 8) Statistical analysis

[0135] Regarding PCR quantification, the difference between the groups was evaluated by Student's t-test. The significance level was set at 5%.

[0136] <Results>

[0137] 1) Evaluation of PCV2 viral genome copy number in serum (evaluation of viremia)

[0138] In the oral vaccine administration group, PCV2 virus did not reach the detection limit after infection, while the PCV2 virus genome was detected in the non-administered group (control group) on the 7th day after infection and thereafter. The oral vaccine administration group significantly inhibited the proliferation of PCV2 virus (p<0.01) ( Figure 2 ).

[0139] 2) Evaluation of PCV2 viral genome copy number in various organs

[0140] The evaluation results of PCV2 viral genome copy numbers in the lung, hilar lymph nodes, mesenteric lymph nodes, and inguinal lymph nodes showed that the oral vaccine administration group showed a tendency to lower virus detection ratio and virus load compared with the non-administration group ( Figure 3 ).

[0141] 3) Weight changes

[0142] Clinical symptoms of PCV2 virus include suppression of weight gain. Compared with the non-administered group, the oral vaccine administration group showed a good trend of weight gain after PCV2 virus infection ( Figure 4 ).

[0143] 4) Observation after organ autopsy

[0144] The severity of lesions in lymph nodes, lungs, and intestines after autopsy was evaluated. The results showed that there was no significant difference in the incidence and severity of lesions between the oral vaccine administration group and the non-administration group. However, the proportion of lesions in the colon and cecum was low in the oral vaccine administration group (Table 1).

[0145] [Table 1]

[0146] Table 1. Observation of lesions in organs

[0147]

[0148] Lymph node: hypertrophy → o: none, 1: mild, 2: moderate, 3: severe

[0149] Lung: edema-like changes (circovirus lung) → o: none, 1: mild, 2: moderate, 3: severe

[0150] Intestinal: Leukoplakia → o: None, 1: Mild, 2: Moderate, 3: Severe

[0151] References

[0152] Masuda,A.,Lee,JM,Miyata,T.,Sato,T.,Hayashi,S.,Hino,M.,Kusakabe,T.(2018).Purification and characterization of immunogenic recombinant virus-like particles of porcine circovirus type 2expressed in silkworm pupae.J GenVirol,99(7),917-926.https: / / doi.org / 10.1099 / jgv.0.001087

[0153] [Example 2] Vaccination trial for pregnant pigs

[0154] Materials and Methods

[0155] 1. Test animals

[0156] Twelve pregnant pigs (less than 2 months after mating) with low PCV2 antibody titers were used.

[0157] 2. Test Type

[0158] The test types are listed in Table 2 below.

[0159] [Table 2]

[0160] Table 2 Experimental groups

[0161]

[0162] The test substance was mixed into feed and orally administered (administration by feed addition).

[0163] The dosage was set at a ratio of 5 times / 7 days.

[0164] The new vaccine dosage is set to be once a day, with 1.0 g of silkworm pupa powder per head.

[0165] 3. Test schedule

[0166] The test schedule is shown in Table 3 below.

[0167] [Table 3]

[0168] Table 3 schedule

[0169]

[0170] ○: Implement the items listed on the left

[0171] 4. Test methods

[0172] 1) Administration of test substance

[0173] About 8 weeks before the expected date of delivery after introduction (±1 week or so), oral administration was implemented by feed addition at a ratio of 5 times / 7 days for the oral immunization group (T02 group) (1 g per head per time), and then about 4 weeks before the expected date of delivery (±1 week or so) for the oral immunization group (T01 group and T02 group) at a ratio of 5 times / 7 days for the oral immunization group (T01 group and T02 group) (1 g per head per time). In addition, a non-administered control group (T03 group) was set. Each group had 4 heads, and a total of 12 heads were provided for the test.

[0174] 2) Feeding of experimental pigs

[0175] During the experimental period, the rats were given a normal feed for the gestation and lactation period [manufactured by Chubu Feed Co., Ltd. or FEED ONE CO., LTD.].

[0176] 3) Observation period

[0177] The first dose is given until weaning.

[0178] 5. Observation Project

[0179] 1) Body weight measurement (sow)

[0180] Body weights were measured at introduction and at weaning.

[0181] 2) Blood collection and antibody titer determination (sows)

[0182] Blood was collected four times in total, at the time of the first administration, the second administration, delivery, and weaning, and the antibody titer was measured by ELISA.

[0183] 3) Saliva collection and testing (sows)

[0184] Saliva was collected during blood collection, a total of 4 times.

[0185] 4) Colostrum collection (sows)

[0186] Collect colostrum during delivery.

[0187] 5) Clinical observation (sows and piglets)

[0188] During the experimental period (8 weeks before the expected date of delivery to weaning), general clinical symptoms were observed.

[0189] 6) Body weight measurement (piglets)

[0190] At farrowing and weaning, body weights of all pigs were measured.

[0191] 7) Blood collection and antibody titer determination (piglets)

[0192] This was performed twice in total, at one day of age and at weaning. Blood was collected from five pigs in each litter, and the antibody titer was measured by ELISA.

[0193] 6. Statistical Analysis

[0194] After normality was determined by the Shapiro-Wilk test, statistical analysis was performed using the Kruskal-Wallis test and the Wilcoxon rank-sum test with Bonferroni correction.

[0195] 7. Effectiveness evaluation

[0196] 1) PCV2 antigen-specific IgG and IgA antibody titers in serum

[0197] 2) PCV2 antigen-specific IgG and IgA antibody titers in saliva

[0198] 3) PCV2 antigen-specific IgG and IgA antibody titers in colostrum

[0199] <Results>

[0200] The results are shown in Figure 5 and Figure 6 .

[0201] Figure 5 This is a graph showing the antibody titers of IgG and IgA in colostrum of sows at farrowing.

[0202] Figure A shows the results of PCV2 antigen-specific IgG response in colostrum (diluted 4000 times) (ELISA). The error bars in each graph of T1, T2, and T03 represent the absorbance of whey in the oral immunization group (T01 group), the absorbance of whey in the oral immunization group (T02 group), and the absorbance of whey in the non-administered control group (T03 group) from the left.

[0203] Figure B shows the results of PCV2 antigen-specific IgA response in colostrum (diluted 250 times) (ELISA). The error bars in each graph of T1, T2, and T03 represent the absorbance of whey in the oral immunization group (T01 group), the absorbance of whey in the oral immunization group (T02 group), and the absorbance of whey in the non-administered control group (T03 group) from the left.

[0204] Figure 5 In the study, IgG and IgA responses were observed in the colostrum of sows, indicating that the vaccine effect was also obtained in breast milk.

[0205] Figure 6 This is a graph showing the antibody titers of IgG and IgA in the serum of one-day-old piglets.

[0206] Figure A shows the results of PCV2 antigen-specific IgG response in the serum of one-day-old piglets (diluted 4000 times) (ELISA). The error bars in each graph of T1, T2 and T03 represent the absorbance of serum from piglets born in the oral immunization group (T01 group), the absorbance of serum from piglets born in the oral immunization group (T02 group), and the absorbance of serum from piglets born in the non-administered control group (T03 group), respectively.

[0207] Figure B shows the results of PCV2 antigen-specific IgA response in the serum of one-day-old piglets (diluted 1000 times) (ELISA). The error bars in each graph of T1, T2 and T03 represent the absorbance of serum from piglets born in the oral immunization group (T01 group), the absorbance of serum from piglets born in the oral immunization group (T02 group), and the absorbance of serum from piglets born in the non-administered control group (T03 group), respectively.

[0208] Figure 6 It was shown that even in piglets that received colostrum from sows that had been vaccinated orally, IgG and IgA responses were observed in the serum at one day of age, indicating that the vaccine effect was passed on to piglets through breast milk.

[0209] [Example 3] Confirmation test 2 of the effect of oral administration of a new vaccine against PCV2 to piglets (dosage and dosage study)

[0210] <Test method>

[0211] 1. Test substances

[0212] New vaccine: New oral vaccine for porcine PCV2 (silkworm pupa powder expressing PCV2 rCap / VLP) 1 type Positive control: Circoflex (manufactured by Boehringer Ingelheim Co., Ltd.)

[0213] 2. Test animals

[0214] The effectiveness of the new vaccine for PCV2 infection in pigs was confirmed by experimental challenge test using porcine PCV2 virus using piglets born from the negative control group in the new circovirus vaccine test for breeding pigs and piglets born from some vaccinated sows. In the test, a total of 28 pigs shown in the test category were used for the test (Table 4).

[0215] [Table 4]

[0216] Test Type

[0217]

[0218] The test substance was administered orally forcibly.

[0219] 4. Test schedule

[0220] The test schedule is shown in Table 5.

[0221] [Table 5]

[0222]

[0223] 5. Test methods

[0224] 1) Administration of test substance

[0225] Administration of the test substance was carried out according to the test category. In this embodiment, group feeding was carried out in each group, and administration was forced oral administration. When forced oral administration was performed, 0.5 g of the test substance was weighed in advance, put into a 50 mL PP tube, and the pig was fixed and orally administered. After oral administration, the pig was forced to orally ingest about 20 mL of tap water.

[0226] There were 7 test groups, each with 4 heads, and a total of 28 heads were used in the test.

[0227] 2) Attack Method

[0228] 28 days after the start of immunization (9 to 10 weeks of age), 5 mL of porcine PCV2 (KDK field isolate: PCV2) culture fluid was sprayed into the nasal cavity of the test pigs once a day for 2 days for challenge. The challenge bacterial count was measured by real-time PCR (qPCR).

[0229] 3) Feeding of experimental pigs

[0230] During the test period, the piglets were given standard test feed SDS No. 2 (manufactured by FEED ONE CO., LTD) which did not contain any antimicrobial substances.

[0231] 4) Observation period

[0232] The period was assumed to be 8 weeks from the first administration.

[0233] 6. Observation Project

[0234] 1) Body weight measurement

[0235] Body weight was measured once a week from the start of the first administration until autopsy.

[0236] 2) Blood collection, PCV2 quantification and antibody titer determination in blood

[0237] From the start of the first administration to the time of autopsy, blood was collected a total of 9 times at one-week intervals, and PCV2 in the blood was quantified (qPCR) (PCR measurement was performed only after challenge).

[0238] 3) Saliva collection and testing

[0239] Blood samples were collected nine times at one-week intervals from the start of the first administration to the time of autopsy, and saliva was collected at the same time as blood collection.

[0240] 4) Clinical observation

[0241] During the test period (56 days), general clinical symptoms were observed. For deaths and elimination cases, the causes were found out and recorded as much as possible, but they did not occur in this example.

[0242] 5) Autopsy and observation of lung lesions

[0243] Necropsy was performed 28 days after the first challenge, and the lungs, hilar lymph nodes, mesenteric lymph nodes, and inguinal lymph nodes were collected.

[0244] 6) PCV2 quantification (real-time PCR)

[0245] The porcine PCV2 was quantified by real-time PCR in the serum after the challenge and in the organs to be examined at the time of autopsy.

[0246] 7. Statistical Analysis

[0247] 1) Increase: Dunnet test (p<0.05, P<0.01).

[0248] 2) PCR quantification: The Steel-Dwass method was used to perform comparison tests among the experimental groups.

[0249] 8. Effectiveness evaluation

[0250] 1) Increased amount and PCV2 virus level in blood (q-PCR)

[0251] 2) IgG antibody titer in serum

[0252] 3) IgA antibody titer in saliva

[0253] <Test results>

[0254] According to the experimental setting, the results were recorded as a 4-week immunization additional test and a subsequent 4-week challenge test.

[0255] 1. Additional immune tests

[0256] 1) Weight and weight gain

[0257] Regarding the results of body weight and weight gain in each group, the average total weight gain in each group during the 4-week test period was 18.2 kg to 20.4 kg, and the results of the Tukey-Kramer test showed that no significant difference was confirmed between the groups.

[0258] 2) Clinical symptoms

[0259] Regarding clinical symptoms in each group, no abnormalities in clinical symptoms such as vitality, appetite, and stool characteristics were observed during the test period.

[0260] 2. Attack test

[0261] 1) Weight and weight gain

[0262] The average total increase during the 4-week test period was 7.3 kg for the control group without drug administration (hereinafter referred to as T07), 16.9 kg for the group with 0.5 g of Cap silkworm pupae for 10 days (hereinafter referred to as T01), 17.8 kg for the group with 0.5 g of Cap silkworm pupae for 6 days (hereinafter referred to as T02), 19.3 kg for the group with 0.5 g of Cap silkworm pupae for 3 days (hereinafter referred to as T03), 9.0 kg for the group with piglets born from sow drug administration (1 cycle), 13.8 kg for the group with piglets born from sow drug administration (2 cycles), and 17.0 kg for the group with Circoflex drug administration (1 intramuscular administration). The drug administration groups showed a high increase ( Figure 7 ).

[0263] In the drug administration group, high increases were confirmed in T01, T02, T03, T05, and T06. The results of Dunnet's test (p<0.05) showed that in terms of the total increase in the 4-week trial period (4-8W), the T01, T02, T03, and T06 groups showed significantly higher values ​​than the negative control group T07 group ( Figure 7 ).

[0264] 2) Quantification of PCV2 virus genes in blood

[0265] The average quantitative values ​​of PCV2 genes in blood and their ratios to T07 (challenge control group) are shown in Table 6, and the changes in gene amounts over time are shown in Table 6. Figure 8 .

[0266] Regarding gene quantification, 4 weeks after the attack, T07 was 972125 copies / μL, and a high value was detected. However, in terms of the proportion of each dosing group relative to T07, T01 was 0.4%, T02 was 0.1%, T03 was 0.3%, T04 was 58.7%, T05 was 39.0%, and T06 was 0.0%. In particular, T01, T02, T03 and T06 were significantly low values.

[0267] Regarding the PCV2 gene level in blood, the Circoflex administration group showed the lowest detection level, followed by the Cap-expressing silkworm pupa 0.5 g administration group, which showed a significantly low detection level regardless of the administration dose.

[0268] [Table 6]

[0269] Table 6 Comparison of PCV2 gene levels in blood and virus inhibition ratio relative to the control group (T07)

[0270]

[0271] Statistics: Dunnet*: P<0.05

[0272] 3) PCV2 antigen-specific antibody titer in serum

[0273] In order to evaluate the amount of antibodies in the serum, antigen-specific IgG detection using the ELISA method was performed. The results showed that the absorbance increased from the second week after immunization in T06, and the absorbance was 1.969 in the fourth week after immunization (before the start of the attack). In the oral immunization group, the absorbance increased from the third week after immunization, and the absorbance ranged from 0.3 to 0.757 in the fourth week after immunization (before the start of the attack). Fig. 9 ).

[0274] Summary

[0275] The results of the virus challenge test showed that in the oral immunization group of piglets, weight gain effect, virus proliferation inhibition and antigen-specific IgG antibody induction were also observed under the dosage of 0.5g pupa powder × 3 days and reduced dosage and number of days of administration, indicating an excellent vaccine effect against PCV2.

[0276] In addition, in the case of transfer immunization alone, the virus proliferation inhibitory effect similar to the oral immunization group was not observed, but a certain body weight gain effect was observed after virus challenge, indicating that transfer immunization alone may be an effective immunization method.

[0277] [Example 4] Test to confirm the growth and decline of transferred antibodies in piglets after oral administration of a new vaccine against PCV2 to pregnant pigs

[0278] <Method>

[0279] 1. Test animals

[0280] Among the piglets born from four sows in each group, five piglets from each litter from which blood was collected, for a total of 60 piglets, were used for the test.

[0281] 2. Test Type

[0282] The test categories are shown in Table 7.

[0283] [Table 7]

[0284]

[0285] 3. Test schedule

[0286] The test schedule is shown in Table 8.

[0287] [Table 8]

[0288]

[0289] ○Implementation

[0290] 4. Observation Project

[0291] 1) Body weight measurement

[0292] The body weight of each individual was measured on day 0 (4 to 5 weeks of age), day 28 (8 to 9 weeks of age), and day 56 (12 to 13 weeks of age) after the start of the experiment.

[0293] 2) Blood and saliva collection

[0294] On the day of body weight measurement, blood and saliva were collected from each pig.

[0295] 3) Clinical observation

[0296] Observe the general condition (mentality, appetite, stool characteristics, etc.) during the test period.

[0297] 4) Blood antibody titer determination

[0298] The PCV2-specific IgG contained in the serum was measured by ELISA.

[0299] <Test results>

[0300] 1. Weight

[0301] The average body weight of each group was 16.5, 33.8 and 54.2 kg in T01, 10.3, 26.1 and 46.2 kg in T02, and 15.4, 33.7 and 54.1 kg in T03, in the order of 0th, 28th and 56th day after the start of the test.

[0302] The average weight gain during the period was 17.3, 20.4 and 37.7 kg in T01, 15.9, 20.1 and 36.0 kg in T02, and 18.3, 20.4 and 38.7 kg in T03 in the order of 0 to 28 days, 28 to 56 days and the entire period after the start of the test.

[0303] 2. IgG antibody titer in serum

[0304] At the beginning of the experiment (piglets 4-5 weeks old) and 4 weeks after the beginning of the experiment (piglets 8-9 weeks old), the absorbance of the T02 group was significantly higher than that of the other two groups. 8 weeks after the beginning of the experiment (piglets 12-13 weeks old), the T02 group showed a tendency to have a high absorbance ( Fig.10 ).

[0305] Summary

[0306] The results of evaluating the antibody fluctuation of the transferred antibody by ELISA showed that the antibodies were significantly maintained in piglets at 8 to 9 weeks of age compared with the non-administered group. Among the injectable vaccines on the market, there are also products that claim to have the effect of maintaining the transferred antibodies of piglets until 5 weeks of age. Therefore, through the sow immunization experiment of this example, it can be considered that oral administration of silkworm-derived antigens to sows can give piglets excellent immune effects brought about by the transferred antibodies.

[0307] Sequence Listing Free Text Sequence Number 1: Synthetic DNA Sequence Number 2: Synthetic construct.

Claims

1. An oral vaccine composition for porcine circovirus-related diseases, comprising pupae or cells of baculovirus-infectious insects, wherein the pupae or cells are infected with a recombinant baculovirus into which a DNA encoding porcine circovirus type 2 protein is introduced and freeze-dried.

2. The oral vaccine composition according to claim 1, wherein The DNA encoding porcine circovirus type 2 protein is the DNA represented by sequence number 1.

3. The oral vaccine composition according to claim 1, wherein Also included are solutions containing adjuvants.

4. The oral vaccine composition according to claim 1, wherein The composition comprises at least 20% by weight of pupae relative to the total weight of the composition.

5. The oral vaccine composition according to claim 1, wherein The porcine circovirus-related disease is at least one selected from the group consisting of post-weaning multisystemic wasting syndrome, porcine dermatitis and nephropathy syndrome, porcine respiratory disease syndrome and reproductive failure.

6. A method for producing an oral vaccine against porcine circovirus-related diseases, comprising the steps of: infecting larvae or pupae of baculovirus-infectious insects with a recombinant baculovirus introduced with a DNA encoding porcine circovirus type 2 protein, and freeze-drying pupae obtained by pupation of the infected larvae or the infected pupae.

7. A method for producing an oral vaccine against porcine circovirus-related diseases, comprising the steps of: infecting baculovirus-infectious cells with a recombinant baculovirus introduced with a DNA encoding porcine circovirus type 2 protein, and freeze-drying the infected cells.

8. The oral vaccine composition according to claim 6 or 7, wherein The DNA encoding porcine circovirus type 2 protein is the DNA represented by sequence number 1.

9. The method according to claim 6, wherein: The insect is the silkworm.

10. The method according to claim 7, wherein: The cells are cells derived from the yellow-collared armyworm, the silkworm, the silkworm, the fall armyworm or the cabbage looper.

11. A method for immunizing pigs against porcine circovirus, comprising the step of administering the composition according to any one of claims 1 to 5 to pigs.

Images