Exon skipping to treat ersche syndrome

Abstract

Compositions for treating subjects suffering from USH2A-related retinal and / or cochlear diseases caused by mutations in exon 13 of the USH2A gene by deleting exon 13 shear acceptor sequences from the USH2A gene or transcript, and methods of use thereof, and genetically modified animals and cells.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 306,833, filed on February 4, 2022. The contents of the foregoing application are incorporated herein by reference in their entirety.

[0003] Federally Sponsored Research or Development

[0004] This invention was made with U.S. government support under Grant Nos. DC016875 and TR002636 awarded by the National Institutes of Health. The U.S. government has certain rights in this invention. Technical Field

[0005] Compositions, methods of use thereof, and genetically modified animals and cells for treating a subject suffering from USH2A-associated retinal and / or cochlear degeneration caused by a mutation in exon 13 of the USH2A gene by deleting the exon 13 splice acceptor sequence from the USH2A gene or transcript. Background Art

[0006] Usher syndrome (USH) is the main cause of hereditary combined hearing and vision loss. Among patients with Usher syndrome, about two-thirds suffer from Usher syndrome type II (USH2), wherein more than 75% of cases are caused by mutations in the USH2A gene. Patients with USH2 show moderate to severe hearing loss, post-pubertal onset of retinitis pigmentosa (RP), and normal vestibular reflexes, and USH2 represents the most common form of hereditary deafness-blindness, and is estimated to affect about 1 in 17,000 individuals. In particular, mutations in exon 13 account for about 35% of all USH2 cases, including a single base deletion (c.2299delG) at position 2299, which is the most common mutation accounting for about 24% of cases. Summary of the invention

[0007] Provided herein are nucleic acids comprising a sequence encoding a Cas9 protein, and a first gRNA, and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 provided in Table 1, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431 provided in Table 2. The target sequence of the first gRNA falls within the 3'1000 base pairs (bp) of intron 12, and the target sequence of the second gRNA falls within exon 13; any combination of a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244 and a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431 can be used to delete the relevant DNA fragment from the genome. In some embodiments, the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO: 313. In some embodiments, the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO: 260. The deletions mediated by paired gRNAs provided herein will include part of intron 12 and part of exon 13, with deletion sizes ranging from 6 bp to several kilobase pairs (kb), all of which can induce human USH2A exon 13 skipping, preferably ranging from 6 kb to 2 kb, with certain preferred combinations of gRNAs.

[0008] In some embodiments, the nucleic acid encodes S. pyogenes Cas9 or S. aureus Cas9 (optionally KKH SaCas9). In some embodiments, Cas9 includes a nuclear localization signal, e.g., a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal; and / or wherein the sequence encoding Cas9 includes a polyadenylation signal.

[0009] In some embodiments, the gRNA is a unimolecular S. aureus or S. pyogenes gRNA, or a corresponding two-part modular S. aureus or S. pyogenes gRNA (see, e.g., WO 2018 / 026976).

[0010] In some embodiments, the nucleic acid comprises a viral delivery vector, preferably an adeno-associated virus (AAV) vector. In some embodiments, the viral delivery vector comprises a promoter for Cas9, preferably a CMV, EFS, U1A or hGRK1 promoter. In some embodiments, the nucleic acid comprises:

[0011] (i) a first guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 2-244 and a second guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 245-431;

[0012] (ii) first and second inverted terminal repeats (ITRs); and

[0013] (iii) a promoter for driving the expression of Cas9 selected from the group consisting of CMV, EFS, U1A or hGRK1 promoter.

[0014] The nucleic acids described herein can be used, for example, in the preparation of a therapy or medicament.For example, the nucleic acids can be used in a method of treating a subject having a condition associated with a mutation in exon 13 of a USH2A gene.

[0015] In some embodiments, the condition is Usher syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).

[0016] In some embodiments, the AAV vector is delivered to the retina of the subject by injection, such as by subretinal injection, or to the inner ear of the subject by injection, such as through the round window.

[0017] Further provided herein are compositions comprising a first ribonucleoprotein (RNP) complex comprising a Cas9 protein and a first gRNA or sgRNA, and / or a second RNP complex comprising a Cas9 protein and a second gRNA or sgRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431. In some embodiments, Cas9 is Staphylococcus aureus Cas9, optionally KKH SaCas9 (optionally KKHSaCas9) or Streptococcus pyogenes Cas9.

[0018] Further provided is a method for deleting a sequence including an exon 13 splice acceptor sequence from a USH2A gene in a cell, wherein the deletion includes a portion of intron 12 and a portion of exon 13, ranging from 6 bp to several kb, all of which can induce human USH2A exon 13 skipping, although the ideal range is less than 2 kb. The method comprises contacting the cell with a nucleic acid or composition as described herein.

[0019] Also provided herein are methods for genome editing in human cells, comprising using CRISPR editing to form a first double-strand break within intron 12 of a human USH2A gene and a second double-strand break within exon 13 of a human USH2A gene, and resulting in the removal of a fragment of genomic DNA containing a portion of intron 12 and a portion of exon 13 of the USH2A gene on chromosome 1. In some embodiments, the first double-strand break is generated using a gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and the second double-strand break is generated using a gRNA having a target sequence of any one of SEQ ID NOs: 245-431.

[0020] In some embodiments, the cell is in or from a subject having a mutation in a USH2A gene. In some embodiments, the cell is a cell of the eye or inner ear of a mammal.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated herein by reference in their entirety. In the event of a conflict, the present specification, including definitions, will prevail.

[0022] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic representation of the CRISPR / Cas9 splice acceptor targeting strategy to induce USH2A exon 13 skipping by a pair of gRNAs targeting the flanking genomic DNA of the splice acceptor site.

[0024] Figure 2A -I. Splice acceptor targeting strategy increases Ush2A transcripts in-frame of exon 12 (equivalent to human exon 13) in mouse cells.

[0025] (a). Gel image showing the strategy for whole exon 12 deletion in a genome using CRISPR / Cas9. The red asterisk indicates the fragment after deletion.

[0026] (b). Schematic diagram of the whole exon 12 deletion strategy.

[0027] (c). Next generation sequencing (NGS) of edited genomic DNA confirming deletion of exon 12.

[0028] (d). Gel image showing the splice acceptor targeting strategy to delete the Ush2A exon 12 splice acceptor in HEI-OC1 cells. Asterisks indicate the fragment after deletion.

[0029] (e). Schematic diagram of the splice acceptor targeting strategy.

[0030] (f). NGS demonstrating genome editing efficiency of whole exon 12 deletion and splice acceptor targeted deletion strategies.

[0031] (g). Quantification of genome editing efficiency of whole exon 12 deletion (sgL1+sgR1) and splice acceptor targeted (sgL1+sgK4) deletion strategies.

[0032] (h). Gel image showing different Ush2A transcripts with or without genome editing.

[0033] (i). qPCR quantification of exon 12 non-skipped (top) and exon 12 skipped (bottom) transcripts with or without genome editing.

[0034] Figure 3A -H. Efficient genome editing at the USH2A exon 13 locus using a splice acceptor-targeted strategy in human cells.

[0035] (a). Schematic representation of the whole exon 13 deletion strategy showing the expected in-frame transcript with skipped exon 13.

[0036] (b). Gel image showing full USH2A exon 13 deletion in the WERI-RB1 cell genome. Asterisks indicate the fragment after deletion.

[0037] (c). Pie chart showing the percentage of deletions and indels after genome editing using the full USH2A exon 13 strategy.

[0038] (d). Schematic representation of the splice acceptor targeted deletion strategy targeting splice sites, showing the expected in-frame transcript with skipped exon 13.

[0039] (e). Gel image showing fragment deletion using a splice acceptor targeted strategy in WERI-RB1 cells. Asterisks indicate fragments after deletion.

[0040] (f). Pie chart showing the percentage of deletions and indels after genome editing using paired gRNAs sgRNA-L1 (sgL1) and sgRNA-K4 (sgK4).

[0041] (g). Pie chart showing the percentage of deletions and indels after genome editing using paired gRNAs sgRNA-L1 (sgL1) and sgRNA-K5 (sgK5).

[0042] (h). NGS of edited genomic DNA showing deletion of USH2A exon 13 splice acceptor after genome editing using sgRNA-L1 and sgRNA-K5.

[0043] Figure 4A -I. Small deletions caused by a splice acceptor-targeted strategy lead to robust production of USH2A exon 13 skipping transcripts in human cells.

[0044] (a). Schematic representation of transcripts of human USH2A without exon 13 skipping (top) and with exon 13 skipping (bottom).

[0045] (b). Gel image showing exon skipping efficiency with or without genome editing. Red arrows indicate USH2A transcripts.

[0046] (c). Representative Sanger sequencing data showing exon 13 skipping in USH2A transcripts after genome editing.

[0047] (d). Pie chart showing the percentage of different USH2A transcripts in unedited cells.

[0048] (e). Pie chart showing the percentages of different USH2A transcripts in cells edited with paired gRNAs sgL1 and sgR2.

[0049] (f). Pie chart showing the percentages of different USH2A transcripts in cells edited with paired gRNAs sgL1 and sgK4.

[0050] (g). Pie chart showing the percentage of different USH2A transcripts in cells edited with the paired gRNAs sgL1 and sgK5. This combination produced the highest percentage (73%) of USH2A transcripts with exon 13 skipping in human cells.

[0051] (h). NGS data generated from cDNA derived from human cells edited with paired gRNAs sgL1 and sgK4, showing distinct USH2A transcripts generated by splice acceptor-targeted genome editing.

[0052] (i). NGS data generated from cDNA derived from human cells edited with paired gRNAs sgL1 and sgK5, showing distinct USH2A transcripts generated by splice acceptor-targeted genome editing.

[0053] Figure 5A -F. A splice acceptor-targeted strategy induces transcripts with USH2A exon 13 skipping in human induced pluripotent stem cells (hiPSCs) derived from a USH2 patient carrying the homozygous mutation c.2299delG).

[0054] (a). Sequence information of USH2A mutations in hiPSCs derived from USH2 patients.

[0055] (b). Gel image showing genome editing efficiency after editing hiPSCs by different doses of CRISPR / Cas9-sgL1 / sgK5 targeting the splice acceptor site. Arrows indicate edited fragments after deletion.

[0056] (c). Pie chart showing the percentage of deletions and indels after genome editing using CRISPR / Cas9-sgL1 / sgK5, with an efficiency of 75% for exon 13 skipping.

[0057] (d). Schematic diagram of USH2A transcriptional activation using the dCas9 / gRNA-guided synergistic activation mediator (SAM) system.

[0058] (e). Gel image showing exon 13 skipping in edited hiPSCs derived from a USH2 patient following SAM activation.

[0059] (f). Pie chart showing the percentages of different USH2A transcripts in edited hiPSCs derived from USH2 patients after SAM activation. 71% of USH2A transcripts indicated exon 13 skipping.

[0060] Figure 6A-6B .Efficient exon skipping in inner ear organoids generated from hiPSCs derived from USH2 patients.

[0061] (a). Gel images showing full-length USH2A transcripts in healthy controls and in inner ear organoids generated from hiPSCs derived from USH2 patients. After exon skipping, at day 50, exon 13 was skipped in most transcripts, as indicated by the arrows.

[0062] (b). Bar graph showing quantification of the ratio between USH2A exon 13 skipped transcripts and full-length USH2A transcripts, indicating that more than 75% of exon 13 skipping was mediated by sgRNA pair sgL1 / sgK5 in inner ear organoids generated from hiPSCs derived from USH2 patients.

[0063] Figure 7A-7B .Exon 5 skipping in the Ush2a gene causes hearing loss in mice.

[0064] (a). Graph of auditory brainstem response (ABR) threshold shift showing that exon 5 skipping in the normal allele leads to hearing loss in a mouse model of Usher syndrome (WT / KO) in which one Ush2a allele is normal and the other allele is disrupted.

[0065] (b). Graph of distortion product otoacoustic emission (DPOAE) threshold shift showing that exon 5 skipping in the normal allele leads to hearing loss in a mouse model of Usher syndrome (WT / KO) in which one Ush2a allele is normal and the other allele is disrupted. DETAILED DESCRIPTION

[0066] Gene therapy of USH2 via AAV is severely hampered by the size of the USH2A cDNA (15,606 nucleotides), which greatly exceeds the cargo capacity of AAV. Alternatively, skipping exon 13 in the USH2A transcript could be a potential therapeutic modality, where the resulting transcript encodes a slightly shortened in-frame USHERIN protein lacking several laminin EGF-like domains. USHERIN proteins translated from transcripts skipped from exon 13 remain functional, and thus the exon 13 skipping strategy has therapeutic potential for any hearing loss caused by mutations in USH2A exon 13.

[0067] Robust exon skipping induction via exon 13 splice acceptor deletion using CRISPR / dual sgRNA.

[0068] Deletion of the splice acceptor can mediate exon 13 skipping in USH2A transcripts. The splice acceptor can be deleted by gene editing with higher efficiency than deleting the entire exon 13. Cas9 and dual sgRNAs can be delivered to the inner ear of the patient via, for example, an AAV vector or lipid nanoparticles.

[0069] Compared to other potential treatments for Usher syndrome, such as antisense oligonucleotide (AON)-based treatments, which are difficult to evaluate for efficacy and may require multiple treatments throughout the life of the subject, the compositions and methods disclosed herein provide a one-time treatment, including an exon 13 skipping strategy, that can have durability, even for the patient's entire life. In addition, the disclosure provides evidence for the robust induction of specific target exon skipping, which can be developed as a gene editing therapy for diseases involving other splicing mutations.

[0070] Specific combinations of gRNAs mediate efficient removal of USH2A exon 13 in a variety of human cell lines, such as WERI-RB1 cells, and human induced pluripotent stem cells (hiPSCs) derived from patients with Usher syndrome. Exon 13 removal results in efficient production of USH2A in-frame transcripts that do not include exon 13, which are shown to be functional and promote rescue of hearing and vision in mouse models. We also generated human inner ear organoids from hiPSCs derived from patients with Usher syndrome and healthy control individuals.

[0071] The USHERIN protein encoded by USH2A (GenBank Acc No. NC_000001.11, Reference GRCh38.p7 Primary Assembly, Range 215622894-216423396, complement; SEQ ID NO: 1) is a transmembrane protein anchored in the photoreceptor plasma membrane (van Wijk, E., et al., Am J Hum Genet, 2004. 74(4): p.738-44; Grati, M., et al., J Neurosci, 2012. 32(41): p.14288-93). Its extracellular portion, which accounts for more than 96% of the length of the protein and projects into the periciliary matrix, is thought to have important structural and possible signaling roles for the long-term maintenance of photoreceptors (van Wijk, E., et al., Am J Hum Genet, 2004. 74(4): p.738-44; Grati, M., et al., J Neurosci, 2012. 32(41): p.14288-93). Two isoforms of USH2A have been described. Isoform b (GenBank Acc. No. NM_206933.2 (transcript) and NP_996816.2 (protein)) is most abundantly expressed in the retina and is used as the canonical, standard sequence in the literature and in this application.

[0072] Treatment

[0073] CRISPR / Cas based exon skipping has been successfully used to restore expression of functional dystrophin and dystrophic muscle function in a mouse model of Duchenne muscular dystrophy. The methods described herein include methods for treating disorders associated with mutations in exon 13 of the USH2A gene.

[0074] In some embodiments, the disease is Usher syndrome, for example, Usher syndrome type 2. Subjects with Usher syndrome type 2 (USH2) usually have moderate to severe hearing loss at birth, and gradually impaired vision from adolescence. In some embodiments, the disease is autosomal recessive retinitis pigmentosa (arRP). Typically, the method includes applying a therapeutically effective amount of a genome editing system as described herein to a subject who has such a treatment need or has been determined to have such a treatment need. The term "genome editing system" refers to any system with RNA-guided DNA editing activity. The genome editing system disclosed herein includes at least two components adapted from a naturally occurring CRISPR system: gRNA and RNA-guided nucleases. These two components form a complex that can bind to a specific nucleic acid sequence in a cell and, for example, by performing a single-strand break (SSB or nick), a double-strand break (DSB) and / or a base substitution. One or more of the DNA in or around the nucleic acid sequence is edited. For a complete description of an exemplary genome editing system, see, for example, WO2018 / 026976.

[0075] As used herein, "treat" means improving at least one symptom of a disorder associated with a mutation in exon 13 of the USH2A gene. Typically, these mutations result in hearing loss and / or vision loss; therefore, treatment comprising administration of a therapeutic gene editing system as described herein can result in a reduction in hearing impairment and / or visual impairment; a reduction in the rate of progression of hearing loss and / or vision loss; and / or a return to or near normal hearing and / or vision. Hearing and vision can be tested using known methods such as electroretinograms, optical coherence tomography, video-electronystagmography, and audiological testing.

[0076] The method can be used to treat any subject (e.g., a mammalian subject, preferably a human subject) having a mutation in exon 13 of the USH2A gene, such as a c.2299delG mutation or a c.2276G>T mutation, for example, in one or both alleles of USH2A. As used herein, an "allele" is one of the genetic variations of a pair or series of polymorphisms (also referred to as mutations) at a specific genomic location. As used herein, a "genotype" refers to a diploid combination of alleles of a given genetic polymorphism. Homozygous subjects carry two copies of the same allele, and heterozygous subjects carry two different alleles. Methods for identifying subjects with such mutations are known in the art; see, e.g., Yan et al., J Hum Genet. 2009 Dec; 54(12): 732-738; Leroy et al., Exp Eye Res. 2001 May; 72(5): 503-9; or Consugar et al., Genet Med. 2015 Apr; 17(4): 253-261. For example, gel electrophoresis, capillary electrophoresis, size exclusion chromatography, sequencing, and / or arrays can be used to detect the presence or absence of an allele or genotype. Where desired, amplification of nucleic acids can be accomplished using methods known in the art such as PCR. In one example, a sample (e.g., a sample comprising genomic DNA) is obtained from a subject. The DNA in the sample is then examined to identify or detect the presence of an allele or genotype as described herein. An allele or genotype can be identified or determined by any method described herein, such as by Sanger sequencing or next generation sequencing (NGS). Since the size of exon 13 is 643bp, it is simple and direct to use Sanger sequencing or NGS to genotype patients with exon 13 mutations. Other methods can include hybridization of genes in genomic DNA, RNA or cDNA with nucleic acid probes, such as DNA probes (which include cDNA and oligonucleotide probes) or RNA probes. Nucleic acid probes can be designed to hybridize specifically or preferentially with specific mutations (also referred to as polymorphic variations).

[0077] Other methods for nucleic acid analysis may include direct manual sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81: 1991-1995 (1988); Sanger et al., Proc. Natl. Acad. Sci. USA 74: 5463-5467 (1977); Beavis et al., US Pat. No. 5,288,644); automated fluorescent sequencing; single-strand conformation polymorphism analysis (SSCP) (Schafer et al., Nat. Biotechnol. 15: 33-39 (1995)); clamped denaturing gel electrophoresis (CDGE); two-dimensional gel electrophoresis (2DGE or TDGE); conformation-sensitive gel electrophoresis (CSGE); denaturing gradient gel electrophoresis (DGGE) (Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232-236 (1989)); denaturing high performance liquid chromatography (DHPLC, Underhill et al., Genome Res. 7:996-1005 (1997)); infrared matrix-assisted laser desorption / ionization (IR-MALDI) mass spectrometry (WO 99 / 57318); mobility shift analysis (Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770 (1989)); restriction enzyme analysis (Flavell et al., Cell 15:25 (1978); Geever et al., Proc. Natl. Acad. Sci. USA 78:5081 (1981)); quantitative real-time PCR (Raca et al., Genet Test 8(4):387-94 (2004)); heteroduplex analysis; chemical mismatch cleavage (CMC) (Cotton et al., Proc. Natl. Acad. Sci. USA 85:4397-4401 (1985)); RNase protection assay (Myers et al., Science 230:1242 (1985)); use of polypeptides that recognize nucleotide mismatches, such as the E. coli mutS protein; allele-specific PCR, and combinations of such methods. See, e.g., U.S. Patent Publication No. 2004 / 0014095 to Gerber et al., which is incorporated herein by reference in its entirety.

[0078] In certain aspects, the present disclosure provides an AAV vector encoding a CRISPR / Cas9 genome editing system including a first gRNA and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 provided in Table 1, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431 provided in Table 2, and the present disclosure provides the use of such vectors for treating USH2A-related diseases. Exemplary AAV vector genomes are known in the art; see, for example, Figure 9 of PCT / US2019 / 023934, which shows some fixed and variable elements of these vectors: inverted terminal repeats (ITRs), one or two gRNA sequences and promoter sequences driving their expression, Cas9 coding sequences, and another promoter driving their expression. Each of these elements is discussed in detail herein. Although a single vector can be used to deliver Cas9 and two gRNAs, in some embodiments multiple vectors are used, e.g., where one vector is used to deliver Cas9 and another vector or vectors are used to deliver one or more gRNAs (e.g., one vector for one gRNA, one vector for two gRNAs, or two vectors for each of the two gRNAs).

[0079] RNA-guided nuclease / Cas9

[0080] Various RNA-guided nucleases can be used in the present method, for example, as described in WO 2018 / 026976. The method can use different CRISPR proteins and their corresponding gRNAs, including Streptococcus pyogenes Cas9 (SpCas9) and engineered SpCas9 variants, Staphylococcus aureus Cas9 (SaCas9), KKH variant SaCas9 (see Kleinstiver et al., Nat Biotechnol. 2015 Dec; 33 (12): 1293-1298; WO 2016 / 141224), Cpf1 (also known as Cas12a, such as AsCpf1, LPCpf1), Cas12f (such as UnlCas12f1, AsCas12f1), etc. In some embodiments, the RNA-guided nuclease used in the present method and composition is Staphylococcus aureus Cas9 or Streptococcus pyogenes Cas9. In some embodiments of the present disclosure, the Cas9 sequence is modified to include two nuclear localization sequences (NLS) (e.g., PKKKRKV (SEQ ID NO: 432) at the C-terminus and N-terminus of the Cas9 protein, and a micro-polyadenylation signal (or Poly -A sequence). Exemplary NLSs are the SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 433)) and the nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 434)). Other NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep. 2000 Nov 15; 1(5): 411-415; Freitas and Cunha, Curr Genomics. 2009 Dec; 10(8): 550-557.

[0081] An exemplary polyadenylation signal is

[0082] TAGCAATAAAGGATCGTTTATTTTCATTGGAAGCGTGTGTTGGTTTTTTGATCAGGCGCG (SEQ ID NO: 435). Exemplary S. aureus Cas9 sequences (both nucleotides and peptides) are described in Table 4 of WO 2018 / 026976, e.g., SEQ ID Nos 10 and 11 therein.

[0083] Guide RNA

[0084] In some embodiments, the gRNA used in the present disclosure can be unimolecular or modular, as described below.

[0085] Described herein are methods for treating a subject having a mutation in exon 13 of USH2A that utilize dual gRNAs to delete exon 13. Two gRNAs (sgRNA-L and sgRNA-R, one with a target sequence in intron 12 and one with a target sequence in intron 13) are used in combination to delete a small DNA fragment containing an exon 13 splice acceptor. sgRNA-L has a target sequence in intron 12, and sgRNA-R has a target sequence in exon 13. Tables 1 and 2 provide exemplary sequences of target sequences for sgRNAs targeting intron 12 (sgRNA-L) and exon 13 (sgRNA-R), respectively. The sgRNA targets fall within the 3'1000bp of intron 12 (SEQ ID NOs: 2-244) and the 3'1000bp of exon 13 (SEQ ID NOs: 245-431). Note that in the sequences provided in this article, the actual sgRNA will use U instead of T.

[0086] In some embodiments of these methods, any combination of a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431 can be used to delete certain DNA fragments from the genome, although certain combinations may be more preferred, as exemplified below.

[0087] In some embodiments, the compositions and methods disclosed herein use Staphylococcus aureus Cas9 (SaCas9) and corresponding gRNA. SaCas9 is one of several smaller Cas9 orthologues suitable for viral delivery (Horvath et al., J Bacteriol 190, 1401-1412 (2008); Ran et al., Nature 520, 186-191 (2015); Zhang et al., Mol Cell 50, 488-503 (2013)). The wild type recognizes a longer NNGRRT PAM that is expected to appear once in every 32bp of random DNA; or an alternative NNGRRA PAM. Tables 1 and 2 provide exemplary sequences of target sites in exons 12 and 13, respectively. Note that the "target site" sequence provided herein is the sequence of the gRNA (although the gRNA will replace T with U).

[0088] Table 1: Target sequences of exemplary sgRNA-L targeting USH2A intron 12, reference genome: human GRCh38 (NCBI RefSeq NC_000001.11) chr1: 216247225-216248226.

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095] Table 2: Target sequences of exemplary sgRNA-R targeting USH2A exon 13, reference genome: human GRCh38 (NCBI RefSeq NC_000001.11) chr1: 216246565-216247246.

[0096]

[0097]

[0098]

[0099]

[0100]

[0101] AAV delivery system

[0102] The method includes delivering a CRISPR / Cas9 genome editing system including a Cas9 nuclease and one or two guide RNAs to a subject in need. The delivery method may include, for example, viral delivery, preferably using an adeno-associated virus (AAV) vector encoding Cas9 and one or more guide RNAs. AAV is a naturally occurring defective virus that requires another virus such as an adenovirus or herpes virus as a helper virus for effective replication and production life cycle. (For review, see Muzyczka et al., Curr. Topics in Micro and Immunol. 158: 97-129 (1992)). AAV vectors effectively transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been widely used for gene augmentation or replacement and have shown therapeutic efficacy in a variety of animal models and in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther. 2009 Aug; 11(4): 442-447; Asokan et al., Mol Ther. 2012 April; 20(4): 699-708. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. For example, AAV2, AAV5, AAV2 / 5, AAV2 / 8 and AAV2 / 7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al., Vision Research 2008, 48(3):377-385; Khani et al., Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al., J. Virol. 2007 81(20):11372-11380). In some embodiments, the AAV vector can include an AAV capsid polypeptide described in PCT / US2014 / 060163 (or a sequence encoding the AAV capsid polypeptide); for example, an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT / US2014 / 060163, and a viral particle comprising a Cas9 sequence and a guide RNA sequence as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, such as Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44.In some embodiments, AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO2018 / 026976. However, it should be noted that many modified versions of the AAV2 ITRs are used in the art, and the ITR sequences shown below are exemplary and not intended to be limiting. Modifications of these sequences are known in the art or will be apparent to those skilled in the art and are therefore included within the scope of the present disclosure.

[0103] Cas9 expression can be driven by promoters known in the art. In some embodiments, expression is driven by one of three promoters: cytomegalovirus (CMV), elongation factor-1 (EFS), or human g protein receptor coupled kinase-1 (hGRK1), which is specifically expressed in retinal photoreceptor cells. The nucleotide sequence of each of these promoters is provided in Table 5 of WO2018 / 026976. Modification of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of the present disclosure.

[0104] The expression of gRNA in AAV vector is driven by a promoter known in the art. In some embodiments, polymerase III promoter, such as human U6 promoter. An exemplary U6 ​​promoter sequence is presented as follows: AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 436).

[0105] In some embodiments, the nucleic acid or AAV vector shares at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity with one of the nucleic acids or AAV vectors listed above.

[0106] The above-mentioned AAV genome can be packaged into an AAV capsid (e.g., an AAV5 capsid), which can be included in a composition (such as a pharmaceutical composition) and / or administered to a subject. Exemplary pharmaceutical compositions comprising AAV capsids according to the present disclosure can include a pharmaceutically acceptable carrier, such as a balanced salt solution (BSS) and one or more surfactants (e.g., Tween 20) and / or a thermosensitive or reverse thermosensitive polymer (e.g., pluronic). Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described herein.

[0107] Compositions comprising AAV vectors according to the present disclosure can be administered to a subject by any suitable means, including but not limited to injection, such as subretinal injection or injection through the round window. The concentration of the AAV vector in the composition is selected to ensure, among other factors, that a sufficient dose of AAV is administered to the retina or inner ear of the subject, taking into account the dead volume within the injection device and the relatively limited volume that can be safely administered. Suitable doses may include, for example, 1×10 11 Viral genome (vg) / mL, 2×10 11 Viral genome (vg) / mL, 3×10 11 Viral genome (vg) / mL, 4×10 11 Viral genome (vg) / mL, 5×10 11 Viral genome (vg) / mL, 6×10 11 Viral genome (vg) / mL, 7×10 11 Viral genome (vg) / mL, 8×10 11 Viral genome (vg) / mL, 9×10 11 Viral genome (vg) / mL, 1×10 12 vg / mL, 2×10 12 Viral genome (vg) / mL, 3×10 12 Viral genome (vg) / mL, 4×10 12 Viral genome (vg) / mI, 5×10 12 Viral genome (vg) / mL, 6×10 12 Viral genome (vg) / mL, 7×10 12 Viral genome (vg) / mL, 8×10 12 Viral genome (vg) / mL, 9×10 12 Viral genome (vg) / mL, l×10 13 vg / mL, 2×10 13 Viral genome (vg) / mL, 3×10 13 Viral genome (vg) / mL, 4×1013 Viral genome (vg) / mL, 5×10 13 Viral genome (vg) / mL, 6×10 13 Viral genome (vg) / mL, 7×10 13 Viral genome (vg) / mL, 8×10 13 Viral genome (vg) / mL or 9×10 13 Viral genomes (vg) / mL. Any suitable volume of the composition can be delivered to the subretinal or cochlear space. In some cases, the volume is selected to form a bleb in the subretinal space, such as 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, etc.

[0108] Any area of ​​the retina can be targeted, although the fovea (which extends about 1 degree from the center of the eye) may be preferred in some cases because of its role in central vision and the relatively high concentration of cone photoreceptors relative to the peripheral areas of the retina. Alternatively or additionally, the injection can target the parafoveal region (extending between about 2 to 10 degrees from the center), which is characterized by the presence of all three types of retinal photoreceptor cells. In addition, the injection in the parafoveal region can be performed at a relatively acute angle using a needle path that crosses the midline of the retina. For example, the injection path can extend from the nasal aspect of the sclera near the limbus (limbus) through the vitreous chamber and enter the parafoveal retina on the temporal side, extend from the temporal aspect of the sclera to the parafoveal retina on the nasal side, extend from a portion of the sclera located above the cornea to a lower parafoveal position, and / or extend from the lower portion of the sclera to an upper parafoveal position. Use of a relatively shallow injection angle relative to the retinal surface can advantageously reduce or limit the likelihood of vector spillover from the bleb into the vitreous, and thus reduce vector loss during delivery. In other cases, the macula (including the fovea) can be targeted, and in other cases, additional retinal areas can be targeted, or can receive spillover doses.

[0109] In order to deliver to the inner ear, injection into the cochlear duct filled with high potassium endolymph can provide direct access to hair cells. However, changes to this delicate (delicate) fluid environment may destroy the potential in the cochlea, increasing the risk of injection-related toxicity. The perilymph-filled space around the cochlear duct, scala tympani and scala vestibularis can be entered from the middle ear through an elliptical or round window membrane (RWM). As the only non-bone opening for entering the inner ear, the RWM is relatively easy to enter in many animal models, and the use of this approach to administer viral vectors is well tolerated. Administration through an elliptical window or through the tympanic membrane can also be used. See, for example, WO2017100791 and US7206639.

[0110] For the purpose of preclinical development, the systems, compositions, nucleotides and vectors according to the present disclosure can be evaluated in vitro using a human retinal explant system, or in vivo using an animal model such as mice, rabbits, pigs, non-human primates, etc. The retinal explant is optionally maintained on a supporting matrix, and the AAV vector can be delivered by injection into the space between the photoreceptor layer and the supporting matrix to simulate a subretinal injection. Tissue for retinal explants can be obtained from a human or animal subject, such as a mouse.

[0111] Explants are particularly useful for studying the expression of gRNA and / or Cas9 after viral transduction, and for studying genome editing over relatively short intervals. These models also allow for higher production volumes than might be possible in animal models, and can predict expression and genome editing in animal models and subjects. Small (mice, rats) and large animal models (such as rabbits, pigs, non-human primates) can be used for pharmacological and / or toxicological studies, and for testing the systems, nucleotides, vectors, and compositions of the present disclosure under conditions and volumes close to those that will be used clinically. Because model systems are selected to summarize relevant aspects of human anatomy and / or physiology, data obtained in these systems will generally (although not necessarily) predict the behavior of AAV vectors and compositions according to the present disclosure in humans and animal subjects.

[0112] Example

[0113] The present invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0114] Example 1

[0115] Efficient deletion of the mouse Ush2A exon 12 splice acceptor using paired sgRNAs in mouse cells.

[0116] Mouse organ of Corti HEI-OC1 cells were used as an in vitro cell line model to test the methods disclosed herein. HEI-OC1 cells are derived from the mouse cochlea (Kalinec et al. (1999) Cell biology international 23(3): 175-184; Kelley et al. (1993) Development 119(4): 1041-1053). HEI-OC1 cells express USHERIN, making these cells particularly suitable for these studies.

[0117] CRISPR / Cas9 genome editing technology is used to induce mouse exon 12 or human exon 13 skipping in Ush2a / USH2A transcripts. LONZA 4D-Nucleofector TM Used to deliver Cas9 / sgRNA protein complexes to cells. The transfection procedure was performed according to the manufacturer's instructions (DS120, SG Cell Line 4D-Nucleofector TM X kit) was optimized. The purified sgRNA was incubated with Cas9 protein for 5 minutes before transfection. The culture medium was changed about 16 hours after nuclear transfection, and the cells were harvested for subsequent genomic DNA extraction after about 96 hours.

[0118] These results demonstrate that it is possible to delete all of exon 12 from the mouse genome in HEI-OC1 cells using CRISPR / Cas9 with a pair of sgRNAs, one targeting intron 11 and one targeting intron 12. Different sgRNA pairs were screened, and a pair of sgRNAs, sgL1 / sgR1, was identified that had a 23.4% deletion efficiency ( Figure 2A -C). Next, the genome editing strategy was redesigned to target the exon 12 splice acceptor for removal, a strategy called the receptor-targeted paired sgRNA strategy ( Figure 2E ). The receptor-targeted paired sgRNA strategy increased genome editing efficiency, with sgRNA pairs sgL1 and sgK4 demonstrating editing efficiencies greater than 60% ( Figure 2D , 2F , 2G). RT-PCR analysis of Ush2A transcripts showed that exon 12 in-frame transcripts increased in OC1 cells after genome editing ( Figure 2H , 2I ). Exon 12 skipping was also observed in unedited HEI-OC1 cells, in contrast to human cells, in which spontaneous exon skipping was not observed. These results indicate that the receptor-targeted paired sgRNA strategy effectively induces exon 12 skipping in mouse HEI-OCl cells.

[0119] Example 2

[0120] Efficient targeting of the USH2A exon 13 locus using a splice acceptor targeting strategy in human cells.

[0121] To evaluate the receptor-targeted paired sgRNA strategy in human cells, a human retinoblastoma-derived cell line (WERI-RB1) was used because WERI-RB1 cells express USHERIN. Multiple paired sgRNA combinations were screened to test the deletion efficiency at human USH2A exon 13, with each pair of sgRNAs including one sgRNA targeting human USH2A intron 12 and another sgRNA targeting exon 13 ( Figure 1 ). Removal of the exon 13 splice acceptor by paired sgRNA should abolish recognition of the remaining exon 13 as an exon, generating USH2A transcripts with exon 13 skipping ( Figure 3D ). The SpCas9 protein and paired sgRNA were combined to form RNPs and delivered into cells by nuclear transfection. After 48 hours, genomic DNA was extracted from the cells. Next, PCR and next-generation sequencing (NGS) were performed to evaluate the deletion efficiency at the USH2A locus. NGS analysis showed that the receptor-targeted paired sgRNA strategy resulted in a deletion efficiency of 69% for the sgL1 / sgK4 pair (having target sequences corresponding to SEQ ID NO: 17 and SEQ ID NO: 313, respectively), and a deletion efficiency of 84% for the sgL1 / sgK5 pair (having target sequences corresponding to SEQ ID NO: 17 and SEQ ID NO: 260, respectively) ( Figure 3E -h). In contrast, the whole exon 13 deletion strategy achieved only ~25% efficiency in exon 13 skipping ( Figure 3A -C).

[0122] Using RT-PCR, the percentage of in-frame exon 13 skipping in USH2A transcripts was evaluated after genome editing. Two pairs of primers were designed to detect wild-type USH2A transcripts (E12-E13-E14) and exon 13 skipping transcripts (E12-E14) ( Figure 4A ). 96 hours after nuclear transfection, miRNeasy Mini Kit (QIAGEN, 217004) was used to extract the 10 6 Next, PrimeScript PCR with gDNA Eraser was used with random hexamers according to the manufacturer’s instructions. TM RT Kit (PrimeScript TMRT reagent Kit with gDNA Eraser) (Takara) was used to produce the first strand cDNA. PCR was performed, and the results showed that sgL1 / sgK5 produced the highest exon 13 skipping induction efficiency ( Figure 4B ). Sanger sequencing of shorter fragments from the DNA gel confirmed in-frame exon 13 skipping. NGS was performed on cDNA reverse transcribed from USH2A transcripts to analyze the different types of USH2A transcripts generated by genome editing. The results showed that the sgL1 / sgK5 combination produced in-frame USH2A transcripts with the highest efficiency of exon 13 skipping: 73% of all USH2A transcripts were in-frame transcripts with exon 13 skipping ( Figure 4D -G). The NGS read lengths of sgL1 / sgK4 and sgL1 / sgK5 are shown in Figure 4H , 4I These data demonstrate that the receptor-targeted paired sgRNA strategy mediates USH2A exon 13 skipping and generates in-frame USH2A transcripts in human cells.

[0123] Example 3

[0124] In-frame transcripts with USH2A exon 13 skipping were efficiently induced from USH2A patient-derived hiPSCs.

[0125] To test the receptor-targeted paired sgRNA strategy in human cells carrying USH2A exon 13 mutations, human induced pluripotent stem cells (hiPSCs) derived from a female USH2 patient were obtained. The cells carry the homozygous c.2299delG mutation ( Figure 5A ). The c.2299delG mutation is located in human USH2A exon 13 and is the most common pathogenic mutation observed in patients with Usher syndrome. sgL1 / sgK5 sgRNA was used to induce USH2A exon 13 skipping in c.2299delG hiPSCs. Several Cas9 / sgL1 / sgK5 RNP doses were tested using nucleofection, and the results showed dose-dependent deletion efficiency, with the highest efficiency obtained at doses above 1000nM ( Figure 5B NGS analysis of genomic DNA extracted from edited hiPSCs showed that 75% of the reads included skipped exon 13 ( Figure 5C ).

[0126] Since USH2A is not expressed in hiPSCs, to analyze USH2A transcripts after editing, the synergistic activation mediator (SAM) system was used to activate USH2A expression in hiPSCs ( Figure 5D). After genome editing with Cas9 / sgL1 / sgK5 RNP, PB-SAM donor plasmid (addgene, 102559) with sgRNA to activate USH2A expression was co-transfected with PiggyBac transposon vector (PB210PA, System Biosciences) in c.2299delG hiPSC. Cells were cultured and selected in growth medium containing 10 μg / mL blasticidin. Total mRNA was isolated, cRNA was reverse transcribed, and NGS and RT-PCR were performed to analyze the expressed USH2A transcripts with exon 13 skipping. Gel imaging showed that 1000nM RNP delivery of a pair of sgRNA sgL1 / sgK5 induced efficient USH2A exon 13 skipping ( Figure 5E ), and NGS indicated that 73% of all USH2A transcripts included in-frame skipping of exon 13. Collectively, these data suggest that the receptor-targeted paired sgRNA strategy using Cas9 / sgL1 / sgK5 RNPs shows therapeutic potential for treating diseases associated with mutations in USH2A exon 13 by efficiently inducing in-frame exon 13 skipping.

[0127] Example 4

[0128] Efficient exon skipping in human USH2A patient inner ear organoids.

[0129] Wild-type hiPSCs, USH2A delG / delG hiPSCs and genome-edited USH2A delG / delG hiPSCs were differentiated into inner ear organoids that mimic human cochlear development in vivo. Differentiation of each of the three types of hiPSCs produced inner ear organoids containing hair cells. At day 50, organoid samples were collected, total mRNA was extracted, and cDNA was reverse transcribed. RT-PCR performed on cDNA showed that the expression of mitochondria in the inner ear organoids derived from wild-type hiPSCs and from USH2A delG / delG In hiPSC-derived organoids, only full-length USH2A transcripts containing exons 12, 13, and 14 were detected. Fig. 6A As shown in the gel image of , efficient exon 13 skipping was detected in organoids generated from hiPSCs edited with Cas9 / sgL1 / sgK5 RNP. Figure 6B As shown, transcripts with exon 13 skipping accounted for more than 75% of USH2A transcripts detected in organoids generated from hiPSCs edited with Cas9 / sgL1 / sgK5 RNPs.

[0130] Example 5

[0131] Exon 5 skipping in the Ush2a gene causes hearing loss.

[0132] Using a paired sgRNA genome editing strategy, an AAV vector was designed to target Ush2a exon 5 and exon 12 (equivalent to human USH2A exon 13) in the mouse genome. The AAV vector was administered to mice carrying a heterozygous Ush2a mutation (Ush2a + / - The study showed that exon 5 skipping, but not exon 12 skipping, caused hearing loss in the mouse model. This study shows that in the mouse model of Usher syndrome, exon 5 but not exon 12 is required for functional USHERIN protein in normal hearing.

[0133] Other Implementations

[0134] It should be understood that although the invention has been described in conjunction with the detailed description of the invention, the foregoing description is intended to illustrate rather than limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the appended claims.

Claims

1. A nucleic acid comprising a sequence encoding a Cas9 protein, a first gRNA, and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431.

2. The nucleic acid of claim 1, wherein the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO:

313.

3. The nucleic acid of claim 1, wherein the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO:

260.

4. The nucleic acid of any one of claims 1-3, wherein the nucleic acid encodes Streptococcus pyogenes Cas9 or Staphylococcus aureus Cas9, optionally KKH SaCas9.

5. The nucleic acid of claim 4, wherein the Cas9 comprises a nuclear localization signal, such as a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal; and / or wherein the sequence encoding the Cas9 comprises a polyadenylation signal.

6. A nucleic acid according to any one of claims 1-5, wherein the gRNA is a single-molecule S. pyogenes or S. aureus gRNA, or a corresponding two-part modular S. pyogenes or S. aureus gRNA.

7. The nucleic acid according to any one of claims 1 to 6, comprising a viral delivery vector, preferably an adeno-associated virus (AAV) vector.

8. The nucleic acid according to claim 7, wherein the viral delivery vector comprises a promoter for Cas9, preferably CMV, EFS, U1A or hGRK1 promoter.

9. The nucleic acid according to claim 8, comprising: (i) a first guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 2-244 and a second guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 245-431; (ii) first and second inverted terminal repeats (ITRs); and (iii) a promoter for driving the expression of Cas9 selected from the group consisting of CMV, EFS, U1A or hGRK1 promoter.

10. A nucleic acid according to any one of claims 1 to 9 for use in therapy.

11. The nucleic acid according to any one of claims 1 to 9, for use in the preparation of a medicament.

12. The nucleic acid of any one of claims 1-9 for use in a method of treating a subject suffering from a condition associated with a mutation in exon 13 of the USH2A gene.

13. The nucleic acid for use according to claim 12, wherein the condition is Usher syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).

14. The nucleic acid for use according to claim 12, wherein the AAV vector is delivered to the retina of the subject by injection, such as by subretinal injection, or to the inner ear of the subject by injection, such as through the round window.

15. A composition comprising a first ribonucleoprotein (RNP) complex comprising a Cas9 protein and a first gRNA, and / or a second RNP complex comprising a Cas9 protein and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431.

16. The composition of claim 15, wherein the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO:

313.

17. The composition of claim 15, wherein the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO:

260.

18. The composition of any one of claims 15-17, wherein the Cas9 is Streptococcus pyogenes Cas9 or Staphylococcus aureus Cas9, optionally KKH SaCas9.

19. A method for deleting a sequence including an exon 13 splice acceptor sequence from a USH2A gene in a cell, wherein the deletion includes a portion of intron 12 and a portion of exon 13, ranging from 6 bp to 2 KB, wherein the deletion induces human USH2A exon 13 skipping, the method comprising contacting the cell with a nucleic acid according to any one of claims 1 to 9 or a composition according to any one of claims 15 to 18.

20. A method for performing genome editing in human cells, the method comprising using CRISPR editing to form a first double-strand break within intron 12 of the human USH2A gene and a second double-strand break within exon 13 of the human USH2A gene, and resulting in the removal of a fragment of genomic DNA on chromosome 1 containing a portion of intron 12 and a portion of exon 13 of the USH2A gene.

21. The method of claim 20, wherein the first double-strand break is generated using a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and the second double-strand break is generated using a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431.

22. The method of claim 21, wherein the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO:

313.

23. The method of claim 21, wherein the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO:

260.

24. The method according to any one of claims 19 to 23, wherein the cell is in or from a subject having a mutation in the USH2A gene.

25. The method of any one of claims 19-24, wherein the cell is a cell of the eye or inner ear of a mammal.

Images