Gene RXLR motif and application thereof

Abstract

The invention discloses application of a pathogenic bacterium RXLR effector gene RXLR motif or coding nucleic acid thereof in transporting disease-resistant protein genes. The amino acid sequence of the pathogenic bacterium RXLR effector gene RXLR motif is RFLRAHEEDDAGER, and the pathogenic bacterium RXLR effector gene RXLR motif belongs to the technical field of biology and the field of crop cultivation and disease control. The disease-resistant protein gene is a disease-resistant gene for resisting clubroot in Chinese cabbage, and particularly is a Chinese cabbage disease-resistant gene CRa1. According to the RXLR motif, the disease-resistant protein can be transferred into root system cells of root systems of brassicaceous plants such as tuber mustard and the like through the RXLR motif, a better control effect on the clubroot is achieved, in addition, the protein can be degraded in the root systems of the tuber mustard after 14 days, so that the clubroot is prevented and treated, hidden dangers do not exist in the aspect of safety, and the application prospect is wide. Meanwhile, on the basis of the RXLR motif, antibodies of other plant disease and insect pest resistant proteins or pathogenic bacteria pathogenic proteins can be subsequently developed to achieve a disease resistant effect.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, crop cultivation and disease prevention, and in particular to a gene RXLR motif and its application in transporting disease-resistant protein genes. Background Art

[0002] 1. Clubroot is the main disease in the cultivation of tuberous mustard, which is serious and difficult to prevent and control.

[0003] Clubroot is a soil-borne disease of Brassica crops caused by Plasmodiophora brassicae Woron, which is a parasitic fungus of the genus Brassicae. It causes serious damage to cruciferous vegetables and is extremely difficult to control (Howard R J, 2010). Clubroot mainly infects the roots of cruciferous vegetables, forming smooth or cracked and rough tumors of varying sizes, which are later infected by soil bacteria and rot. The aboveground parts of the plants grow slowly, wilt due to lack of water, and the leaves at the base gradually turn yellow and die in the later stage. In severe cases, the entire plant dies (Devos S, 2005). With the increase in the number of cultivated cruciferous crops and the expansion of the area, the exchange and transportation of commercial seeds and northern and southern vegetables, and the acidification of the soil, the area of ​​cruciferous clubroot in my country has expanded year by year in recent years, and the severity has increased year by year. Clubroot has become one of the main diseases restricting the sustainable development of cruciferous vegetable production in my country.

[0004] Tuberous stem mustard (Brassica juncea var.tumidaTsen et Lee) is a variant of Brassica juncea subspecies Brassica juncea in the family Brassicae. The mustard tuber made from it has become a favorite pickled vegetable of the Chinese people. As an important mustard tuber production area, Fuling is also well-known throughout the country. At present, in the cultivation process of tumorous stem mustard, clubroot and viral diseases have seriously restricted the production of tumorous stem mustard, among which clubroot is the most serious, resulting in a serious decline in the yield and quality of tumorous stem mustard. The plots with serious disease will no longer be suitable for the cultivation of tumorous stem mustard, which seriously threatens the sustainable development of the mustard tuber industry (Wang Diandong, 2016).

[0005] Clubroot is mainly spread by dormant spores in the soil, through diseased seedlings, water flow carrying bacteria and soil, etc. (Li Jinping, 2010). At present, the infection mechanism of clubroot is still not very clear. In the process of interaction between clubroot and host, it is still not clear how dormant spores gather in the roots, whether primary zoospores can directly invade the host root epidermal cells, and whether there is an asexual cycle (Du Yan, 2016). The fungus can survive in the soil for a long time, and its dormant sporangium can survive for a long time at minus 20℃. Once the disease occurs in the field, it is difficult to eliminate. If the field continues to plant cruciferous crops, the degree of disease will increase year by year (Narisawak, 2000; Druzhinina IS, 2012; Chu M, 2014). At the same time, because stem mustard is a low-temperature growing plant, there is a lack of alternative varieties other than cruciferous in the same period, so the continuous cropping of cruciferous plants is also the main reason for the rampant disease. At present, the main production methods include vegetable rotation, removal and burning of diseased plants, application of lime to adjust soil pH, covering with ash and chemical control, etc. In addition, since the disease acts on the roots of tuberous mustard, and the soil in Fuling is viscous and has many stones, and the abundant rain in winter makes it difficult to plow the soil, pesticides are difficult to work, and problems such as pesticide residues are becoming increasingly prominent.

[0006] 2. Disease resistance and susceptibility are two relative phenotypic responses of the interaction between plants and pathogens.

[0007] In the long-term co-evolution of plants and pathogenic microorganisms, two different modes of interaction have been formed, namely affinity (expressed as susceptibility) and incompatibility (expressed as resistance). Plants have susceptibility genes to specific pathogens (Eckardt NA, 2002). In nature, plants encounter a large number of potential pathogens. In order to discover plants as hosts, pathogens must overcome plants including passive barriers (such as leaf cuticle as a physical barrier) and induced defense responses (Niks RE, 2009; Bcj S, 2017). Among them, the induced defense response is triggered by pathogen-associated molecular pattern (PAMP) Triggered Immunity (PTI). PAMP is often a conservative compound such as chitin of fungi and flagellin of bacteria, and all invading pathogens can induce PTI (Bittel P, 2007; Boller T, 2009; Jones JD, 2006). Therefore, if the plant state is to be changed from a non-host to a host, the inhibition of PTI by pathogens is a prerequisite. Adapted pathogens manipulate host cell functions through secreted pathogen effectors, thereby inhibiting PTI (Jones JD, 2006; Van RDH, 2008). Studies have found that the main function of pathogen effectors is to inhibit plant innate immunity by interacting with specific host proteins (Van RDH, 2008), and most effector targets are defense signal components that positively regulate plant defense mechanisms (Chisholm ST, 2006; Speth EB, 2007; Vaithilingam V, 2017). For example, Pseudomonas syringae HopAI1 inhibits PTI by preventing the activity of two key components of the Arabidopsis immune signal transduction cascade, MPK3 and MPK6 (Jie Z, 2007). However, some pathogen effectors promote the growth and development of pathogens by activating effector targets with susceptibility factor functions, that is, they inhibit plant natural immunity. These effector targets are susceptibility genes (S-genes) of plant pathogens (Pavan S, 2010).So far, many susceptibility genes have been cloned successively, such as eIF4E and eIF4G (Diazpendon JA, 2004; Robaglia C, 2006), MLO (Büschges R, 2007; Bai Y, 2008), Xa5 (Iyerpascuzzi AS, 2007), Xa13 (Yang B, 2006), etc., which are cloned from natural mutants. Most susceptibility genes are identified through expression analysis of plant-pathogen affinity interactions, and the functions of their encoded proteins are complex and diverse (Hückelhoven R, 2013; Pavan S, 2010). Therefore, the control of susceptibility can be defined as a dominant gene in genetics, and its loss-of-function mutation is a recessive resistance. Based on the disease resistance exhibited by loss-of-function mutations in genes such as Mlo, PMR6, and eTF4E, DeAlmeida Engler et al. first proposed in 2005 the idea of ​​discovering disease-susceptibility genes as a new approach to breeding for nematode resistance. After more than 10 years of in-depth research on the functions of plant disease-susceptibility genes, a new breeding strategy based on the loss of plant disease susceptibility as a means of developing durable and broad-spectrum resistance has been formed (Hückelhoven R, 2013; Pavan S, 2010).

[0008] Two layers of immunity are formed in the incompatible interaction between plants and pathogens (Jones JD, 2006; Nicaise V, 2017). The first layer is pathogen-phase molecular pattern-triggered immunity (PTI), which is initiated by plant pattern recognition receptors (PRR) in plant surface cells. PTI is often a phenotypic response of the basic resistance of plants to prevent infection by various potential pathogenic microorganisms (Nicaise V, 2017); the second layer of immunity is triggered by plant immune receptor proteins (R proteins) recognizing pathogen-specific effectors (also called avirulence factors or Avr). Since R proteins can specifically recognize one or several pathogen effectors, this immune response is a typical effector-triggered immunity (ETI) (Roy S, 2017), that is, race-specific resistance, also called R gene-mediated resistance, often causes hypersensitive response (HR) at the infection site of pathogens, thereby inhibiting the growth of pathogens again; at the same time, some effectors of pathogenic microorganisms avoid being recognized by plant disease resistance proteins through the evolutionary mechanism of natural selection, thereby inhibiting ETI and promoting the growth of plant pathogens again (Jones JD, 2006; Gu Y, 2016). PTI is highly conservative or species-level resistance, while ETI often shows polymorphic variation among varieties and has been deeply studied and widely used in breeding (Boller T, 2009). In particular, with the rapid development of molecular genetic technology, a large number of disease resistance genes have been cloned and identified. At present, five major types of disease resistance genes have been discovered, namely: nucleotide binding site and leucine-rich repeat intracellular receptor protein NBS-LRR (nucleotide binding site plus leu-cine-rich repeat) including TIR-NBS-LRR type genes and non-TIR-NBS-LRR type genes, extracellular leucine-rich repeat transmembrane receptor protein eLRR-TM (extracellular leucine-rich repeat plus transmembrane receptor), extracellular leucine-rich repeat and intracellular serine / threonine kinase eLRR-TM-pkinase (extracellular leucine-rich repeat transmembrane protein kinase), serine / threonine kinase STK (serine-threorine kinase), and inactivated toxins (Inactivated toxin) (Wang Youhong, 2005; Chen G, 2007).So far, there are 8 recognized clubroot resistance genes in the world, namely Crr1, Crr2, Crr3, Crr4, CRa, CRb, CRc and CRk. Later, new disease resistance genes PbBa3.1 and PbBa3.3 were discovered. Plant pathologists and breeders use disease resistance genes and other defense response genes in plant disease resistance to develop disease-resistant varieties, providing effective "weapons" for controlling diseases in modern agricultural crop production (Wulff BB, 2011). In cruciferous plants, new clubroot resistance varieties of cabbage and rapeseed have been cultivated using disease resistance genes (R proteins) and are widely used in production (Zhang Jingyuan, 2013; Xu Xuezhong, 2015). Clubroot resistance varieties have not yet been cultivated in tumorous stem mustard.

[0009] 3. The way plant disease resistance proteins induce immune responses and signal transduction pathways

[0010] Plant disease resistance proteins can be divided into two modes of action: direct recognition and indirect recognition. That is, disease resistance proteins directly bind to effectors secreted by pathogens, inhibit their functions and play an immune role. For example, the disease resistance protein Pita in rice can directly bind to the effector AvrPita secreted by rice blast fungus (Jia Y, 2016). In most cases, plant disease resistance proteins recognize effectors indirectly, such as the plant disease resistance protein Rpm1 in Arabidopsis. The effectors AvrRpm1 and AvrB secreted by pathogens phosphorylate the RIN4 protein, and then Rpm1 can recognize the phosphorylated RIN4, which eventually causes HR and plays an immune role (Serrano M, 2010). The mechanism of the NBS-LRR-type disease resistance gene HRT recognizing the coat protein (CP) of turnip leaf crinkle virus requires a mediator protein (TIP) to form a CP-TIP-HRT complex to produce resistance (Ren T, 2000).

[0011] At present, only a few functions of plant disease resistance genes and related signal pathways have been studied relatively clearly, and most disease resistance gene signal transduction pathways need further study. The general rule is that after the cell detects the non-toxic protein of the pathogen, the membrane permeability changes and releases free radicals such as superoxide anions, peroxides and OH- to the extracellular space. These reactive oxygen intermediates and nitric oxide molecules accumulate locally, causing the plant's hypersensitive response and the expression of disease defense genes (McDowell JM, 2003; Fan G, 2015). In addition, the accumulation of reactive oxygen intermediates and nitric oxide as signal molecules can cause protein phosphorylation / dephosphorylation reactions, and the signal is transmitted and amplified, ultimately promoting the expression of resistance genes (Sessa G, 2000). Studies have found that there are 151 genes related to the interaction with root knot fungi in Chinese cabbage, involving pathways and processes such as PAMP, effector recognition, calcium ion influx, hormone signals, transcription factors and cell wall modification. Among them, the most widely used hormone signal transduction pathways are salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) (Chen J, 2016). SA signal transduction mainly depends on NPR1. Increasing SA levels can induce changes in cellular redox balance, thereby releasing a large number of NPR1 monomers. After these NPR1 monomers enter the nucleus, most of them bind to SA, inducing conformational changes in the NPR1 C-terminal domain, allowing it to interact with members of the TGA transcription factor family, thereby promoting the transcriptional activation of defense-related genes such as PR1 and WRKY (Fu ZQ, 2012; Wu Y, 2012; Pajerowskamukhtar KM, 2013). When JA content increases, it binds to its receptor COI1-JAZ complex, causing the disintegration of NINJA, JAZ, MYC2 / 3 / 4, and TPL complexes and the ubiquitination of JAZ, thereby releasing MYC transcription factors and activating JA to regulate gene expression (Fernández-Calvo P, 2010; Pauwels L, 2010Pauwels L; Sheard LB, 2010). When ET content increases, it binds to its receptor ETR1, causing CTR1 inactivation, preventing EIN2 phosphorylation. Unphosphorylated EIN2 undergoes proteolytic cleavage and enters the nucleus. EIN2 in the nucleus inhibits the proteasome degradation of EIN3, thereby triggering ET signal transduction (Binder BM, 2015; Wen CK, 2015).

[0012] At present, root knot is a very serious hazard in the cultivation of mustard. The infection of root knot fungi on mustard is closely related to the transplanting time. When the temperature is low, the incidence of root knot is less severe, but the late transplanting time affects the quality and yield of mustard, and also affects the cultivation of the next crop. If the infection of root knot fungi can be reduced in the early stage of transplanting, the harm caused by root knot fungi will be greatly reduced, and the yield and quality of mustard will be improved. Disease-resistant breeding is currently the most effective, safe and economical strategy to solve plant diseases, but at present, mustard has not yet cultivated varieties resistant to root knot. In addition, because a variety of plant hormones are involved in the regulation of immunity, the interaction between hormones leads to the impact on important agronomic traits such as yield, that is, there is a cost problem of resistance (He Zuhua, 2017).

[0013] Studies have found that different types of disease resistance proteins are distributed differently in plant cells. Among them, the disease resistance gene products with TM structure, such as eLRR-TM, eLRR-TM-Kinase and CC-TM, are located on the cell membrane, while the disease resistance gene products with NBS structure, such as STK and NBS-LRR, may be distributed in the cytoplasm (Dangl JL, 2001). The infection of Chinese cabbage with root knot fungus is controlled by a dominant single gene, among which the disease resistance gene crr1 gene is a TIR-NBS-LRR type disease resistance gene (Hatakeyama K, 2013; Yang Zheng, 2015). Therefore, it is inferred that in the Chinese cabbage resistant to root knot fungus varieties, the disease resistance protein interacts with the root knot fungus effector in the cytoplasm to block the infection of the pathogen, and the root knot fungus effector can be secreted into the root cells of cruciferous plants.

[0014] A class of intracellular effectors RXLR (R: arginine; X: any amino acid; L: leucine) was found in oomycetes and some fungi. The N-terminus of this type of effector protein has a signal peptide sequence that secretes the protein outside the pathogen cell. Immediately following the signal peptide is the conserved RXLR motif, which is responsible for transporting the effector into plant cells, followed by the C-terminal effector functional domain (Kamoun S, 2006; Govers F, 2008; Jiang RHY, 2012). The RXLR motif can mediate the effector to bind to inositol triphosphate (PI3P) on the extracellular membrane of the host plant, and further transport it into the host cell through host plant receptor-mediated endocytosis (Kale SD, 2010). For CRN-type effectors, the N-terminus of the signal peptide is followed by two adjacent and highly conserved FLAK (F: phenylalanine; L: leucine; A: alanine; K: lysine) and HVLVVVP (H: histidine; V: valine; L: leucine; P: proline) elements, and the C-terminus of the protein is a variable region (Tyler BM, 2006; Haas BJ, 2009). Summary of the invention

[0015] In view of the fact that the RXLR motif in the RXLR effector has the function of transporting the effector into the cell, the present invention screens the effector gene in the root-knot fungus genome library, analyzes the effector with the RXLR structure, analyzes the core domain of this type of gene transporting foreign proteins into the stem tumor mustard cell, and analyzes the maximum limit of its transport of foreign proteins, and uses its partial domain and the whole domain of disease-resistant protein transport to analyze its disease resistance, and uses the stem tumor mustard root endophytic fungi to express secretable disease-resistant protein containing RXLR motif. Disease-resistant protein can effectively bind to pathogen effectors and inhibit the occurrence of diseases. If the susceptible varieties can absorb disease-resistant protein, it is expected to solve the disease problem. Therefore, the technical problem to be solved by the present invention is: to introduce exogenous RXLR motif disease-resistant protein into plant cells or cell membranes so that it can act on pathogenic microorganism effectors, and use exogenous disease-resistant protein to prevent and control plant diseases.

[0016] The technical solution provided by the present invention is as follows:

[0017] The present invention provides a pathogen RXLR effector gene RXLR motif or an application of a nucleic acid encoding the pathogen RXLR effector gene RXLR motif in transporting disease resistance protein genes; the pathogen RXLR effector gene RXLR motif is characterized in that its amino acid sequence is: RFLRAHEEDDAGER (SEQ ID No. 2).

[0018] Preferably, the nucleotide sequence of the encoding nucleic acid is: CGCTTTCTGCGCGCGCATGAAGAAGATGATGCGGGCGAACGC (SEQ ID No. 3).

[0019] Specifically, the disease resistance protein gene is a disease resistance gene for Chinese cabbage to resist clubroot disease, and more specifically, it is the Chinese cabbage disease resistance gene CRa1.

[0020] The present invention also provides a disease resistance protein gene expression cassette, which includes an element connecting a nucleic acid encoding a RXLR motif of a pathogenic bacteria RXLR effector gene and the disease resistance protein gene. Preferably, the disease resistance protein gene is the Chinese cabbage disease resistance gene CRa1.

[0021] The present invention further provides an expression vector containing the anti-disease protein gene expression cassette, specifically, it is a prokaryotic expression vector.

[0022] The present invention also provides a fusion protein of a RXLR motif and a disease-resistant protein, wherein the pathogen RXLR-like effector gene RXLR motif is fused with the disease-resistant protein, and specifically the disease-resistant protein is a disease-resistant protein against Chinese cabbage and clubroot, and specifically it is the Chinese cabbage disease-resistant protein CRa1.

[0023] Specifically, the amino acid sequence of the RXLR motif of the pathogen RXLR effector gene is: RFLRAHEEDDAGER.

[0024] In a specific embodiment, the fusion protein is obtained by a genetic engineering expression system.

[0025] The present invention particularly provides a method for preventing and treating clubroot disease of cruciferous plants, which comprises irrigating or soaking the roots of the plants with the fusion protein.

[0026] Specifically, it is used for soaking and treating the root system of plant seedlings, specifically for soaking for 20-48 hours. The plant is mustard tuber, and the clubroot disease is Chinese cabbage resistant clubroot disease.

[0027] The present invention has the following beneficial effects: the disease-resistant protein can be transported into the root cells of the root system of cruciferous plants such as mustard tuber through the RXLR motif, and has a good preventive effect on clubroot. In addition, the protein will be degraded in the mustard tuber root system after 14 days, thereby achieving the prevention and treatment of clubroot, and there is no hidden danger in terms of safety. At the same time, based on the RXLR motif, other plant disease-resistant proteins or antibodies to pathogenic proteins of pathogenic bacteria can be developed in the future to play an anti-disease role. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 .Design of sequence of transgenic Chinese cabbage clubroot resistance gene CRa.

[0029] Figure 2 .Optimization detection diagram of RXLR+EGFP+CRa protein expression conditions, A: Induction temperature, where M is Maker D250KDa; 1, 2, 3 are induced at 16℃, 25℃, and 37℃ respectively; B: Inducer concentration, where M is Maker D250KDa; 1 and 2 are induced without inducer; 3, 4, 5 are induced with inducer concentrations of 0.5mmol / L, 1mmol / L, and 1.5mmol / L respectively.

[0030] Figure 3 .Analysis of the solubility of RXLR+EGFP+CRa protein and detection after protein purification, A: Solubility detection of recombinant protein RXLR+EGFP+CRa, M is Maker D250 KDa; 1, 2, 3 are whole bacteria, supernatant and precipitate after ultrasonic disruption of EGFP-CRa protein, respectively; B: Detection of recombinant protein RXLR+EGFP+CRa after purification, M is Maker D250KDa; CL is bacterial lysis buffer; FT is loading flow-through buffer; W1~W3 are denaturing lysis buffer wash buffers 1~3; E1~E4 are elution buffer elutions 1~4.

[0031] Figure 4.Observation of the root colonization of RXLR-EGFP-CRa protein in mustard tuber, A: green fluorescence signal in root cells after immersion for 1 hour, B: green fluorescence signal in root cells after immersion for 3 hours, C: green fluorescence signal in root cells after immersion for 6 hours, D: green fluorescence signal in root cells after immersion for 9 hours, E: green fluorescence signal in root cells after immersion for 12 hours, F: green fluorescence signal in root cells after immersion for 24 hours.

[0032] Figure 5 .Observation of fluorescence retention in the roots of mustard tuber (A: observation of green fluorescence signal in root cells 10 days after inoculation with RXLR-EGFP-CRa protein, B: observation of green fluorescence signal in root cells 14 days after inoculation with RXLR-EGFP-CRa protein.

[0033] Figure 6 .Observation of infection of root knot fungus after inoculation with RXLR-EGFP-CRa crude protein, A: spores adsorbed on the surface of root hairs (the part indicated by the asterisk) in the control group 1 day after inoculation, A': spores adsorbed on the surface (the part indicated by the asterisk) in the treatment group 1 day after inoculation; B: primary zoospores infect root hairs (the part indicated by the asterisk) in the control group 3 days after inoculation, B': spores infect root hairs (the part indicated by the asterisk) in the treatment group 3 days after inoculation; C: spores enter root hairs (the part indicated by the asterisk) in large quantities in the control group 5 days after inoculation, C': spores enter root hairs (the part indicated by the asterisk) in the treatment group 5 days after inoculation; D, E, F: spores form plasmodia inside root hairs 8 days after inoculation in the control group, and plasmodia produce Secondary sporangium, sporangium released into the environment produces small sporangium (part indicated by asterisks), D', E', F': spores form plasmophores in root hairs 8 days after inoculation in the treatment group, and the plasmophores form secondary sporangium, which is released into the environment and produces small sporangium (part indicated by asterisks); G: sporangium adsorbed on the cortex and root hair surface (part indicated by asterisks) 10 days after inoculation in the control group; G': a small number of sporangium adsorbed on the cortex and root hair surface 10 days after inoculation in the treatment group; H: spores enter the root cortex and pith and multiply in large numbers 14 days after inoculation in the control group (part indicated by asterisks); H': spores invade the cortical cells of the treatment group 14 days after inoculation (part indicated by asterisks).

[0034] Figure 7 . Observation of disease conditions 18 days after infection with root knotweed after inoculation of RXLR-EGFP-CRa crude protein. A: Root disease conditions. B: Growth conditions of the whole plant after disease. DETAILED DESCRIPTION

[0035] The present invention is further described below through specific implementation modes, but does not constitute a limitation of the present invention.

[0036] Example 1: Sequence design of the transgenic Chinese cabbage clubroot resistance gene CRa and construction of a prokaryotic expression vector

[0037] Referring to the RXLR effector gene sequence of the oomycete root-dotted fungus, the RXLR effector core motif was designed, which contained 14 amino acids and a total of 42 base sequences. In order to facilitate observation and further confirm the ability of the RXLR effector core motif to transport exogenous proteins into the cell and facilitate observation and analysis, 726 bases of the eGFP sequence with the termination codon removed (as shown in SEQ ID No. 1) were added, and finally 3975 bases of the CDS sequence of the Chinese cabbage disease resistance gene CRa were added to form a structural sequence containing the RXLR motif + eGFP + CRa. The predicted protein was 173kD ( Figure 1 The sequence was synthesized by BGI, and then connected to the prokaryotic expression vector PET28a to complete the construction of the PET28a--EGFP-Cra vector, and transformed into Escherichia coli BL21 competent cells, and single clones were picked for subsequent experiments.

[0038] Example 2: Optimization of prokaryotic expression conditions

[0039] The cells were cultured at 16°C, 25°C and 37°C respectively. When the OD600 value was within the range of 0.6 to 0.8, 1 mmol / L IPTG was added for induction for 4 hours. The induced proteins were subjected to SDS-PAGE gel electrophoresis. The results showed that ( Figure 2 In Figure A), the target protein of 173 KDa can be induced under different temperature induction conditions, but the expression level is highest under 16°C induction conditions, followed by 25°C, and finally 37°C. By screening the protein induction temperature conditions, 16°C can be selected as the culture temperature for subsequent inducer concentrations.

[0040] The concentration of inducer for recombinant protein expression was optimized. The cells were cultured at 16°C. When the OD600 value was within the range of 0.6-0.8, IPTG with concentrations of 0.5mmol / L, 1mmol / L, and 1.5mmol / L was added for induction for 4h. The bacterial solution without inducer was used as the control group. The results of SDS-PAGE electrophoresis showed that ( Figure 2 In B), IPTG can induce an increase in the expression of the target protein compared with the control group, but the change in the inducer concentration has no obvious effect on the expression of the target protein. Therefore, the induction temperature of 16°C and the inducer concentration of 1 mmol / L were selected as the culture conditions for protein expression in subsequent experiments.

[0041] Example 3: Purification of fusion protein

[0042] The target protein was induced overnight at 16°C and an inducer concentration of 1 mmol / L. The cells were collected and ultrasonically disrupted by adding a denaturing lysis buffer. The supernatant and precipitate were collected by centrifugation for SDS-PAGE electrophoresis analysis. The results showed that under this induction condition, a fusion protein band of 173 KDa was clearly present in the whole cells and precipitate after disruption, and a slightly obvious specific band was also present in the supernatant after disruption ( Figure 3 This indicates that most of the protein is present in the precipitate as inclusion bodies, and a small amount of protein is present in the supernatant of the lysate as soluble protein.

[0043] Induce overnight under optimal conditions, collect the cells by centrifugation, add denatured lysis buffer for ultrasonic disruption, and place the supernatant after centrifugation in a medium containing BeyoGold TM The His-tag Purification Resin was placed in a centrifuge tube and incubated at 4°C for 2 h. The column was washed 5 times with denaturing lysis buffer, 5 times with denaturing washing buffer, and 5 times with denaturing elution buffer to elute the target protein to obtain a RXLR+EGFP+CRa fusion protein with a molecular weight of 173 KDa, removing most other proteins ( Figure 3 (middle B).

[0044] Example 4: Analysis of the ability of RXLR-EGFP-CRa protein to be transported to the roots of mustard tuber and its degradation cycle

[0045] The constructed PET-28a(+)-EGFP-CRa recombinant plasmid was introduced into E. coli BL21, cultured overnight under the optimal induction conditions, centrifuged and collected, added PBS for ultrasonic disruption, soaked the mustard tuber roots with crude protein, and regularly took seedlings to observe the fluorescence colonization. The results showed that fluorescence could be observed in the cortex of the seedlings after soaking for 1 hour, and the protein began to enter the cortical cells ( Figure 4 Middle A); After immersion for 3 hours, the fluorescence area of ​​the cortex was observed to expand, and the protein infection area gradually increased ( Figure 4 Middle B); After 6 hours of immersion, a small amount of fluorescence can be observed in the basic tissue of the seedling, and the protein begins to invade the internal tissue ( Figure 4 C); After 9 hours of immersion, a large amount of fluorescence can be observed in the internal tissues, and the protein begins to infect the internal tissues on a large scale ( Figure 4 D); After immersion for 12 hours, a small amount of fluorescence can be observed in the pith and duct, and protein begins to invade the pith ( Figure 4 Middle E); After immersion for 24 hours, the roots of the mustard tuber seedlings were full of fluorescence, and the protein almost completely infected the roots of the seedlings ( Figure 4 (F) This indicates that the protein can completely infect the root tissues of mustard seedlings after 24 hours.

[0046] After the RXLR-EGFP-CRa protein was inoculated into the roots of mustard tuber, a large amount of fluorescence was detected in the roots of mustard tuber 10 days after inoculation, and only a small amount of fluorescence remained 14 days after inoculation ( Figure 5 ), indicating that the effective period of RXLR-EGFP-CRa protein in vivo is about 14 days after inoculation.

[0047] Example 5: Analysis of resistance of RXLR-EGFP-CRa protein to clubroot

[0048] Ultrasonic disruption was used to extract and collect crude protein of RXLR-EGFP-CRa. After soaking the roots of sterile mustard seedlings for 24 hours (with sterile water as control), the inoculation concentration was 1*10 8 1 ml of dormant spores of root-knot fungus with a concentration of 100 / ml was hydroponically cultured in a 23°C incubator, and the root infection of root-knot fungus was observed and photographed at different time points. The results showed that in the entire life cycle of root-knot fungus, the early infection stage (1-3 days), i.e., the mutual recognition stage between root-knot fungus and root hair cells, the primary infection stage (3-10 days), the secondary infection stage (10-14 days), and the dormant stage (15-18 days), RXLR-EGFP-CRa crude protein can significantly inhibit infection and pathogenicity in root-knot fungus, as follows.

[0049] One day after inoculation, a large number of spores were observed adsorbed on the root surface in the control group ( Figure 6 In the middle (A), spores were also attached to the root surface of the seedlings in the treatment group, but the number was less than that in the control group ( Figure 6 A'); 3 days later, in the control group, primary zoospores formed by dormant spores were observed to swim to the surface of root hairs and attach to them, and a small number of spores entered the root hairs ( Figure 6 In the treatment group, there were also zoospores adsorbed on the root hair surface and entered, but the number was less than that of the control group ( Figure 6 B'); after 5 days, it can be observed that a large number of primary zoospores in the control group entered the root hair cells, and the number of spores adsorbed on the surface was greater ( Figure 6 C), a small amount of spores entered the root hairs of the seedlings in the treatment group ( Figure 6 C'); 8 days later, multiple infection processes of root knot fungi were observed in the control group, including the formation of zoospores and the presence of plasmodia inside the root hairs ( Figure 6 D), the plasmodium divides and expands to produce secondary zoosporangium ( Figure 6 E), then the sporangium is released and continues to grow and divide in the external environment to produce sporangium ( Figure 6 F), the newly generated secondary sporangium will release a large number of secondary zoospores after development. The above infection process can also be observed in the treatment group, which is the formation of plasmodium ( Figure 6 D'), the plasmodium produces secondary zoosporangium ( Figure 6In E’), the zoosporangia are then released into the environment and produce small sporangia ( Figure 6 In F’), the sporangia release secondary zoospores into the environment. Compared with the control group, the treatment group produced fewer sporangia. Ten days after inoculation, a large number of sporangia could be observed adsorbed on the surface of the cortex and root hairs in the control group ( Figure 6 In G), a small number of sporangia could be observed adsorbed on the surface of the root hairs and cortex in the treatment group ( Figure 6 In G’); Fourteen days after inoculation, a large number of bacteria were observed invading the cortex and stele of the stem mustard roots in the control group, and multiplying in large numbers to form plasmodia ( Figure 6 In H); A small number of bacteria invaded the cortex of the treatment group seedlings’ roots, but no bacteria invaded the stele part ( Figure 6 In H’); Eighteen days after inoculation, samples of the swollen roots of the mustard tuber were taken to observe the condition of the swollen roots. The results showed that compared with the control group, the main roots of the mustard tuber roots inoculated with the protein had less severe disease and less obvious swollen roots ( Figure 7 In A), the lateral roots were well-developed, and the overall plant grew better ( Figure 7 In B).

Claims

1. An application of a pathogen RXLR-like effector gene RXLR motif or a nucleic acid encoding a pathogen RXLR-like effector gene RXLR motif in transporting disease resistance protein genes; the amino acid sequence of the pathogen RXLR-like effector gene RXLR motif is: RFLRAHEEDDAGER.

2. The use according to claim 1, characterized in that The nucleotide sequence of the encoding nucleic acid is: CGCTTTCTGCGCGCGCATGAAGAAGATGATGCGGGCGAACGC.

3. The use according to claim 1 or 2, characterized in that: The disease resistance protein gene is a disease resistance gene for Chinese cabbage to resist clubroot disease, specifically, it is the Chinese cabbage disease resistance gene CRa1.

4. A disease resistance protein gene expression cassette, characterized in that: The invention comprises an element connecting the encoding nucleic acid of the RXLR motif of the pathogenic bacteria RXLR effector gene and the disease resistance protein gene.

5. The anti-disease protein gene expression cassette according to claim 4, characterized in that: The disease resistance protein gene is the Chinese cabbage disease resistance gene CRa1.

6. An expression vector containing the anti-disease protein gene expression cassette as claimed in claim 4 or 5, specifically, it is a prokaryotic expression vector.

7. A fusion protein of RXLR motif and disease resistance protein, characterized in that: The pathogen RXLR effector gene RXLR motif is fused with the disease resistance protein. Specifically, the disease resistance protein is a disease resistance protein against Chinese cabbage and clubroot, specifically, it is the Chinese cabbage disease resistance protein CRa1.

8. The fusion protein according to claim 7, characterized in that The amino acid sequence of the RXLR motif of the pathogenic bacteria RXLR effector gene is: RFLRAHEEDDAGER.

9. A method for preventing and treating clubroot of cruciferous plants, characterized in that: The plant is subjected to root irrigation or root immersion treatment using the fusion protein as described in claim 7 or 8.

10. The method according to claim 9, characterized in that Specifically, it is used for soaking and treating the root system of plant seedlings, specifically for soaking for 20-48 hours. The plant is mustard tuber, and the clubroot disease is Chinese cabbage resistant clubroot disease.

Images