Application of a SNP molecular marker combination in comb height-assisted breeding

Abstract

This invention discloses the application of SNP molecular marker combinations in assisted breeding of chicken comb height. The SNP molecular marker combinations include a total of four SNP loci, SNP1 to SNP4. In marker-assisted breeding of chicken comb height, individuals with dominant genotypes of AA and GA at SNP1 locus, CC and CT at SNP2 locus, AA and GA at SNP3 locus, and AA and GA at SNP4 locus can be selected and other individuals with inferior genotypes can be eliminated to help improve the selection of chicken comb height and accelerate the progress of generational selection of chicken comb height.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to an application of a SNP molecular marker combination in comb height-assisted breeding of chickens. Background Art

[0002] The comb is the most obvious and important feature of the chicken's secondary sexual characteristics, and can be used as an indicator to measure the degree of sexual maturity. The development of the comb is a phenotypic characteristic of sexual development. When live chickens or chilled chickens are put on the market, the combs need to reach a certain degree of development. Generally, the combs are required to be large and red, and not inverted. The height of the comb is an important factor affecting the size of the comb. The combs of healthy chickens are generally upright and red in color. Unhealthy chickens that are sick or have decreased immunity have smaller combs and are prone to inverted combs and white combs. The comb is an important indicator of the health, disease resistance and nutritional status of chickens. The comb epidermis contains Merck cells, as well as large arteries and some vertically arranged nerves that can sense external stimuli. The development of the comb is a quantitative trait controlled by multiple genes.

[0003] At present, the comb height is usually directly measured or observed by naked eye in the process of comb height breeding, and the generational inheritance progress is slow. Therefore, finding molecular markers significantly related to comb height is of great significance for improving the progress of comb height generational breeding. Summary of the invention

[0004] In response to the problem of slow progress in generational breeding of comb height, the present invention provides an application of a SNP molecular marker combination in assisted breeding of comb height, which assists in improving the breeding of comb height through 4 SNP molecular markers that are significantly correlated with comb height, thereby accelerating the progress of generational breeding of comb height.

[0005] In order to achieve the above object, the present invention provides an application of a SNP molecular marker combination in assisted breeding of comb height, wherein the SNP molecular marker combination corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI as follows:

[0006]

[0007] The screening method of the SNP molecular marker is as follows:

[0008] Using the chicken genome bGalGal.mat.broiler.GRCg7b (GCF_016699485.2) as a reference, GWAS sequencing technology and whole genome association analysis were used to obtain four SNP loci significantly associated with comb height, all of which belonged to a candidate gene LOC101749492. The univariate analysis of variance in the general linear model of SPSS 16.0 software was used to analyze and verify the association between the genotype of the polymorphic locus and the comb height, and the dominant genotypes of the four SNP loci were screened.

[0009] GWAS is a powerful tool for analyzing the genetic structure of quantitative traits in livestock and poultry. The GWAS method is used to study the association between SNP sites and phenotypic values, which can identify molecular markers that affect economic traits and is particularly suitable for complex quantitative traits. Based on this, the present invention screened the molecular markers of comb height through GWAS and obtained 4 SNP molecular markers that were significantly correlated with comb height. Compared with candidate gene and QTL linkage analysis, GWAS has a high marker density, can analyze rare and low-frequency variations, can analyze the genetic structure of complex traits, and can also identify new variations, and the results are more reliable.

[0010] The nucleotide sequences of the primers for the above SNP molecular markers are as follows:

[0011]

[0012] Specifically, the breeding method for increasing the comb height includes the following steps:

[0013] (1) Determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the above-mentioned SNP molecular marker combination;

[0014] (2) The dominant genotypes of AA and GA at SNP1, CC and CT at SNP2, AA and GA at SNP3, and AA and GA at SNP4 were selected as the individuals with relatively high comb heights, and the individuals with the inferior genotypes of GG, TT, GG, and GG at SNP1 to SNP4 were eliminated respectively.

[0015] Specifically, in step (1), the method for determining the genotype of the chicken to be bred is:

[0016] (1.1) Extracting total genomic DNA from the chicken to be tested; preferably, the genomic DNA from the chicken to be tested is obtained by sampling blood from the wing vein of the chicken to be tested;

[0017] (1.2) According to the SNP molecular marker combination, the target sequence is amplified by PCR method using the corresponding primer pair, and the sequence of the primer pair is:

[0018] SNP1F: 5'TCTGTTCTGAGGGAGGATGG3'

[0019] SNP1R: 5'CATTTCATCCTGCCCACTCT3'

[0020] SNP2F: 5'TGCTGACTCACTGCCACTCT3'

[0021] SNP2R: 5'AGACAGACATGGCAGCCTTT3'

[0022] SNP3F: 5' CGGCACTGAAAGGAGAAGTC3'

[0023] SNP3R: 5'TTGGGTTCTGGTACAGCAAA3'

[0024] SNP4F: 5'GGGCTTCATTAGGTGCAAAG3'

[0025] SNP4R: 5'CTCTGAGATGTCCCCGACCT3';

[0026] (1.3) After sequencing the PCR amplification product, determine the genotype.

[0027] The PCR product was sent to a biological company for sequencing, and the resulting sequence was compared with the reference genome of chicken to find the polymorphic site. The nucleotide sequence of the PCR product of the SNP site is as follows:

[0028] There is a G / A mutation at SNP1-43bp, and the PCR product length is 217 bp.

[0029] TCTGTTCTGAGGGAGGATGGGAAGGAGGGAGGCTGCCTCACTK (G / A) GAGTGGAGAAGAGATTTGGGTTATGAACAAGTAACAGAGAATGGGCAGGGGGAGGTGAACTTGTAGGTAAAGTGCATAAAGCCGAGGGCGTGTCTGTTGTGAGAAAGGAGAAATAAGAACAAAGTTTGGACAGCAGCAGTCAGACAGCACTTTGAGAGTGGGCAGGATGAAATG

[0030] SNP2—A / G mutation at 170bp, PCR product length is 224 bp.

[0031] TGCTGACTCACTGCCACTCTCTACCATTAGAAAACCGAAATAAATCATTGTATCACCACTTCCTTCTGTCCAGATCTGCAGTGAGGTTTACACTGGAAAAGGTTGTAAAGCATTCTGCTGCTCACAAATGGGGAAACTGCAGGGAGGGAAAAGCACAGATGTCTGACCAK(C / T)GGTCTGACCATTTGATCAAAGAAATGAAATTTCCAAAGGCTGCCATGTCTGTCT

[0032] There is a G / A mutation at SNP3—65bp, and the PCR product length is 201 bp.

[0033] CGGCACTGAAAGGAGAAGTCTTCTCATGGAGAGTAATACACCTCCCATTGTTCTCTAAGTCCCCK(G / A)ATCCCCTGAAATATCTGATTCTAAATACAGTTGATGCATGCTGAATTTGAAGTGTAGAATCCTCGCAGACAAAAGAGTTGTCATGTTCAAATCTAAAGATAATACCACATATACTATTTGCTGTACCAGAACCCAA

[0034] There is a G / A mutation at SNP4—66bp, and the PCR product length is 191 bp.

[0035] GGGCTTCATTAGGTGCAAAGAGAAAAGTGTGCAGATACTGAAGTGCAAAGGGGCAGCGCGGCTGAK(G / A)CTGAAGTCCCGAGGGAAATGCCAGCGCCCGGTGAGGGGAACGCTTTCCCCGAATTCCGCCTGCCGCACAGATTGGAGCAGGCGAAGGGCAGAGCAGAGCAGTGCAGGTCGGGGACATCTCAGAG

[0036] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0037] The specific method for determining the dominant genotype individuals is as follows:

[0038] Firstly, the correlation between single SNP markers and comb height was analyzed. The comb heights of the four SNPs loci were significantly different among different genotypes. SNP1 (rs312669246) had three genotypes, AA, GA and GG. The comb heights of individuals with AA and GA genotypes were significantly greater than those with GG genotypes (P < 0.05). SNP2 (rs313331126) had three genotypes, CC, CT and TT. The comb heights of individuals with CC and CT genotypes were significantly greater than those with TT genotypes (P < 0.05). SNP3 (rs313205409) had three genotypes, AA, GA and GG. The comb heights of individuals with AA and GA genotypes were significantly greater than those with GG genotypes (P < 0.05). SNP4 (rs314830898) had three genotypes, AA, GA and GG. The comb heights of individuals with AA and GA genotypes were significantly greater than those with GG genotypes (P < 0.05). Haploview software was used to analyze the linkage disequilibrium (LD) of the four SNPs, and it was found that the four SNPs were not in a strong linkage state (R 2 <100), so the correlation between the combined genotype of the four SNP loci and comb height was no longer analyzed. SNP1 AA, GA genotype, SNP2 CC, CT genotype, SNP3 AA, GA genotype, SNP4 AA, GA genotype are the dominant genotypes for comb height, and can be used as important molecular markers for molecular-assisted breeding of comb height.

[0039] Through the above technical solution, the present invention achieves the following beneficial effects:

[0040] In the molecular marker-assisted breeding of comb height, the method of retaining individuals with the dominant genotypes AA and GA at SNP1, CC and CT at SNP2, AA and GA at SNP3, and AA and GA at SNP4, and eliminating individuals with other inferior genotypes can be used to assist in improving the breeding of comb height and accelerate the progress of generational breeding of comb height. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Manhattan plots for highly correlated molecules in cockscombs;

[0042] Figure 2 Mark the QQ graph for the highly correlated molecules of cockscomb;

[0043] Figure 3 This is a linkage disequilibrium analysis diagram of 4 SNP molecular markers. DETAILED DESCRIPTION

[0044] The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0045] Example 1 Screening of molecular markers significantly associated with cockscomb height

[0046] 1. Experimental Materials

[0047] The test subjects selected were the terminal paternal line A of Lihua yellow-footed chickens. The main selected traits of this line are body weight, comb development, feed conversion rate and slaughter rate. It has undergone six generations of closed breeding. The experimental chickens were raised at the Jintan breeding base of Jiangsu Lihua Animal Husbandry Co., Ltd. in Changzhou City, Jiangsu Province. All experimental chickens were hatched from the same batch and raised in the same chicken house. The experimental chickens were raised in two stages. They were raised in cages from 1 to 4 weeks of age and transferred to individual cages after 5 weeks of age. The company's standard breeder feed was used for feeding, and the chickens were free to drink water and eat during the test period. Immunization followed the standard procedures established by the company.

[0048] 2. Comb height measurement

[0049] 400 Lihua yellow-footed chickens of specialized strain A were randomly selected and weighed after fasting for 12 hours. The leg numbers were recorded and the comb heights of 60-day-old roosters were measured. The specific measurement method was as follows: the vertical distance from the base of the comb to the highest comb tooth was measured with a vernier caliper. All comb heights were measured by the same person and the measured parts were basically the same.

[0050] 3. Mining of molecular markers of cockscomb height

[0051] At 60 days of age, 1.5 mL of blood was collected from the subwing vein of all groups whose combs were measured. EDTA was used for anticoagulation. After blood collection, the anticoagulation tube was slowly shaken up and down to allow the EDTA in the tube to fully contact and mix the blood. The anticoagulation tube was stored in an incubator containing ice packs. After blood collection, it was quickly transported to the laboratory and stored at -20°C for future use. DNA was extracted using the TIANGEN Blood Genomic DNA Extraction Kit (spin column type) (YDP348). DNA integrity and purity were determined by gel migration (1% agarose gel electrophoresis), and the DNA concentration was determined using the Qubit 4 fluorescence quantifier (Thermo Fisher, Shanghai) to ensure that the concentration of the extracted DNA sample was greater than 15 ng / μL.

[0052] Whole genome resequencing: DNA samples that have passed quality inspection are uniformly delivered to Beijing Boya Geya Biotechnology Co., Ltd. for whole genome resequencing, including preparation of genomic libraries and sequencing on the MGISEQ-2000 platform.

[0053] Quality control: The main purpose is to filter the original genome reads of the MGISEQ-2000 platform double-end sequencing, and use the fastp (v.0.20.0) preprocessor (set to default parameters) to remove low-quality reads, adapters, and reads containing poly-N. Finally, the reads obtained after quality control were aligned to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI using BWA (v0.7.17) software; the reads with repeated alignments were removed using Picard software; and high-quality SNP sites were obtained through GATK 4.0 software analysis.

[0054] Genome-wide association analysis: PLINK (v1.90p) software was used to perform principal component analysis (PCA) on the SNP loci after quality control to prevent false positive results caused by population stratification. The linear mixed model (LMM) of GEMMA (v0.98.5) software was used to perform association analysis on weight traits.

[0055] y=Wα+xβ+u+ , u~MVNn(0,λτ -1 K), ~MVNn(0,λτ -1 I n )

[0056] Where y is the phenotype vector; W is the fixed effect matrix (the first three principal components including PCA); α is the fixed effect vector; x is the genotype vector, β is the SNP effect vector; u is the random effect vector; represents the residual vector. MVNn is an n-dimensional multivariate normal distribution, λ is the genetic variance and the residual variance (random effect vector u and residual vector The ratio of -1 is the residual variance, K is the kinship matrix calculated based on SNP using GEMMA, and I n is the identity matrix.

[0057] The (-indep-pairwise 50 10 0.2) parameter in PLINK software was used to infer the number of valid SNPs for independent testing, and the final inference was that the number of valid independent testing SNPs was 432,529. After multiple testing, the Bonferroni correction method was used to set the significant threshold. The genome-wide significant level p in this study was 1.16×10 -7 (0.05 / number of effective independent test SNPs 432529), that is, p = 0.05 / 432529 = 1.16 × 10-7 , then take the negative logarithm of log10 for the p-value, i.e. -log10 （1.16×10-7） =6.93 is the threshold of the genome-wide significant level; the genome-wide potential significant level p is 2.31×10 -6 (1 / 432529), the negative logarithm of log10 is taken, which is the potential significant level threshold of 5.63. The Cmplot package in R was used to visualize the GWAS results. The adjacent genes within 100 Kb upstream and downstream of the significant site were annotated using Bedtools (v2.30.0) software.

[0058] After quality inspection, genome-wide association analysis was performed on the comb height phenotype values ​​of 366 chickens. The results are as follows Figure 1 , Figure 2 As shown. From the Manhattan plot, it can be seen that there are 4 SNP sites with significant genome correlation on chromosome 4 of chicken (above the threshold value of 6.93), all of which are annotated to the candidate gene LOC101749492. In addition, potential significantly correlated SNP sites (above the threshold value of 5.63) were located on chromosomes 4, 5, 6, 10, 11 and 19. The QQ plot further verifies that the GWAS results are reliable. The significantly correlated molecular markers of comb height are summarized as shown in Table 1:

[0059] Table 1 Molecular markers significantly associated with comb height

[0060]

[0061] The physical position of the marker chromosome is referenced to the chicken whole genome (bGalGal1.mat broiler .GRCg7b).

[0062] 4. Genetic polymorphism analysis of four SNPs sites significantly associated with cockscomb height

[0063] The genotype frequency, gene frequency, and heterozygosity (He) of the four SNP molecular markers obtained by PopGene (version 1.31) were analyzed, and the chi-square test was used to detect whether the SNP loci were in Hardy-Weinberg (HW) equilibrium. The analysis results are shown in Table 2.

[0064] As shown in Table 2, the four SNP loci all have three genotypes. The HW equilibrium test showed that the four SNPs loci were in HW equilibrium (P>0.05). The four SNPs loci had moderate genetic diversity (0.40 <He<0.50)。

[0065] Table 2 Genetic polymorphism of 4 SNP loci and Hardy-Weinberg equilibrium test

[0066]

[0067] 5. Analysis of dominant genotypes of comb height SNP molecular markers

[0068] The association analysis between polymorphic locus genotype and comb height was performed using univariate analysis of variance in the general linear model of SPSS 16.0 software. Fixed factors: different genotypes of SNP markers, dependent variables: comb height, Tukey HSD method was used to compare the significance of comb height between different marker genotypes, P < 0.05 indicated significant difference.

[0069] Firstly, the correlation between single SNP markers and comb height was analyzed. The comb heights of the four SNPs loci were significantly different among different genotypes. SNP1 (rs312669246) had three genotypes, AA, GA and GG. The comb heights of individuals with AA and GA genotypes were significantly greater than those with GG genotypes (P < 0.05). SNP2 (rs313331126) had three genotypes, CC, CT and TT. The comb heights of individuals with CC and CT genotypes were significantly greater than those with TT genotypes (P < 0.05). SNP3 (rs313205409) had three genotypes, AA, GA and GG. The comb heights of individuals with AA and GA genotypes were significantly greater than those with GG genotypes (P < 0.05). SNP4 (rs314830898) had three genotypes, AA, GA and GG. The comb heights of individuals with AA and GA genotypes were significantly greater than those with GG genotypes (P < 0.05). Haploview software was used to analyze the linkage disequilibrium (LD) of the four SNPs loci. The results of linkage disequilibrium analysis are shown in Figure 3 . Figure 3 The value R in the box 2 It is obtained by multiplying the D' value by 100. Figure 3 It can be seen that the four SNP loci are not in a strong linkage state (D' value <1, R 2 <100), so the correlation between the combined genotype of the four molecular markers and comb height was no longer analyzed.

[0070] The AA and GA genotypes of SNP1, CC and CT genotypes of SNP2, AA and GA genotypes of SNP3 and AA and GA genotypes of SNP4 are the dominant genotypes for comb height and can serve as important molecular markers for molecular-assisted breeding of comb height.

[0071] In the breeding of comb height, the method of retaining individuals with superior genotypes and eliminating individuals with inferior genotypes GG, TT, GG, and GG at SNP1~SNP4 sites can be used to assist in improving the selection of comb height and accelerate the progress of generational selection of comb height.

[0072] Table 3 Association analysis between gene loci and comb height traits (mean ± SD)

[0073]

[0074] Example 2 Verification of comb height molecular marker-assisted breeding

[0075] At 60 days of age, the chickens in the terminal paternal line A of Lihua Huangjiao Ma chicken were genotyped, and the dominant genotype individuals with larger comb height were retained. The specific plan is as follows:

[0076] (1) At 60 days of age, blood was collected from the wing vein of 800 A-line roosters using a disposable syringe, and DNA was extracted using the phenol-chloroform method to extract the total genomic DNA of the chickens to be tested;

[0077] PCR amplification primers: Download DNA template sequence information from the NCBI website, and use primer premier software to design primers for related gene SNP sites (rs312669246, rs313331126, rs313205409, rs314830898). The relevant information of primer sequences is shown in Table 4.

[0078] Table 4 Primer sequence related information

[0079]

[0080] (2) PCR amplification, electrophoresis and sequencing genotyping: The PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping was performed on the A-line roosters of Lihua Mahuang Chicken, and the dominant genotype individuals with larger comb height were retained.

[0081] PCR total reaction system 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3 mmol·L -1 ) 0.6 μL, 1× PCR reaction buffer 5 μL, upstream and downstream primers (10 μmol·L -1 ) 1 μL each, Taq polymerase (1U·μL -1 ) 2.5 μL, add ultrapure water to 50 μL.

[0082] PCR reaction program: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, a total of 35 cycles; 72℃ extension for 5 min. The PCR amplified target fragment was detected by 1.5% agarose gel electrophoresis.

[0083] The PCR amplification products were sent to a sequencing company for sequence polymorphism detection. The nucleotide sequences of the PCR products of the four SNPs sites are as follows:

[0084] There is a G / A mutation at SNP1-43bp, and the PCR product length is 217 bp.

[0085] TCTGTTCTGAGGGAGGATGGGAAGGAGGGAGGCTGCCTCACTK (G / A) GAGTGGAGAAGAGATTTGGGTTATGAACAAGTAACAGAGAATGGGCAGGGGGAGGTGAACTTGTAGGTAAAGTGCATAAAGCCGAGGGCGTGTCTGTTGTGAGAAAGGAGAAATAAGAACAAAGTTTGGACAGCAGCAGTCAGACAGCACTTTGAGAGTGGGCAGGATGAAATG

[0086] SNP2—A / G mutation at 170bp, PCR product length is 224 bp.

[0087] TGCTGACTCACTGCCACTCTCTACCATTAGAAAACCGAAATAAATCATTGTATCACCACTTCCTTCTGTCCAGATCTGCAGTGAGGTTTACACTGGAAAAGGTTGTAAAGCATTCTGCTGCTCACAAATGGGGAAACTGCAGGGAGGGAAAAGCACAGATGTCTGACCAK(C / T)GGTCTGACCATTTGATCAAAGAAATGAAATTTCCAAAGGCTGCCATGTCTGTCT

[0088] There is a G / A mutation at SNP3—65bp, and the PCR product length is 201 bp.

[0089] CGGCACTGAAAGGAGAAGTCTTCTCATGGAGAGTAATACACCTCCCATTGTTCTCTAAGTCCCCK(G / A)ATCCCCTGAAATATCTGATTCTAAATACAGTTGATGCATGCTGAATTTGAAGTGTAGAATCCTCGCAGACAAAAGAGTTGTCATGTTCAAATCTAAAGATAATACCACATATACTATTTGCTGTACCAGAACCCAA

[0090] There is a G / A mutation at SNP4—66bp, and the PCR product length is 191 bp.

[0091] GGGCTTCATTAGGTGCAAAGAGAAAAGTGTGCAGATACTGAAGTGCAAAGGGGCAGCGCGGCTGAK(G / A)CTGAAGTCCCGAGGGAAATGCCAGCGCCCGGTGAGGGGAACGCTTTCCCCGAATTCCGCCTGCCGCACAGATTGGAGCAGGCGAAGGGCAGAGCAGAGCAGTGCAGGTCGGGGACATCTCAGAG

[0092] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0093] (3) Method for measuring comb height at 60 days of age: Use a vernier caliper to measure the height from the base of the comb to the highest point.

[0094] The vertical distance from the top of the crown teeth. All comb heights were measured by the same person and the measured parts were basically the same.

[0095] (4) Molecular marker-assisted selection of comb height

[0096] The AA and GA genotypes at SNP1, CC and CT genotypes at SNP2, AA and GA genotypes at SNP3 and AA and GA genotypes at SNP4 were the dominant genotypes for comb height.

[0097] In the molecular marker-assisted breeding of comb height, the method of retaining individuals with the AA and GA genotypes at SNP1, CC and CT genotypes at SNP2, AA and GA genotypes at SNP3, and AA and GA dominant genotypes at SNP4, and eliminating individuals with the inferior genotypes of GG, TT, GG, and GG at SNP1~SNP4 is used to assist in improving the breeding of comb height and accelerate the progress of generational breeding of comb height.

[0098] Through whole genome association analysis, 4 SNP molecular markers significantly associated with comb height were screened out. The molecular marker-assisted breeding verification experiment on the comb height of the 5th and 6th generations of the terminal paternal line A of Lihua Huangjiao Ma Chicken showed that the operation is simple and can increase the comb height more quickly. As shown in Table 5, after 2 generations of breeding, the comb thickness of roosters in the 5th generation increased by 1.67mm compared with the 4th generation, and the 6th generation increased by 1.82mm compared with the 5th generation, with an average increase of about 1.75mm per generation. Compared with the 2nd to 4th generations, the comb height of each generation increased by about 0.6mm, the comb height of the 5th and 6th generations increased significantly, the coefficient of variation also decreased significantly, the uniformity increased significantly, and the progress of comb height breeding was accelerated.

[0099] Table 5 Results of comb height measurement of Lihua Mahuang chicken strain A in different generations

[0100]

[0101] Measurement age: 60 days

[0102] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0103] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0104] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. Application of a reagent for detecting a combination of SNP molecular markers in assisted breeding of comb height of yellow-footed chicken, characterized in that: The SNP molecular marker combination includes the following four SNP sites, SNP1 to SNP4: SNP1 corresponds to position 390635 of the positive strand of chromosome 4 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a G or A polymorphism and is numbered rs312669246; SNP2 corresponds to position 400686 of the positive strand of chromosome 4 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a C or T polymorphism and is numbered rs313331126; SNP3 corresponds to position 402172 of the positive strand of chromosome 4 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a G or A polymorphism and is numbered rs313205409; SNP4 corresponds to position 407690 of the positive strand of chromosome 4 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a G or A polymorphism and is numbered as rs314830898; The dominant genotypes of SNP1 are AA and GA, the dominant genotypes of SNP2 are CC and CT, the dominant genotypes of SNP3 are AA and GA, and the dominant genotypes of SNP4 are AA and GA; the chickens to be bred with the dominant genotypes are individuals with relatively high comb heights.

2. A breeding method for increasing the comb height of yellow-footed chicken, characterized in that: The steps include: (1) Determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the SNP molecular marker combination described in claim 1; (2) The dominant genotypes of AA and GA at SNP1, CC and CT at SNP2, AA and GA at SNP3, and AA and GA at SNP4 were selected as the individuals with relatively high comb heights, and the individuals with the inferior genotypes of GG, TT, GG, and GG at SNP1 to SNP4 were eliminated respectively.

3. The breeding method according to claim 2, characterized in that: In step (1), the method for determining the genotype of the chicken to be bred is: (1.1) Extracting the total genomic DNA of the chicken to be tested; (1.2) According to the SNP molecular marker combination, the target sequence is amplified by PCR method using the corresponding primer pair, and the sequence of the primer pair is: SNP1F: 5'TCTGTTCTGAGGGAGGATGG3' SNP1R: 5'CATTTCATCCTGCCCACTCT3' SNP2F: 5'TGCTGACTCACTGCCACTCT3' SNP2R: 5'AGACAGACATGGCAGCCTTT3' SNP3F: 5' CGGCACTGAAAGGAGAAGTC3' SNP3R: 5'TTGGGTTCTGGTACAGCAAA3' SNP4F: 5'GGGCTTCATTAGGTGCAAAG3' SNP4R: 5'CTCTGAGATGTCCCCGACCT3'; (1.3) After sequencing the PCR amplification product, determine the genotype.

4. The breeding method according to claim 3, characterized in that: The nucleotide sequences of the PCR amplification products are shown in SEQ ID NO.1 to SEQ ID NO.4, and the lengths of the PCR products are 217 bp, 224 bp, 201 bp, and 191 bp.

Images