SgRNA guide sequence specifically targeting porcine HMGA1 and HMGA2 genes and application of sgRNA guide sequence

Abstract

The invention relates to the technical field of animal gene engineering, in particular to an sgRNA guiding sequence of specific targeting pig HMGA1 and HMGA2 genes and application of the sgRNA guiding sequence. According to the invention, four sgRNA guiding sequences are respectively designed aiming at porcine HMGA1 and HMGA2 genes, and the sgRNA guiding sequences capable of efficiently targeting the porcine HMGA1 and HMGA2 genes and the combination of the sgRNA guiding sequences are selected from the four sgRNA guiding sequences by utilizing a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 system. The sgRNA guide sequence and the combination thereof provided by the invention are combined with a CRISPR / Cas9 system for use, so that the editing of the HMGA1 and HMGA2 genes in the pig can be realized, the simultaneous knockout of the HMGA1 and HMGA2 genes is further realized, and a technical foundation is laid for the application of gene breeding, xenotransplantation, gene function research models and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biological genetic engineering, and relates to animal husbandry, in particular to pig genetic engineering technology, in particular to sgRNA guide sequences specifically targeting pig HMGA1 and HMGA2 genes and applications thereof. Background Art

[0002] High mobility group proteins (HMG proteins) are widely present in eukaryotic cells and are named for their high mobility in polyacrylamide gel electrophoresis. HMG proteins are the driving force behind gene regulation in eukaryotic cells. They are non-histone proteins and are the most abundant group of chromatin proteins in eukaryotic cells after histones. They play an important role in the structure and function of chromatin and in the regulation of gene expression. The HMG protein family can be divided into three subfamilies: HMGA, HMGB, and HMGN.

[0003] HMGA is the most abundant non-histone protein family in the nucleus of vertebrates and invertebrates. The HMGA protein family includes 4 main members, of which HMGA1a, HMGA1b, and HMGA1c are encoded by the gene hmga1, and HMGA2 is encoded by the hmga2 gene (see Vignali R, et al. Hmga Genes and Proteins in Development and Evolution. International journal of molecular sciences (2020) 21 (2): 654). Among them, HMGA1 is involved in cell cycle progression, embryonic development, tumor transformation, etc. (see Kolb S, et al. Hmga1 Controls Transcription of Insulin Receptor to Regulate Cyclin D1 Translation in Pancreatic Cancer Cells. Cancer Research (2007) 67 (10): 4679-86). HMGA2 is believed to be closely related to body shape and growth. People who lack this gene are short in stature (see Leszinski GS, et al. A Case Report and Review of the Literature Indicate That Hmga2 Should Be Added as a Disease Gene for Silver-Russell Syndrome. Gene (2018) 663: 110-4). HMGA1 and HMGA2 are expressed in the early stages of mouse development and are undetectable in most adult tissues (see Parisi S, et al. HMGA Proteins in Stemness and Differentiation of Embryonic and Adult Stem Cells. Int J Mol Sci. (2020) 6; 21 (1): 362); but the expression level in cancer is usually very high (see Pallante P., et al. High mobility group a proteins as tumor markers. Front. Med. (Lausanne) (2015) 2: 15).

[0004] At present, the animal models of HMGA are mainly mice and pigs. There are three mouse models. HMGA1-KO mice show down-regulated insulin receptor expression after knocking out HMGA1 exons 3, 4, and 5 by homologous recombination (see Foti D, et al. Lack of the architectural factor HMGA1 causes insulin resistance and diabetes in humans and mice. Nat Med. (2005) 11 (7): 765-73). HMGA2-KO mice show a 60% reduction in body size after knocking out exons 1 and 2 by homologous recombination (see Zhou X, et al. Mutation responsible for the mouse pygmy phenotype in the developmentally regulated factor HMGI-C. Nature (1995). 376, 771–774). Mice lacking both HMGA1 and HMGA2 obtained by hybridization have a smaller body size, only 30% of that of normal mice (see Federico A., et al. Hmga1 / Hmga2 double knock-out mice display a "superpygmy" phenotype. Biol. Open. (2014) 3: 372–378).

[0005] Mouse models are often used to determine important gene functions and confirm the feasibility of genome editing, while pigs, as a complement to other model systems, can provide preclinical evidence for human diseases and test treatment options. The existing HMGA2-KO pig model uses homologous recombination and TALEN-mediated NHEJ repair to knock out HMGA2 exons 1 and 2, which manifests as reduced body size (1 / 5 of the normal group at 3 months of age), abnormal fetal resource allocation, and cryptorchidism. Considering that HMGA family proteins have regulatory effects on many genes, the function of one protein in the family can be compensated or partially compensated by another family member (see Federico A, et al. Hmga1 / Hmga2 double knock-out mice display a "superpygmy" phenotype. Biology Open (2014) 3(5): 372-8), and in multiple strains of Chinese pigs, HMGA1 is also considered to be a gene related to limb length, obesity and body size (see Zhang LC, et al. A Genome-Wide Association Study of Limb Bone Length Using a Large White×Minzhu Intercross Population. Genetics Selection Evolution (2014) 46(1): 1-8 and Wang L, et al. Genome-Wide Association Studies Identify the Loci for 5 Exterior Traits in a Large White×Minzhu Pig Population. PLoS One (2014) 9(8): e103766). So far, there has been no report on the effects of simultaneous knockout of HMGA1 and HMGA2 on pigs. Therefore, the creation of genetically modified pigs with simultaneous knockout of HMGA1 and HMGA2 is of great significance for the research and development of new pig breeds.

[0006] Gene editing technology can precisely modify specific target genes (target genes) in the genome of an organism. Gene editing technology can be used to delete, replace, mutate endogenous genes, or insert exogenous genes. Depending on the editable nuclease used, there are currently three main types of mainstream gene editing technologies: zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and clustered regularly repeated short palindromic sequences (CRISPR / Cas9). All three technologies can efficiently target genes and introduce multi-allelic modifications into somatic cells. Common methods for constructing genetically modified animals include somatic cell nuclear transfer (SCNT), pronuclear injection, lentivirus transfection, and sperm-mediated gene transfer.

[0007] As the latest and more mature CRISPR gene editing technology, the CRISPR / Cas system is an acquired immune system in bacteria and archaea that specifically cuts exogenous genetic material through RNA-mediated cutting. The type II CRISPR / Cas system, namely CRISPR / Cas9, has been proven to be widely used for efficient cutting of any given DNA in vivo and in vitro. At the same time, the system can be used for site-directed mutagenesis and site-directed insertion of the genome. Compared with traditional ZFN and TALEN technologies, CRISPR / Cas9 has the advantages of high efficiency, small sequence selection restrictions, simple construction process, and the ability to target multiple genes at the same time. The biggest disadvantage of CRISPR / Cas9 is its off-target effect. At present, many studies have shown that this off-target effect can be controlled by certain technical means. This is closely related to the specificity of sgRNA.

[0008] In the patent literature, WO2021144574A1 discloses a method for gene editing of unfertilized pig and bovine oocytes by gene editing of unfertilized oocytes. The gene editing system used is CRISPR / Cas9, and the target gene mentions HMGA. However, the HMGA gene and / or its sgRNA are not implemented in the examples, so it is not clear whether it can be successful and the efficiency of its targeting, which is not enough to convince technicians in the field of this gene editing effect.

[0009] WO2023150503A2 discloses a gene editing method for embryonic stem cells, where the host animal includes pigs, the gene editing system used is CRISPR / Cas9, and the target gene mentions HMGA. However, the HMGA gene and / or its sgRNA are not implemented in the examples, so it is not clear whether it can be successful and the efficiency of its targeting, and it is not enough for those skilled in the art to believe in the effect of gene editing.

[0010] In addition, since the method for predicting sgRNA efficiency is not perfect, one sgRNA can only target one site of the gene, and the targeting efficiency is low. Even if the targeting is successful, it may not cause frameshift mutations because only a few base insertions and deletions (indels) are generated, which does not affect the function of the protein. The prior art does not disclose the technology of simultaneously knocking out two genes by simultaneously targeting porcine HMGA1 and porcine HMGA2 with specific dual sgRNAs.

[0011] The purpose of the present invention is to overcome the shortcomings of the prior art, improve the targeting efficiency and reduce the influence of the compensation mechanism of the same family members, so as to more conveniently produce and study HMGA1 and HMGA2 gene knockout related transgenic pigs, and lay the foundation for the preparation of related transgenic pigs. Summary of the invention

[0012] In order to solve the above technical problems, the present invention provides a sgRNA guide sequence that specifically targets the porcine HMGA1 gene, and the target sequence targeted by the sgRNA guide sequence is a nucleotide sequence as shown in SEQ ID NO:1.

[0013] Preferably, the sgRNA guide sequence is selected from SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

[0014] The present invention also provides a sgRNA guide sequence that specifically targets the porcine HMGA2 gene, wherein the target sequence targeted by the sgRNA guide sequence is a nucleotide sequence as shown in SEQ ID NO:6.

[0015] Preferably, the sgRNA guide sequence is selected from SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.

[0016] The present invention further provides a plurality of sgRNA guide sequence combinations of the above-mentioned sgRNAs that specifically target the porcine HMGA1 gene and the porcine HMGA2 gene, respectively.

[0017] The present invention also provides a nucleic acid molecule encoding the above-mentioned sgRNA guide sequence or a combination of multiple sgRNA guide sequences.

[0018] The present invention further provides a biomaterial, which comprises the above-mentioned sgRNA guide sequence or a combination of multiple sgRNA guide sequences, and the biomaterial is one or more of a vector, an expression cassette or a transgenic cell.

[0019] The present invention also provides a method for targeted knockout of porcine HMGA1 gene and / or porcine HMGA2 gene based on CRISPR / Cas9, the method comprising the following steps:

[0020] 1) Extract porcine genomic DNA and amplify HMGA1 and HMGA2 genes respectively, and design the above-mentioned sgRNA guide sequences according to the target sequences;

[0021] 2) culturing porcine fetal fibroblasts, and when the cell density reaches 80-90%, collecting the cells for transfection;

[0022] 3) mixing the sgRNA guide sequence or its paired combination with the Cas9 protein to form an RNP complex, and performing transfection by electroporation;

[0023] 4) Cultivating and screening the transfected monoclonal cells to obtain a porcine fetal fibroblast cell line in which the HMGA1 gene and / or porcine HMGA2 gene is targeted and knocked out.

[0024] The present invention also provides a primer pair for identifying targeted knockout of porcine HMGA1 gene and / or porcine HMGA2 gene, wherein the left and right primers for identifying HMGA1 gene have sequences as shown in SEQ ID NOs: 11 and 12, respectively, and the left and right primers for identifying HMGA2 gene have sequences as shown in SEQ ID NOs: 13 and 14, respectively.

[0025] The present invention further provides the use of the above-mentioned sgRNA guide sequence, a combination of multiple sgRNA guide sequences, nucleic acid molecules or biological materials in gene breeding, xenotransplantation, gene function research models, etc. The present invention has the following beneficial effects:

[0026] The present invention obtains the nucleotide sequences of Bama pig HMGA1 and HMGA2 genes by extracting Bama pig genomic DNA, amplifying target sequences and performing sequencing analysis. Based on the analysis of the sequences and in accordance with the design principle of sgRNA in CRISPR / Ca9, sgRNA guide sequences are designed and screened on the Bama pig HMGA1 and HMGA2 genes, and finally 4 sgRNA guide sequences specifically targeting HMGA1 and 4 sgRNA guide sequences specifically targeting HMGA2 are screened and obtained.

[0027] The present invention provides 4 sgRNA guide sequences specifically targeting porcine HMGA1 and 4 sgRNA guide sequences specifically targeting porcine HMGA2 and combinations thereof, and provides applications of the above sgRNA guide sequences and combinations thereof. The present invention obtains a porcine fetal fibroblast cell line with HMGA1 gene knocked out, a porcine fetal fibroblast cell line with HMGA2 gene knocked out, and a porcine fetal fibroblast cell line with both HMGA1 and HMGA2 genes knocked out through the CRISPR / Cas9 targeted knockout technology of the above sgRNA guide sequences and combinations thereof.

[0028] The present invention constructs porcine fibroblasts lacking the HMGA1 and / or HMGA2 genes without introducing exogenous genes by combining dual sgRNA with CRISPR / Cas9 gene editing technology, and hopes to prepare HMGA1 and HMGA2 double-gene knockout pigs through these lacking cells, laying an important foundation for related research such as gene breeding, xenotransplantation, and providing animal research models of new strains of companion animals.

[0029] For the target sequences on the pig HMGA1 and HMGA2 genes, the present invention designed four sgRNAs respectively, and performed paired screening through the double sgRNA targeted knockout method, and found that 4 sequences can specifically target the pig HMGA1, and the other 4 sequences can specifically target the HMGA2 gene. At the same time, the double sgRNA combination and its effect verification were performed on them respectively, and the most preferred double sgRNA combination was obtained, which can most efficiently knock out the HMGA1 and HMGA2 genes at the same time.

[0030] The advantage of the present invention is that, for the first time, a porcine fetal fibroblast cell line with HMGA1 / HMGA2 gene knockout and a porcine fetal fibroblast cell line with HMGA1 and HMGA2 double gene knockout without exogenous gene introduction is obtained through the CRISPR / Cas9 gene editing system, which fills the gap in related technologies at home and abroad, and optimizes the most efficient sgRNA and its combination. The relevant gene knockout cell line obtained by the present invention can be used as a donor for somatic cell nuclear transplantation to prepare transgenic pigs, which is of great significance for the research and development of new pig breeds.

[0031] The experiments of the present invention prove that the sgRNA and the combination thereof for specifically targeting the pig HMGA1 and HMGA2 genes provided by the present invention have strong specificity and high targeting efficiency, and can effectively reduce the off-target phenomenon caused by the CRISPR / Cas9 system during gene modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The present invention shows the dual sgRNA pairing screening that specifically targets porcine HMGA1.

[0034] Figure 2The present invention shows the dual sgRNA pairing screening that specifically targets porcine HMGA2.

[0035] Figure 3 The figure shows the optimization of dual sgRNA targeting conditions for simultaneously targeting porcine HMGA1 and HMGA2 according to the present invention.

[0036] Figure 4 The PCR identification results of some clones of HMGA1 knockout pig fetal fibroblasts of the present invention are shown.

[0037] Figure 5 The monoclonal sequencing analysis of three HMGA1 knockout pig fetal fibroblasts of the present invention is shown.

[0038] Figure 6 The PCR identification results of some clones of HMGA2 knockout pig fetal fibroblasts of the present invention are shown.

[0039] Figure 7 The monoclonal sequencing analysis of three HMGA2 knockout pig fetal fibroblasts of the present invention is shown.

[0040] Figure 8 The monoclonal PCR identification results of the HMGA1 and HMGA2 double gene knockout pig fetal fibroblasts of the present invention are shown.

[0041] Fig. 9 The monoclonal sequencing analysis of three strains of HMGA1 and HMGA2 double gene knockout pig fetal fibroblasts of the present invention is shown. DETAILED DESCRIPTION

[0042] The following is further described in detail through specific implementation methods. However, it should be pointed out that the following embodiments of the present invention are only for better illustrating the content of the present invention, but do not mean that the content of the present invention is limited to the examples. Therefore, those skilled in the art can make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still belongs to the protection scope of the present invention and is subject to the protection scope of the attached claims.

[0043] It is clear to those skilled in the art that the HMGA protein family includes 4 main members, of which HMGA1a, HMGA1b, and HMGA1c are encoded by the gene hmga1, and HMGA2 is encoded by the hmga2 gene. In the present invention, gene editing is performed by using two genes hmga1 and hmga2 as target genes. The full-length sequences of these two genes are clear to those skilled in the art. It is also clear to those skilled in the art that HMGA1 generally refers to the encoded protein, including HMGA1a, HMGA1b, and HMGA1c, and HMGA2 refers to the encoded protein, but since this article only involves the operation of genes, therefore, in this article, unless otherwise specified, HMGA1, HMGA1 gene, and hmga1 are interchangeable expressions, HMGA2, HMGA2 gene, and hmga2 are interchangeable expressions, all referring to the above two gene sequences, not involving the expressed proteins.

[0044] Although this article only uses the relevant genes of Bama pigs as examples to verify the effects of the relevant technology of the present invention, those skilled in the art are aware that most sequences of the same genes in animals are conserved, especially in the pig species. The HMGA1 / 2 gene target sequence involved in the present invention is highly conserved in various pig breeds, so the technology of the present invention is also applicable to other pig breeds.

[0045] It is also clear to those skilled in the art that the CRISPR / Cas system is the latest generation of gene editing technology, which is widely used and mature. The present invention uses a type II CRISPR / Cas system, namely CRISPR / Cas9, in the embodiments, which is currently the most widely used CRISPR / Cas system. However, it is also clear to those skilled in the art that other mature CRISPR / Cas gene editing systems can be used, and these editing systems can be purchased or licensed on the market, and their operating methods are mature and do not affect the implementation of the technical solution of the present invention.

[0046] If the technology, instruments, equipment and materials used in the present invention are not particularly specified, any other technology, instruments, equipment and materials known to those skilled in the art that can achieve the same purpose may be used; even if the technology, instruments, equipment and materials used in the present invention are particularly specified, it does not mean that the present invention can only use these technologies, instruments, equipment and materials, which only represent the preferred embodiments of the present invention, and those skilled in the art can still use any other technology, instruments, equipment and materials known to those skilled in the art that can achieve the same purpose.

[0047] The sgRNA guide sequence is one of the key factors affecting the effect in the CRISPR / Cas gene editing system. In the present invention, the applicant named the four sgRNA guide sequences specifically targeting pig HMGA1 as HMGA1-sgRNA1 (sequence number SEQ ID NO: 2), HMGA1-sgRNA2 (sequence number SEQ ID NO: 3), HMGA1-sgRNA3 (sequence number SEQ ID NO: 4) and HMGA1-sgRNA4 (sequence number SEQ ID NO: 5). The four sgRNA guide sequences specifically targeting the pig HMGA2 gene are named HMGA2-sgRNA1 (sequence number SEQ ID NO: 7), HMGA2-sgRNA2 (sequence number SEQ ID NO: 8), HMGA2-sgRNA3 (sequence number SEQ ID NO: 9) and HMGA2-sgRNA4 (sequence number SEQ ID NO: 10). In the sequence provided by the present invention, the base sequence direction is all 5' to 3'.

[0048] The following is the sequence description and specific sequence corresponding to the sequence number in the sequence list:

[0049] SEQ ID NO: 1 is a DNA fragment of the HGMA1 gene cloned in the present invention: cccagccgtcgctcctccacctgctctatagacaaggaaagatgagcgagtcgagctcgaagtctagccagcccttggcctccaagcaggaaaaggacggcactgagaagcgagggcggggcaggccgcgcaagcagcctccggtgagtcccgggactgcgctggtagggagt

[0050] SEQ ID NO:2 is HMGA1-sgRNA1: actccctaccagcgcagtcc

[0051] SEQ ID NO:3 is HMGA1-sgRNA2: gtcccgggactgcgctggta

[0052] SEQ ID NO:4 is HMGA1-sgRNA3: caggtggaggagcgacggct

[0053] SEQ ID NO: 5 is HMGA1-sgRNA4: ctccacctgctctatagaca

[0054] SEQ ID NO:6 is the DNA fragment of the HGMA2 gene cloned in the present invention: cccggtgatcgcaacttttgatcccaaaccgagaggggagtctcccaacttcaaatcctcttttccttctccttcgctttcctcctctcactacctccaccgccaccgccacctccacctccggcacccacccaccgctgccgccgccaccagcagcgcctccttctctcctcctcctcctcccctcttctctttttggcagccgctggacgtccggtgttgatggtggcagcggcggcagcctaagcagcagcagccctcgccgcacgccagctctagcccaccctgccttattctctagtcctacctcccaatctcccgaaaggtgctgggcagattcggggcggctgaggcgaagcggcagcggtaggagcggcggcggcagcggtagcggcggcggcggcggcgcgaggcaggatgagcgcacgcggtgaaggcgccgggcagccgtccacttcagcccagggacaacctgccgccccggtgcctcagaagaga

[0055] SEQ ID NO:7 is HMGA2-sgRNA1: gatcaaaagttgcgatcacc

[0056] SEQ ID NO:8 is HMGA2-sgRNA2: cgctggacgtccggtgttga

[0057] SEQ ID NO:9 is HMGA2-sgRNA3: cggggcggcaggttgtccct

[0058] SEQ ID NO:10 is HMGA2-sgRNA4: tctcttctgaggcaccgggg

[0059] Primers used to identify porcine HMGA1 were used to specifically amplify a DNA fragment named HMGA1-D (i.e., the sequence shown in SEQ ID NO: 15). Primers used to identify porcine HMGA2 were used to specifically amplify a DNA fragment named HMGA2-D (i.e., the sequence shown in SEQ ID NO: 16). The sequence descriptions, numbers, and specific sequences of these primer sequences are as follows:

[0060] SEQ ID NO: 11 is the left primer among the primers for HMGA1 sgRNA targeting identification:

[0061] AGGACAACAAAGAGCCCTTCTGAAC

[0062] SEQ ID NO: 12 is the right primer among the primers for HMGA1 sgRNA targeting identification:

[0063] ACCTCCCTAGCCCAAAGAAGTAAAC

[0064] SEQ ID NO: 13 is the left primer among the primers for HMGA2 sgRNA targeting identification:

[0065] TTCAAGGGACACAATCCACTCCAAG

[0066] SEQ ID NO: 14 is the right primer among the primers for HMGA2 sgRNA targeting identification:

[0067] CACAATAGCGAAAGTCGGAGGACG

[0068] SEQ ID NO:15 is a DNA fragment of the HGMA1 gene cloned in the present invention, which was amplified using SEQ ID NO:11 and SEQ ID NO:12 as an identification primer pair:

[0069] aggacaacaaagagcccttctgaacaggagataaggagctgattagggccaacggccgggcccgcctgcggctgcat

[0070] tctgggactgggcagacccccccatcagccggagtgggaatcaagggtccccttgggagcaggcatcctgttgggtgtat

[0071] ggaagatgggggtgggtaggaggtggctaaagcaagatgctttgtttcaaacaacttttcctgtctcccagcagcatcccag

[0072] ccgtcgctcctccacctgctctatagacaaggaaagatgagcgagtcgagctcgaagtctagccagcccttggcctccaag

[0073] caggaaaaggacggcactgagaagcgagggcggggcaggccgcgcaagcagcctccggtgagtcccgggactgcg

[0074] ctggtagggagtcaggtgggtgtcaaacctttgcctctgtttacttctttgggctagggaggt

[0075] SEQ ID NO:16 is a DNA fragment of the HGMA2 gene cloned in the present invention, amplified by SEQ ID NO:13 and SEQ ID NO:14 as identification primer pairs:

[0076] ttcaagggacacaatccactccaagtctcttccctttccaagccgcttccgaagtgctcccggtgatcgcaacttttgatccca

[0077] aaccgagaggggagtctcccaacttcaaatcctcttttccttctccttcgctttcctcctctcactacctccaccgccaccgcca

[0078] cctccacctccggcacccacccaccgctgccgccgccaccagcagcgcctccttctctcctcctcctcctcccctcttctctt

[0079] tttggcagccgctggacgtccggtgttgatggtggcagcggcggcagcctaagcagcagcagccctcgccgcacgcca

[0080] gctctagcccaccctgccttattctctagtcctacctcccaatctcccgaaaggtgctgggcagattcggggcggctgaggc

[0081] gaagcggcagcggtaggagcggcggcggcagcggtagcggcggcggcggcggcgcgaggcaggatgagcgcacg

[0082] cggtgaaggcgccgggcagccgtccacttcagcccagggacaacctgccgccccggtgcctcagaagagaggacgcg

[0083] gccgacccaggaagcagcagcaagtcagtacgcaggcggggtgggggcacagcccacctccgagccctctgcaagg

[0084] gccccgcgacgcgcggccatccgagcgcgggagcccagtcgccgcggccgccgcacgctgtcgcgggggcgggct

[0085] gcggagtcccccgcgcgagtgcgcggctgagccccaggcgcccgcgccctcccggccgggaggtggggagccgtct

[0086] ttggcggctgggtgcgggcgggaggtggggtcgggcgaattgcgtcctccgactttcgctattgtg

[0087] Example 1 Acquisition of sgRNA sequences and detection of targeting efficiency

[0088] 1. Design and acquisition of sgRNA sequences:

[0089] The genomic DNA of Bama pig was extracted and the target sequences of HMGA1 and HMGA2 genes were amplified respectively. The sgRNAs were designed by sequencing analysis and comparison using CRISPOR (http: / / crispor.tefor.net / ). Four sgRNAs were designed for HMGA1 and HMGA2 genes respectively and synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0090] 2. Cell culture and collection:

[0091] Using KnockoutTM Porcine fetal fibroblasts (P1 generation, isolated and preserved by the laboratory of the inventor's team from porcine fetuses from the Jiufengshan Experimental Base of Chongqing Academy of Animal Husbandry Sciences) were resuscitated with DMEM complete medium (Gibco). The cell density needed to reach 70-90% before passage. After 2-4 days of culture, when the cell density reached 80-90%, it was used for transfection.

[0092] 3. Pairing and screening of sgRNA:

[0093] Transfection was performed by electroporation.

[0094] (1) Take 1×10 6 The cells were used for electroporation of the paired sgRNA, washed twice with DPBS, and resuspended in 87 μL Opti-MEM medium (Gibco);

[0095] (2) Preparation of RNP complex: 5 μg of each of the dual sgRNAs pairing the HMGA1 and HMGA2 single genes were mixed with 6 μg of Cas9 protein (M0646, NEB) and incubated at room temperature for 15 min to form an RNP complex (see Table 1 below).

[0096] Table 1 RNP complex composition of single gene knockout

[0097]

[0098] (3) Electrotransfection:

[0099] After mixing the RNP complex with porcine fetal fibroblasts, 100 μL was added to the electroporation cup and the NEPA21 high-efficiency gene transfection system (NEPA GENE Co., Ltd) was used with the following parameters:

[0100] Poring Pulse: Voltage: 150V, Pulse Length: 5ms, Pulse Interval: 5ms, Number of Pulses: 2, Decay Rate: 10%, Polarity: +

[0101] Transfer Pulse: Voltage: 20V, Pulse Length: 50ms, Pulse Interval: 50ms, Number of Pulses: 5, Decay Rate: 40%, Polarity: + / -

[0102] Click Ω to record the impedance value (range 30-50Ω).

[0103] (4) The electrotransfected cells were added to a 6-well plate and cultured for 24 hours;

[0104] (5) PCR detection of targeting efficiency: According to the position of the designed sgRNA guide sequence, identification primers were designed respectively. The primer sequences for identifying HMGA1 were SEQ ID NO: 11 and SEQ ID NO: 12, and the primer sequences for identifying HMGA2 were SEQ ID NO: 13 and SEQ ID NO: 14.

[0105] 24 hours after electrotransfection, the cell genomic DNA was extracted and PCR amplified for HMGA1 and HMGA2 using the identification primers. The PCR reaction system (Takara) was 50 μL: 2× PrimeSTAR Max Premix: 25 μL, F: 0.2 μM, R: 0.2 μM, DNA: 20-100 ng, and H2O was added to 50 μL. The PCR reaction conditions were: 98°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 62°C annealing for 5 s, 72°C extension for 5 s, a total of 35 cycles, and then 72°C extension for 5 min.

[0106] The obtained PCR products were subjected to agarose gel electrophoresis. After analysis, the electrophoresis bands of the double sgRNA targeting the HMGA1 gene were all correct, among which the targeting efficiency of combination 1# was 30.1%, the targeting efficiency of combination 2# was 19.5%, the targeting efficiency of combination 3# was 51%, and the targeting efficiency of combination 4# was 39.9%. Combination 3# was preferred for the next step of constructing the HMGA1 gene knockout porcine fetal fibroblast cell line (see Figure 1 ). The electrophoresis bands of the double sgRNA targeting HMGA2 gene were all correct, but there were mixed bands in 5# and 6#. The targeting efficiency of 7# combination was 43.6%, and the targeting efficiency of 8# combination was 28.3%. The 7# combination was preferred for the next step of constructing the HMGA2 gene knockout porcine fetal fibroblast cell line (see Figure 2 ).

[0107] 4. Optimization of dual gene targeting conditions for simultaneously targeting porcine HMGA1 and HMGA2:

[0108] Based on the screening of the above sgRNA targeting conditions, after determining the best sgRNAs targeting porcine HMGA1 (HMGA1-sgRNA2+HMGA1-sgRNA3) and HMGA2 (HMGA2-sgRNA2+HMGA2-sgRNA3), the matching conditions of the RNP complex were optimized (see Table 2 below).

[0109] After electroporation, genomic DNA was extracted and the targeting efficiency was detected by PCR to determine the optimal ratio of sgRNA to Cas9 protein. After PCR detection and analysis of the HMGA1 gene and HMGA2 gene, the targeting results of group a were the best, with the targeting efficiency of HMGA1 being 35.6% and that of HMGA2 being 37.6% (see Figure 3 ).

[0110] Table 2 RNP complex composition of double gene knockout

[0111]

[0112] Example 2 Construction and identification of HMGA1 gene knockout porcine fetal fibroblast cell line

[0113] 1. Obtaining and cloning HMGA1 gene knockout cells

[0114] (1) Cell culture and collection: using Knockout TM Porcine fetal fibroblasts (P1 generation) were revived in DMEM complete medium. The cell density needed to reach 70–90% before subculture. After 2-4 days of culture, when the cell density reached 80-90%, they were used for transfection.

[0115] (2) Transfection: Transfection was performed by electroporation.

[0116] 1) Take 1×10 6 The cells were used for electroporation of 3# combined double sgRNA of HMGA1 gene, washed twice with DPBS, and resuspended in 87μL Opti-MEM medium;

[0117] 2) Preparation of RNP complex: 5 μg of paired HMGA1 dual sgRNA and 6 μg of Cas9 protein (M0646, NEB) were mixed and incubated at room temperature for 15 min to form RNP complex;

[0118] 3) Electrotransfection: After mixing the RNP complex with porcine fetal fibroblasts, take 100 μL and add it to the electroporation cup. Use the NEPA21 high-efficiency gene transfection system and set the parameters as follows:

[0119] Poring Pulse: Voltage: 150V, Pulse Length: 5ms, Pulse Interval: 5ms, Number of Pulses: 2, Decay Rate: 10%, Polarity: +

[0120] Transfer Pulse: Voltage: 20V, Pulse Length: 50ms, Pulse Interval: 50ms, Number of Pulses: 5, Decay Rate: 40%, Polarity: + / -

[0121] Click Ω to record the impedance value (range 30-50Ω).

[0122] 4) Add the electro-transfected cells to a 6-well plate and culture for 24 hours;

[0123] 5) 24 hours after electrotransfection, extract part of the cell genomic DNA, and use the identification primers to perform PCR amplification on HMGA1 to verify the targeting efficiency. The PCR reaction system is 50μL: 2×PrimeSTAR Max Premix: 25μL, F: 0.2μM, R: 0.2μM, DNA: 20-100ng, and H2O is added to 50μL. The PCR reaction conditions are: 98℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 5s, a total of 35 cycles, and then 72℃ extension for 5min.

[0124] 6) After the cells have been tested for targeting efficiency, they are digested and subcloned into a 10 cm dish at a density of 2500 cells / 10 mL. The medium is changed every two days and the culture is continued for about 5 days.

[0125] 7) Use a cloning ring to select subclones with good growth status in the 10 cm dish and transfer them to a 96-well plate. Change the medium on the next day and continue culturing for 2-3 days.

[0126] 8) After the subclones with a confluence of 90% are subcultured to a 24-well plate, they are cultured for 2-3 days, and the subclones in the 24-well plate are preserved and identified by PCR;

[0127] 2. Identification of positive HMGA1 gene knockout monoclonal cells

[0128] 1) Extract some cell genomic DNA and use identification primers to perform PCR identification of HMGA1. The PCR reaction system is 50μL: 2×PrimeSTAR Max Premix: 25μL, F: 0.2μM, R: 0.2μM, DNA: 20-100ng, H2O to 50μL. PCR reaction conditions are: 98℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 5s, a total of 35 cycles, and then 72℃ extension for 5min. The results of PCR detection of some clones are shown in Figure 4 .

[0129] 2) Three monoclonal cell lines were selected and the 312 bp PCR product was sequenced and analyzed. The sequencing results are shown in Figure 5 The results showed that compared with the control group, the HMGA1 gene was deleted in the genomic DNA fragment of the cells after HMGA1 knockout, and the deletion size was 158bp.

[0130] Example 3 Construction and identification of HMGA2 gene knockout porcine fetal fibroblast cell line

[0131] 1. Obtaining and cloning HMGA2 gene knockout cells

[0132] (1) Cell culture and collection: using Knockout TM Porcine fetal fibroblasts (P1 generation) were revived in DMEM complete medium. The cell density needed to reach 70–90% before subculture. After 2-4 days of culture, when the cell density reached 80-90%, they were used for transfection.

[0133] (2) Transfection: Transfection was performed by electroporation.

[0134] 1) Take 1×10 6 The cells were used for electroporation of 7# combined double sgRNA of HMGA2 gene, washed twice with DPBS, and resuspended in 87μL Opti-MEM medium;

[0135] 2) Preparation of RNP complex: 5 μg of each double sgRNA pairing the HMGA2 single gene was mixed with 6 μg of Cas9 protein (M0646, NEB) and incubated at room temperature for 15 min to form an RNP complex;

[0136] 3) Electrotransfection: After mixing the RNP complex with porcine fetal fibroblasts, take 100 μL and add it to the electroporation cup. Use the NEPA21 high-efficiency gene transfection system and set the parameters as follows:

[0137] Poring Pulse: Voltage: 150V, Pulse Length: 5ms, Pulse Interval: 5ms, Number of Pulses: 2, Decay Rate: 10%, Polarity: +

[0138] Transfer Pulse: Voltage: 20V, Pulse Length: 50ms, Pulse Interval: 50ms, Number of Pulses: 5, Decay Rate: 40%, Polarity: + / -

[0139] Click Ω to record the impedance value (range 30-50Ω).

[0140] 4) Add the electro-transfected cells to a 6-well plate and culture for 24 hours;

[0141] 5) 24 hours after electrotransfection, extract part of the cell genomic DNA, and use the identification primers to perform PCR amplification on HMGA1 to verify the targeting efficiency. The PCR reaction system is 50μL: 2×PrimeSTAR Max Premix: 25μL, F: 0.2μM, R: 0.2μM, DNA: 20-100ng, and H2O is added to 50μL. The PCR reaction conditions are: 98℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 5s, a total of 35 cycles, and then 72℃ extension for 5min.

[0142] 6) After the cells have been tested for targeting efficiency, they are digested and subcloned into a 10 cm dish at a density of 2500 cells / 10 mL. The medium is changed every two days and the culture is continued for about 5 days.

[0143] 7) Use a cloning ring to select subclones with good growth status in the 10 cm dish and transfer them to a 96-well plate. Change the medium on the next day and continue culturing for 2-3 days.

[0144] 8) After the subclones with a confluence of 90% are subcultured to a 24-well plate, they are cultured for 2-3 days, and the subclones in the 24-well plate are preserved and identified by PCR;

[0145] 2. Identification of positive HMGA2 gene knockout monoclonal cells

[0146] 1) Extract part of the cell genomic DNA, and use the identification primers to perform PCR identification on HMGA2. The PCR reaction system is 50μL: 2×PrimeSTAR Max Premix: 25μL, F: 0.2μM, R: 0.2μM, DNA: 20-100ng, H2O to 50μL. The PCR reaction conditions are: 98℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 5s, a total of 35 cycles, and then 72℃ extension for 5min. The results of PCR detection of some clones are shown in Figure 6 .

[0147] 2) Three monoclonal cell lines were selected and the 599 bp PCR product was sequenced and analyzed. The sequencing results are shown in Figure 7 The results showed that compared with the control group, the HMGA2 gene was deleted in the genomic DNA fragments of cells after HMGA2 knockout, with 1# and 2# missing 246bp and 3# missing 248bp.

[0148] Example 4 Construction and identification of HMGA1 and HMGA2 double gene knockout porcine fetal fibroblast cell line 1. HMGA1 and HMGA2 double gene knockout and monoclonalization

[0149] (1) Cell culture and collection: using KnockoutTM Porcine fetal fibroblasts (P1 generation) were revived in DMEM complete medium. The cell density needed to reach 70–90% before subculture. After 2-4 days of culture, when the cell density reached 80-90%, they were used for transfection.

[0150] (2) Transfection: Transfection was performed by electroporation.

[0151] 1) Take 1×10 6 The cells were used for double knockout of HMGA1 and HMGA2, washed twice with DPBS, and resuspended in 87 μL of opti-MEM medium;

[0152] 2) Preparation of RNP complex: 5 μg of each of the preferred double sgRNAs of HMGA1 (single gene combination 3#) and HMGA2 (single gene combination 7#) were mixed with 6 μg of Cas9 protein (M0646, NEB), and incubated at room temperature for 15 min to form an RNP complex;

[0153] 3) Electrotransfection: After mixing the RNP complex with porcine fetal fibroblasts, take 100 μL and add it to the electroporation cup. Use the NEPA21 high-efficiency gene transfection system and set the parameters as follows:

[0154] Poring Pulse: Voltage: 150V, Pulse Length: 5ms, Pulse Interval: 5ms, Number of Pulses: 2, Decay Rate: 10%, Polarity: +

[0155] Transfer Pulse: Voltage: 20V, Pulse Length: 50ms, Pulse Interval: 50ms, Number of Pulses: 5, Decay Rate: 40%, Polarity: + / -

[0156] Click Ω to record the impedance value (range 30-50Ω).

[0157] 4) Add the electro-transfected cells to a 6-well plate and culture for 24 hours;

[0158] 5) 24 hours after electrotransfection, extract part of the cell genomic DNA, and use the identification primers to perform PCR amplification on HMGA1 and HMGA2 to verify the targeting efficiency. The PCR reaction system is 50μL: 2×PrimeSTAR Max Premix: 25μL, F: 0.2μM, R: 0.2μM, DNA: 20-100ng, H2O is added to 50μL. The PCR reaction conditions are: 98℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 5s, a total of 35 cycles, and then 72℃ extension for 5min.

[0159] 6) After the cells have been tested for targeting efficiency, they are digested and subcloned into a 10 cm dish at a density of 2500 cells / 10 mL. The medium is changed every two days and the culture is continued for about 5 days.

[0160] 7) Use a cloning ring to select subclones with good growth status in the 10 cm dish and transfer them to a 96-well plate. Change the medium on the next day and continue culturing for 2-3 days.

[0161] 8) After the subclones with a confluence of 90% are subcultured to a 24-well plate, they are cultured for 2-3 days, and the subclones in the 24-well plate are preserved and identified by PCR;

[0162] 2. Identification of positive HMGA1 and HMGA2 double gene knockout monoclonal cells

[0163] 1) Extract part of the cell genomic DNA, and use the identification primers to perform PCR identification on HMGA1 and HMGA2 respectively. The PCR reaction system is 50μL: 2×PrimeSTAR Max Premix: 25μL, F: 0.2μM, R: 0.2μM, DNA: 20-100ng, H2O to 50μL. The PCR reaction conditions are: 98℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 5s, a total of 35 cycles, and then 72℃ extension for 5min. The results of PCR detection of some clones are shown in Figure 8 .

[0164] 2) Three monoclonal cell lines were selected for sequencing analysis. The sequencing results are shown in Fig. 9 The results showed that compared with the control group, the genomic DNA fragments of the HMGA1 and HMGA2 double gene knockout monoclonal cells were deleted in both HMGA1 and HMGA2 genes, with the deletion size of HMGA1 being 161bp, 156bp and 158bp respectively, and the deletion size of HMGA2 being 246bp.

[0165] In summary, the present invention successfully obtained 4 sgRNA guide sequences specifically targeting the porcine HMGA1 gene and 4 sgRNA guide sequences specifically targeting the porcine HMGA2 gene. It can be seen from the targeting verification results that the above sgRNA guide sequences and their combinations have the function of efficiently editing the HGMA1 and / or HGMA2 genes. The porcine fetal fibroblast cell lines with HMGA1 and / or HMGA2 gene deletions were constructed using gene editing technology. Sequencing analysis showed that both had large fragment deletions, which provided an important animal model research and development foundation for related research such as gene breeding, xenotransplantation, and the development of new strains of companion animals.

[0166] The above is only an embodiment of the present invention. The commonly known technical common sense in the scheme is not described in detail here. The ordinary technicians in the relevant field are aware of all the common technical knowledge in the technical field to which the invention belongs before the application date, can obtain all the existing technologies in the field, and have the ability to apply the conventional experimental means before that date. The ordinary technicians in the relevant field can improve and implement this scheme in combination with their own abilities under the enlightenment given by this application. Some typical commonly known technologies should not become obstacles for ordinary technicians in the relevant field to implement this application. It should be pointed out that for those skilled in the art, without departing from the structure of the present invention, they can also make some adjustments and improvements, which should also be regarded as the scope of protection of the present invention, which will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection claimed by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A sgRNA guide sequence specifically targeting the porcine HMGA1 gene, characterized in that: The target sequence targeted by the sgRNA guide sequence is the nucleotide sequence shown in SEQ ID NO:

1.

2. The sgRNA guide sequence specifically targeting the porcine HMGA1 gene according to claim 1, characterized in that: The sgRNA guide sequence is selected from SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:

5.

3. A sgRNA guide sequence specifically targeting the porcine HMGA2 gene, characterized in that: The target sequence targeted by the sgRNA guide sequence is the nucleotide sequence shown in SEQ ID NO:

6.

4. The sgRNA guide sequence specifically targeting the porcine HMGA2 gene according to claim 3, characterized in that The sgRNA guide sequence is selected from SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:

10.

5. A combination of multiple sgRNA guide sequences that specifically target the porcine HMGA1 gene and the porcine HMGA2 gene, respectively, wherein the sgRNA guide sequence targeting the porcine HMGA1 gene is the sgRNA guide sequence of claim 2, and the sgRNA guide sequence targeting the porcine HMGA2 gene is the sgRNA guide sequence of claim 4.

6. A nucleic acid molecule encoding the sgRNA guide sequence or a combination of multiple sgRNA guide sequences according to any one of claims 1 to 5.

7. A biomaterial, characterized in that: The biological material comprises the sgRNA guide sequence according to any one of claims 1 to 4 or comprises a combination of multiple sgRNA guide sequences according to claim 5, and the biological material is one or more of a vector, an expression cassette or a transgenic cell.

8. A method for constructing a porcine fetal fibroblast cell line based on CRISPR / Cas9 targeted knockout of porcine HMGA1 gene and / or porcine HMGA2 gene, characterized in that: The method comprises the following steps: 1) Extracting pig genomic DNA and amplifying HMGA1 and HMGA2 genes respectively, and designing the sgRNA guide sequence according to any one of claims 1 to 4 for the target sequence; 2) Culture porcine fetal fibroblasts and collect the cells for transfection when the cell density reaches 80-90%; 3) mixing the sgRNA guide sequence or its paired combination with the Cas9 protein to form an RNP complex, and performing transfection by electroporation; 4) Cultivate and screen the transfected monoclonal cells to obtain porcine fetal fibroblast cell lines with targeted knockout of the HMGA1 gene and / or porcine HMGA2 gene.

9. A primer pair for identifying targeted knockout of porcine HMGA1 gene and / or porcine HMGA2 gene, characterized in that: The left and right primers for identifying the HMGA1 gene have sequences shown in SEQ ID NOs: 11 and 12, respectively, and the left and right primers for identifying the HMGA2 gene have sequences shown in SEQ ID NOs: 13 and 14, respectively.

10. Use of the sgRNA guide sequence according to any one of claims 1 to 4, the combination of multiple sgRNA guide sequences according to claim 5, the nucleic acid molecule according to claim 6, or the biomaterial according to claim 7 in gene breeding, xenotransplantation, and gene function research models.

Images