Medicine containing nuezhenide and application thereof

Abstract

The invention relates to the technical field of medicines, in particular to a medicine containing nuezhenide and application of the medicine. The ligustroside is used as the unique active component in the medicine and is applied to preparation of a medicine for promoting differentiation of filled stem cells into chondrocytes, a medicine for treating cartilage diseases and a medicine for treating joint diseases. According to the invention, the ligustroside is used as a unique active component, the ligustroside can be independently used for promoting chondrogenic differentiation of bone marrow mesenchymal stem cells, the medicine for treating joint diseases or cartilage diseases can be prepared, and a new field is developed for clinical application of the ligustroside. In addition, compared with a nuezhenide and specnuezhenide combined medication group, a nuezhenide independent medication group has a more obvious promotion effect and has an obvious cartilage defect disease repairing effect.

Description

Technical Field

[0001] The invention relates to the technical field of medicines, and in particular to a medicine containing ligustrum lucidum and application thereof. Background Art

[0002] Cartilage defect is one of the common major diseases in bone and joint clinics. Various injuries, inflammations and degeneration can cause irreversible cartilage damage. Cartilage has limited self-repair ability. Once a defect occurs, if it is not treated in time, the wound surface will continue to increase, resulting in cartilage synthesis disorders, which will lead to joint dysfunction and then cause arthritis. At present, cartilage defects caused by sports trauma, osteomyelitis and bone tumors are a difficult problem in clinical practice. In recent years, although the incidence of cartilage defects has been significantly reduced with the continuous improvement of orthopedic clinical treatment methods and technologies, according to statistics, the use of medical expenses for inpatients in the United States is still about US$5 billion per year for bone transplantation and fracture repair in approximately 1.1 million patients. At present, there is no authoritative statistics on the incidence of cartilage defects in my country, but with the development of industries such as industry and construction, the incidence of cartilage defects caused by high-energy trauma is increasing. The treatment of cartilage defects has become an important issue related to the quality of life of patients and the socioeconomic burden.

[0003] The main cause of cartilage defects is the loss of self-repair ability of articular cartilage. Using stem cells to differentiate into chondrocytes to treat cartilage defects has always been a research hotspot in the field of biomedicine and regenerative medicine. Bone marrow mesenchymal stem cells (BMSCs) have strong differentiation potential and can be directed to differentiate into chondrocytes, osteoblasts, myocytes and other cells under certain induction conditions. Studies have shown that in clinical practice, hyaline cartilage repair can be found when autologous BMSCs are injected into the knee joints of patients after microfracture surgery. This finding confirms that stem cells play an important repair role in cartilage regeneration. It can be seen that BMSCs can be used as ideal seed cells for stem cell treatment of cartilage defects.

[0004] In recent years, the repair of bone defects by BMSCs has been continuously studied in depth, but there are still many problems to be solved in its application, such as extremely low content of BMSCs in bone marrow, slow proliferation rate, weak chondrogenic activity, and gradual aging to fat, which cannot meet a large number of clinical needs. A large number of in vitro transfection and in vivo transplantation studies have shown that transplanted BMSCs are not active enough and the number of survival is small, which seriously limits the application and research of BMSCs. Exogenous growth factors such as TGFβ and morphogenetic protein BMP can significantly promote the chondrogenic differentiation of BMSCs, but they have a short half-life in the body, are easily degraded, and are expensive; transfection of TGFβ and other related genes can make them stably expressed in BMSCs, and telomerase can also immortalize stem cells, but there is a potential risk of tumor formation. Therefore, how to improve the induction rate of BMSCs and make them differentiate into chondrocytes efficiently and safely is a key issue that needs to be solved in BMSCs research.

[0005] At present, the drug options for improving the induction rate of BMSCs are very limited, and safer and more effective differentiation-promoting drugs are urgently needed to be developed. The differentiation mechanism of BMSCs is complex, and it is difficult for a single component to control its differentiation process well. Traditional Chinese medicine has the characteristics of multi-component and multi-target action. It has unique advantages by leveraging the advantages of the component-target network to jointly improve the differentiation efficiency of BMSCs. Finding effective prescriptions, traditional Chinese medicines or traditional Chinese medicine small molecules to improve the differentiation efficiency of BMSCs, and studying new methods to improve the differentiation of BMSCs are of great significance for the clinical treatment of cartilage defects and reducing medical costs.

[0006] Based on the theory of "kidney controls bone and produces marrow" in traditional Chinese medicine, regulating the directional differentiation of BMSCs by kidney-tonifying Chinese medicine and its extracts has become a highlight in tissue engineering research, providing a new research idea for bone tissue engineering repair. Erzhi Pills, a classic kidney-tonifying prescription, comes from the "Medical Bread" by Wang Sancai of the Ming Dynasty. It is composed of equal amounts of Ligustrum lucidum and Herba Ecliptae. It has little MSG and mild medicinal properties. It is a prescription for tonifying the kidney and strengthening the tendons and bones. Through the research of this topic, it was found that Ligustrum lucidum glycosides, the effective active ingredient of Erzhi Pills, can promote the directional differentiation of BMSCs into cartilage to repair cartilage defects. Summary of the invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a medicine containing privet glycosides and its application in view of the deficiencies in the prior art.

[0008] In order to solve the above technical problems, the present invention discloses a medicine containing privet glycoside and its application. The specific technical scheme is as follows:

[0009] The present invention provides an application of ligustrin as the only active ingredient in the preparation of a medicine for promoting differentiation of peristaltic stem cells into chondrocytes.

[0010] Wherein, the mesenchymal stem cells are bone marrow mesenchymal stem cells.

[0011] In a second aspect, the present invention provides the use of Ligustrum lucidum as the sole active ingredient in the preparation of a drug for treating cartilage diseases, wherein the Ligustrum lucidum promotes the differentiation of mesenchymal stem cells into chondrocytes.

[0012] The cartilage disease includes any one of cartilage defect, cartilage wear or cartilage degenerative lesions.

[0013] The third aspect of the present invention provides a use of Ligustrum lucidum in the preparation of a drug for treating joint diseases, wherein the Ligustrum lucidum promotes mesenchymal stem cells to differentiate into chondrocytes.

[0014] Wherein, the joint disease includes osteoarthritis or chondritis. The osteoarthritis is an inflammation caused by cartilage damage.

[0015] Wherein, the concentration of Ligustrum lucidum glycoside in the drug is 0.2-0.8 μM.

[0016] Wherein, the concentration of Ligustrum lucidum glycoside in the drug is 0.5 μM.

[0017] The drug may be administered in the form of a solution, emulsion, suspension, injection or transdermal preparation; or may be administered orally, sublingually, subcutaneously, intravenously or intramuscularly.

[0018] Preferably, in the above application, the dosage of Ligustrum lucidum glycoside in diseased rats is 0.002 μmol / 100 g / day, and the medication time is 4 weeks.

[0019] Beneficial effects:

[0020] The present invention provides a medicine containing ligustrin and its application, and explores the medicinal value of the known compound ligustrin as the only active ingredient. The present invention has found through research that ligustrin can be used alone to promote the differentiation of bone marrow mesenchymal stem cells into cartilage, and can be used to prepare medicines for treating joint diseases or cartilage diseases, which opens up a new field for the clinical application of ligustrin. In addition, the group of ligustrin used alone has a more significant promoting effect than the group of ligustrin and ligustrin used in combination, and has a significant effect of repairing cartilage defect diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0022] Figure 1 This is a Safranin-Fast Green staining detection diagram.

[0023] Figure 2 This is a graph showing the expression level of the cartilage marker gene SOX9 detected by Western blot. Figure 2 A is the Western blot test image. Figure 2 B is the graph of relative protein expression levels.

[0024] Figure 3 The figure shows the expression level of SOX9 RNA detected by RT-PCR. DETAILED DESCRIPTION

[0025] In the following examples, the ligustroglucosides were purchased from Chengdu Aifa Biotechnology Co., Ltd. with the item number AB1212; the ligustroglucosides were purchased from Chengdu Aifa Biotechnology Co., Ltd. with the item number AB0920.

[0026] In the following embodiments, the ligustroglucosides and the special ligustroglucosides are administered in the form of ligustroglucosides and special ligustroglucosides solutions, and the solvents of the ligustroglucosides solutions and the special ligustroglucosides solutions are both physiological saline.

[0027] Example 1

[0028] (1) Primary bone marrow mesenchymal stem cells (BMSCs) from SD rats were cultured to the third generation for subsequent experiments (the culture method is described in reference: Nsun4 and Mettl3 mediated translational reprogramming of Sox9 promotes BMSC chondrogenic differentiation. Communications biology, 2022, 5: 495.)

[0029] (2) Construct a cartilage defect model. The entire surgical process was performed in a strictly sterile environment. SD rats weighing about 250 g were selected and intraperitoneally injected with 3.5% chloral hydrate solution (1 mg / 0.1 kg) for general anesthesia. The solvent of the 3.5% chloral hydrate solution was normal saline. The knee joint was displaced to open it laterally. A sharp punch was used to punch a hole in the median bone groove of the articular cartilage with a diameter of about 3 mm. In order to reduce the number of animals used, both knee joints were punched for standby use.

[0030] (3) The BMSCs cultured in step (1) were transferred to the hydrogel matrix (purchased from Corning, catalog number #354250) and gently pipetted to make them uniform. The cell confluence was 1×10 7 / mL, transferred to the cartilage defect; wound clips were used to suture the incision; penicillin was injected for 3 consecutive days after surgery, with each rat injected with 80,000 units per day;

[0031] (4) The animals were divided into BMSCs group, BMSCs+special ligustrin group+ligustrin group, and BMSCs+ligustrin group. The animals were kept in a clean and suitable environment. The BMSCs+special ligustrin group+ligustrin group was injected with 100 μL of special ligustrin+ligustrin combined drug solution (special ligustrin 25 μmol / L, ligustrin 25 μmol / L) into the knee joint every day; the BMSCs+ligustrin group was injected with 100 μL of ligustrin solution (50 μmol / L) into the knee joint every day; after 4 weeks of drug intervention, the rats were killed by dislocation, the cartilage defect was fixed, and the cartilage defect repair was observed.

[0032] The bone tissue was decalcified, embedded and sliced, and then stained with safranin-fast green to detect cartilage formation. The results showed that the ligustri glycoside group and the combination of ligustri glycoside and ligustri glycoside could promote BMSCs cartilage differentiation and repair cartilage. At the same time, compared with the combination group, the ligustri glycoside group had a better effect. Figure 1 As shown, from Figure 1 It can be seen that the safranin staining increased in the BMSCs group treated with ligustrin alone compared with the combined drug group, indicating that ligustrin alone can more effectively promote the chondrogenic differentiation of BMSCs to repair cartilage defects. This experiment confirmed that ligustrin can promote the directional chondrogenic differentiation of BMSCs to repair cartilage defects.

[0033] Example 2

[0034] BMSCs were induced to differentiate into chondrogenic cartilage and a 3D chondrogenic spheroid model was constructed (the construction method is described in reference: Nsun4 and Mettl3 mediated translational reprogramming of Sox9 promotes BMSC chondrogenic differentiation. Communications biology, 2022, 5: 495.).

[0035] Ligustrum lucidum with a working concentration of 50 μmol / L, Ligustrum lucidum with a concentration of 25 μmol / L and Ligustrum lucidum with a concentration of 25 μmol / L were used for combined intervention, that is, Ligustrum lucidum and Ligustrum lucidum + Ligustrum lucidum were added to the constructed 3D chondrogenic spheres and cultured at 37°C for 7 days. The chondrogenic globulin was extracted (the extraction method is shown in the reference: Nsun4 and Mettl3 mediated translational reprogramming of Sox9 promotes BMSC chondrogenic differentiation. Communications biology, 2022, 5: 495.), specifically: the protein of the chondrogenic globulin cells was extracted using RIPA buffer (Thermo) containing 100× protease inhibitor mixture (purchased from Thermo). After centrifugation, the supernatant was obtained and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Western blot was used to detect the expression of the target protein chondrogenic marker gene SOX9, the size of which is 70 kDa. The results showed that the expression of SOX9 in the ligustrin group and the ligustrin plus ligustrin combined group was significantly higher than that in the induced group (BMSCs group, no drug was added). Figure 2 A and Figure 2 B, where Figure 2 B is the relative expression level of proteins. Figure 2 B shows that the relative expression level of SOX9 in the group treated with Ligustrum lucidum was 4.62 times that of the induced group and 1.57 times that of the combined group. At the same time, the efficiency of promoting chondrogenic differentiation of BMSCs in the Ligustrum lucidum group was more significant than that in the combined group. This result indicates that Ligustrum lucidum can promote the directional chondrogenic differentiation of BMSCs.

[0036] Example 3

[0037] BMSCs were used to induce chondrogenic differentiation, a 3D chondrogenic spheroid model was constructed, and drug intervention was used (the intervention method was the same as in Example 2). After chondrogenic spheroid protein was extracted, RT-PCR was used to detect the expression of chondrogenic marker gene SOX9 RNA, and the expression level of SOX9 was further verified. The specific experimental process is as follows:

[0038] (1) RNA extraction

[0039] After discarding the cell culture medium, wash twice with ice-cold PBS (pH=7.4), add Trizol lysis beads, collect into RNase-free EP tubes, and lyse on ice for 30 minutes. RNA was extracted using an RNA extraction kit (ZYMO). Nano drop was used for quantification and purity testing, and the cells were stored in aliquots at -80°C.

[0040] (2) Reverse transcription of RNA into cDNA

[0041] The reverse transcription kit (Roche) was used according to its instructions.

[0042] ① Take out the RNA prepared in step (1) and the reagents required in the reverse transcription kit and place them on ice to slowly thaw.

[0043] After thawing, centrifuge at low speed and place on ice for later use.

[0044] ② Take an equal amount of RNA (300-500 ng) from each sample group and add it to a nuclease-free PCR tube, add primers and nuclease-free water, and the total volume is 12 μL. The PCR system is shown in Table 1.

[0045] Table 1 PCR reverse transcription system composition

[0046]

[0047]

[0048] Place the prepared PCR reaction system in a PCR instrument, incubate at 65°C for 10 min, and immediately cool on ice.

[0049] ③Add the remaining reagents into the PCR tube as shown in Table 2.

[0050] Table 2 Composition of other reagents in qPCR reverse transcription system

[0051]

[0052] Place the prepared system on a PCR instrument for reverse transcription under the following conditions: 50°C, 60 min (reverse transcription reaction).

[0053] The cDNA obtained by the reverse transcription reaction was used as a template to perform qPCR reaction according to the reaction system described in Table 3 and the reaction conditions described in Table 4. The sequences of the Forward Primer and Reverse Primer described in Table 3 are Forward Primer: TCAACGGCTCCAGCAAGAACAAG (SEQ ID NO. 1); Reverse Primer: CTCCGCCTCCTCCACGAAGG (SEQ ID NO. 2).

[0054] Table 3 PCR system composition

[0055]

[0056] Table 4 qPCR reaction conditions

[0057]

[0058] The experimental results showed that the expression of SOX9 in the ligustrin group and the ligustrin combined with ligustrin was significantly higher than that in the induced group (BMSCs group). Figure 3 As shown in the figure, the efficiency of promoting BMSCs into chondrogenic differentiation in the Ligustrum lucidum group was more significant than that in the combined drug group. This result shows that Ligustrum lucidum can promote the directional chondrogenic differentiation of BMSCs.

[0059] The present invention provides a drug containing ligustrin and its application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. The application of Ligustrum lucidum glycosides as the only active ingredient in the preparation of drugs for promoting the differentiation of mesenchymal stem cells into chondrocytes.

2. The use according to claim 1, characterized in that: The mesenchymal stem cells are bone marrow mesenchymal stem cells.

3. The application of Ligustrum lucidum glycoside as the sole active ingredient in the preparation of drugs for the treatment of cartilage diseases.

4. The use according to claim 3, characterized in that: Ligustrum lucidum promotes the differentiation of mesenchymal stem cells into chondrocytes.

5. The use according to claim 3, characterized in that: The cartilage disease includes any one of cartilage defect, cartilage wear or cartilage degenerative lesions.

6. The use of Ligustrum lucidum glycoside as the sole active ingredient in the preparation of drugs for the treatment of joint diseases.

7. The use according to claim 6, characterized in that: Ligustrum lucidum promotes the differentiation of mesenchymal stem cells into chondrocytes.

8. The use according to claim 6, characterized in that: The joint diseases include osteoarthritis or chondritis.

9. The use according to any one of claims 1 to 8, characterized in that: In the drug, the concentration of privet glycoside is 0.2-0.8 μM, preferably 0.5 μM.

10. The use according to any one of claims 1 to 8, characterized in that: The dosage form of the drug includes any one of a solution, emulsion, suspension, injection or transdermal preparation; the administration method of the drug includes any one of oral, sublingual, subcutaneous, intravenous or intramuscular.

Images