Trans-fluorescent protein gene specifically expressed by rice embryo, vector and construction method and application thereof

Abstract

The invention relates to a transgenic fluorescent protein gene specifically expressed by a rice embryo, a vector and a construction method and application of the transgenic fluorescent protein gene. The gene has a fragment of a nucleotide sequence as shown in SEQ ID NO.1; according to the invention, the fluorescent protein gene is combined with the promoter for embryo specific expression, so that the fluorescent protein gene is expressed in the seed embryo, and the diploid seed can be identified in the early stage of the seed through a fluorescent protein observation system, so that the purposes of early screening and removing the diploid seed are achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of gene engineering, and more specifically to a rice embryo-specifically expressed transgenic fluorescent protein gene, a vector, and a construction method and application thereof. Background Art

[0002] Double haploid breeding technology can obtain 100% homozygous genetic material used as breeding parents within 1-2 generations. It can significantly accelerate the breeding process and cultivate high-yield, high-quality, and highly resistant crop varieties in a short period of time. It is one of the modern advanced biological breeding technologies.

[0003] The molecular mechanism of haploid induction in maize induction lines has been elucidated, and related homologous genes have been found in rice seeds. By using modern gene editing technology to edit related genes, rice induction lines can be artificially created. With such rice induction lines, rice haploid seeds can be produced in the field, and rice haploids can be converted into rice double haploids through chromosome doubling technology. However, the induction frequency of rice haploid induction lines is not high, generally around 5%. Therefore, there is a problem of how to screen haploids, especially how to screen haploid seeds.

[0004] On the issue of how to screen haploids, the traditional method is to plant the seeds of the hybridization of the induced line and the breeding material, and screen out haploid plants by observing the growth and fruiting of rice. However, haploids need to double into double haploids to reproduce offspring and be used as breeding materials for rice breeding. The best time for haploids to double into double haploids is the seedling stage after seed germination, so how to screen out diploid seeds at the seed stage has become one of the key technologies for double haploid rice breeding. Summary of the invention

[0005] Based on this, the present invention provides a transgenic fluorescent protein gene specifically expressed in rice embryos. The present invention combines the fluorescent protein gene with a promoter specifically expressed in embryos to express the fluorescent protein gene in seed embryos, thereby enabling diploids to be identified through a fluorescent protein observation system, thereby achieving the purpose of early screening of diploid seeds.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] A transgenic fluorescent protein gene specifically expressed in rice embryos, the gene having a fragment of the nucleotide sequence shown in SEQ ID NO.1.

[0008] The present invention also provides a rice embryo-specifically expressed fluorescent protein gene transduction vector, wherein the vector comprises the above gene.

[0009] The method for constructing the above-mentioned rice embryo-specific expression fluorescent protein gene vector comprises the following steps:

[0010] S1. Preparation of promoter OsESG and protein DsRed+pinII: using rice genome as template, designing specific primers, performing PCR amplification and gel electrophoresis, recovering target fragments to obtain promoter OsESG fragment and protein DsRed+pinII fragment respectively; wherein the upstream primer sequence of the promoter OsESG is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3; the upstream primer sequence of the protein DsRed+pinII gene is shown in SEQ ID NO.4, and the downstream primer sequence is shown in SEQ ID NO.5; the promoter OsESG fragment sequence is shown in SEQ ID NO.6, and the protein DsRed+pinII fragment sequence is shown in SEQ ID NO.7;

[0011] S2 and P1300-R vectors were double-digested with restriction endonucleases EcoRI and KpnI, the electrophoretic fragment of the linearized vector was cut out, and the target fragment was recovered;

[0012] S3, homologous recombination ligation: the promoter OsESG fragment and the protein DsRed+pinII fragment obtained in step S1 are connected to the linearized vector by homologous recombination to obtain a ligation product;

[0013] S4. Add the ligation product to the competent E. coli cells, culture them, screen the positive clones, detect by PCR, extract the plasmids and sequence them. If the sequencing result is consistent with the sequence of the target fragment, the expression vector is successfully constructed.

[0014] In some embodiments, in step S1, the PCR reaction system prepared by the promoter OsESG and the protein DsRed+pinII is: 2×buffer 25 μL, upstream primer 1 μL, downstream primer 1 μL, KOD-FX polymerase 1 μL, cDNA 1 μL, and ddH2O to 50 μL.

[0015] In some embodiments, in step S1, the PCR reaction conditions for preparing the promoter OsESG and the protein DsRed+pinII are: 94°C treatment for 2 min; 98°C treatment for 10 s, 58°C treatment for 30 s, 68°C treatment for 1:30 min, for 32 cycles; 68°C extension for 4 min.

[0016] In some embodiments, in step S3, the homologous recombination ligation system is: Gibson assembly mix 5 μL, linearized empty load 100 ng, target fragment 50 ng, add ddH2O to 10 μL; reaction conditions are: treatment at 50°C for 30 min.

[0017] In some embodiments, in step S4, colony PCR detection is performed using a specific primer pair, and the band size is 1509 bp; the sequences of the upstream primers J, J1, J2 and the downstream primer RB-R of the primer pair are shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively.

[0018] In some embodiments, the reaction system for PCR detection is: 2×Taq MIX 10μL, upstream primer J 0.5μL, downstream primer RB-R 0.5μL, pick a small amount of colonies, add ddH2O to 20μL; PCR detection reaction conditions are: 25×, 95℃ pre-denaturation 5min, 95℃ denaturation 30s, 55℃ annealing 30s, 72℃ extension 1:45min, 72℃ final extension 5min.

[0019] In some embodiments, in step S4, plasmid extraction comprises the following steps:

[0020] (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight;

[0021] (2) Take the activated bacterial solution, centrifuge it at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely;

[0022] (3) Take Solution I reagent containing RNase A and thoroughly resuspend the bacterial mass;

[0023] (4) Take Solution II reagent to lyse the bacterial mass and turn it upside down several times until the bacteria become transparent;

[0024] (5) Take Solution III reagent and invert it several times until a white, compact flocculent substance is formed;

[0025] (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant;

[0026] (7) Take out the nucleic acid purification column from the kit, take the supernatant obtained in step (6) into the nucleic acid purification column, centrifuge at room temperature 12000 rpm for 1 min, and discard the filtrate;

[0027] (8) Add Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0028] (9) Add Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0029] (10) Repeat the above step (9);

[0030] (11) Place the nucleic acid purification column on the collection tube and spin at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0031] (12) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0032] (13) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C low-temperature refrigerator for later use;

[0033] (14) Take a portion of the recovered product and use 1% agarose gel electrophoresis to detect the quality of plasmid extraction.

[0034] In some embodiments, in step S4, the extracted plasmid is subjected to Sanger sequencing, using primer Lac-F with a sequence as shown in SEQ ID NO.12 and primer RB-R with a sequence as shown in SEQ ID NO.11 as sequencing primers for sequencing.

[0035] The present invention also provides the use of the above gene or vector in screening out non-haploid rice seeds.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The rice embryo-specifically expressed transgenic fluorescent protein gene or vector provided by the present invention combines the fluorescent protein gene with an embryo-specifically expressed promoter, so that the fluorescent protein gene can be expressed in seed embryos, thereby enabling diploid seeds to be identified with the aid of a fluorescence observation system, thereby achieving the purpose of screening out diploid seeds at an early stage.

[0038] The carrier of the present invention can screen out diploid seeds at the early stage of rice seeds, significantly reduce the cost of haploid identification, and provide the best material for doubling haploids into double haploids.

[0039] The vector construction method provided by the present invention is suitable for rice genetic transformation, and the obtained embryo-specifically expressed fluorescent protein gene transgenic material can be used as a precursor material for the creation of rice haploid induction lines, providing support for the creation of embryo-specifically expressed fluorescent protein gene transgenic rice induction lines and realizing the screening of rice diploid seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the plasmid map of the P1300-R vector;

[0041] Figure 2The present invention provides a plasmid map of the embryo-specifically expressed fluorescent protein gene transfection vector constructed by the present invention. DETAILED DESCRIPTION

[0042] Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the connotation of the present invention, so the present invention is not limited to the specific implementation disclosed below.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0044] Example 1

[0045] A method for constructing a rice embryo-specifically expressed fluorescent protein gene vector comprises the following steps:

[0046] 1. Primer design

[0047] F-T1:

[0048] acacaggaaacagctatgacatgattacgaattcCTTCGGCCCCACAATGGAATCT

[0049] R-T1:

[0050] CTCGGTGATGACGTTCTCGGAGGAGGCCATCATTGCTCGTGACGT

[0051] ACGTGAAC

[0052] F-T2:ATGGCCTCCTCCGAGAACGTCATCACCGAGTT

[0053] R-T2:aagcttGCATGCCTGCAGGTCGACTCTAGAggatcc

[0054] J:ACCATCACACCATCGGACAC

[0055] J1:GCATGTCACTATGTGTGCATCC

[0056] J2:ACGTTCTCGGAGGAGGCCAT

[0057] Lac-F:TCACTCATTAGGCACCCCAG

[0058] RB-R:AAGTTGGGTAACGCCAGGGT

[0059] The specific construction method includes the following steps:

[0060] S1. Preparation of promoter OsESG and protein DsRed+pinII: Using the Nipponbare rice genome as a template, design specific primers, and after PCR amplification, recover the target fragments by gel electrophoresis to obtain promoter OsESG fragments and protein DsRed+pinII fragments respectively;

[0061] The primers for the promoter OsESG are F-T1 and R-T1, and their sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; specifically:

[0062] F-T1:

[0063] acacaggaaacagctatgacatgattacgaattcCTTCGGCCCCACAATGGAATCT

[0064] R-T1:

[0065] CTCGGTGATGACGTTCTCGGAGGAGGCCATCATTGCTCGTGACGT

[0066] ACGTGAAC

[0067] The reaction system and reaction conditions for the preparation of the promoter OsESG are shown in Tables 1 and 2, respectively:

[0068] Table 1 PCR amplification system

[0069]

[0070] Table 2 PCR reaction conditions

[0071]

[0072] Among them, the primers for protein DsRed+pinII gene are F-T2 and R-T2, and their sequences are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively;

[0073] Specifically:

[0074] F-T2:ATGGCCTCCTCCGAGAACGTCATCACCGAGTT

[0075] R-T2:aagcttGCATGCCTGCAGGTCGACTCTAGAggatcc

[0076] The reaction system and reaction conditions of protein DsRed+pinII gene are shown in Table 1 and Table 2, respectively.

[0077] The electrophoresis fragments of 1020 bp and 1022 bp were cut out, and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd.; the operation was performed according to the instructions of the kit; the promoter OsESG fragment sequence is shown in SEQ ID NO.6, and the protein DsRed+pinII fragment sequence is shown in SEQ ID NO.7;

[0078] The structure of S2 and P1300-R vectors is as follows Figure 1 As shown, EcoRI and KpnI were used for double restriction digestion at 37°C, the electrophoresis fragment of the linearized vector was cut out, and the target fragment was recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd.; the operation was performed according to the instructions of the kit.

[0079] S3, homologous recombination ligation reaction: The promoter OsESG fragment and the protein DsRed+pinII fragment obtained in step S1 are connected to the linearized vector by homologous recombination to obtain a ligation product. The specific reaction system and reaction conditions are shown in Tables 3 and 4 below, respectively:

[0080] Table 3 Homologous recombination ligation reaction system

[0081]

[0082] Table 4 Homologous recombination ligation reaction conditions:

[0083]

[0084] S4, recombinant plasmid transformation, the specific steps are as follows:

[0085] (1) Take a tube of 100 μL of DH5a competent E. coli cells and mix with 2-5 μL of ligation product and place on ice for 30 min;

[0086] (2) Rapidly place in a 42°C constant temperature water bath, heat shock for 90 seconds, and ice bath for 2 minutes;

[0087] (3) Add 500 μL LB liquid medium and mix well;

[0088] (4) Cultivate at 37°C and 200 rpm for 45 min to allow the cells to return to normal growth;

[0089] (5) Spread the bacterial solution evenly on a Kana-resistant LB solid culture medium plate;

[0090] (6) After 30 minutes, place the cells in a 37°C incubator for overnight culture.

[0091] S5. Bacteria test

[0092] The primer pair J, J1, J2 and RB-R was used for colony PCR detection, and the band size was about 1509 bp; the positive plaques detected were picked and shaken; the upstream sequences of the primer pair were shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively, and the downstream sequence was shown in SEQ ID NO.11; specifically:

[0093] J:ACCATCACACCATCGGACAC

[0094] J1: GCATGTCACTATGTGTGCATCC

[0095] J2:ACGTTCTCGGAGGAGGCCAT

[0096] RB-R:AAGTTGGGTAACGCCAGGGT

[0097] The colony PCR amplification system is as shown in Table 5:

[0098] Table 5 Colony PCR amplification system

[0099]

[0100] The colony PCR reaction conditions are as shown in Table 6:

[0101] Table 6 Colony PCR reaction conditions

[0102]

[0103] S6. Plasmid extraction, as follows:

[0104] (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight;

[0105] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely;

[0106] (3) Take 250 μL of Solution I reagent containing RNase A to thoroughly resuspend the bacterial mass;

[0107] (4) Take 250 μL of Solution II reagent to lyse the bacterial mass and gently invert it several times until the bacteria become transparent;

[0108] (5) Take 350 μL of Solution III reagent and invert several times until white, compact flocs are formed;

[0109] (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant;

[0110] (7) Take out the nucleic acid purification column from the kit and place it on the collection tube;

[0111] (8) Take the clarified supernatant from the above operation step (6) and transfer it to a nucleic acid purification column, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate;

[0112] (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0113] (10) Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0114] (11) Repeat the above step 10;

[0115] (12) Place the nucleic acid purification column on the collection tube and spin at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0116] (13) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0117] (14) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C refrigerator for later use;

[0118] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the quality of the plasmid extraction;

[0119] S7. Sequencing

[0120] The plasmid extracted from the positive plaque was subjected to Sanger sequencing using sequencing primers Lac-F / RB-R. The sequencing primer sequences are shown in SEQ ID NO.12 and SEQ ID NO.11, respectively. Specifically, the sequencing primer sequences are as follows:

[0121] Lac-F:TCACTCATTAGGCACCCCAG

[0122] RB-R:AAGTTGGGTAACGCCAGGGT

[0123] The sequencing result sequence is consistent with the target fragment sequence, which means that the expression vector is successfully constructed. The structure of the successfully constructed vector is as follows: Figure 2 As shown, its sequence is shown in SEQ ID NO.1.

[0124] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0125] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A rice embryo-specifically expressed transgenic fluorescent protein gene, characterized in that: It has a fragment of the nucleotide sequence shown in SEQ ID NO.

1.

2. A rice embryo-specifically expressed fluorescent protein gene vector, characterized in that: Comprising the gene according to claim 1.

3. The method for constructing the rice embryo-specifically expressed fluorescent protein gene vector according to claim 2, characterized in that: The following steps are involved: S1. Preparation of promoter OsESG and protein DsRed+pinII: using rice genome as template, designing specific primers, performing PCR amplification and gel electrophoresis, recovering target fragments to obtain promoter OsESG fragment and protein DsRed+pinII fragment respectively; wherein the upstream primer sequence of the promoter OsESG is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3; the upstream primer sequence of the protein DsRed+pinII gene is shown in SEQ ID NO.4, and the downstream primer sequence is shown in SEQ ID NO.5; the promoter OsESG fragment sequence is shown in SEQ ID NO.6, and the protein DsRed+pinII fragment sequence is shown in SEQ ID NO.7; S2 and P1300-R vectors were double-digested with restriction endonucleases EcoRI and KpnI, the electrophoretic fragment of the linearized vector was cut out, and the target fragment was recovered; S3, homologous recombination ligation: the promoter OsESG fragment and the protein DsRed+pinII fragment obtained in step S1 are connected to the linearized vector by homologous recombination to obtain a ligation product; S4. Add the ligation product to the competent E. coli cells, culture them, screen the positive clones, detect by PCR, extract the plasmids and sequence them. If the sequencing result is consistent with the sequence of the target fragment, the expression vector is successfully constructed.

4. The method for constructing a rice embryo-specifically expressed fluorescent protein gene vector according to claim 3, characterized in that: In step S1, the PCR reaction system prepared by the promoter OsESG and the protein DsRed+pinII is: 2×buffer 25 μL, upstream primer 1 μL, downstream primer 1 μL, KOD-FX polymerase 1 μL, cDNA 1 μL, and ddH2O to 50 μL.

5. The method for constructing a rice embryo-specifically expressed fluorescent protein gene vector according to claim 3, characterized in that: In step S1, the PCR reaction conditions for the preparation of the promoter OsESG and the protein DsRed+pinII are: 94°C for 2 min; 98°C for 10 s, 58°C for 30 s, 68°C for 1:30 min, for 32 cycles; and 68°C for 4 min.

6. The method for constructing a rice embryo-specifically expressed fluorescent protein gene vector according to claim 3, characterized in that: In step S3, the homologous recombination ligation system is: Gibson assembly mix 5 μL, linearized empty load 100 ng, target fragment 50 ng, add ddH2O to 10 μL; reaction conditions are: treatment at 50°C for 30 min.

7. The method for constructing a rice embryo-specifically expressed fluorescent protein gene vector according to claim 3, characterized in that: In step S4, colony PCR detection is performed using a specific primer pair, and the band size is 1509 bp; the sequences of the upstream primers J, J1, J2 and the downstream primer RB-R of the primer pair are shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively.

8. The method for constructing a rice embryo-specifically expressed fluorescent protein gene vector according to claim 7, characterized in that: The reaction system for PCR detection was: 2×Taq MIX 10μL, upstream primer J 0.5μL, downstream primer RB-R 0.5μL, pick a small amount of colonies and add ddH2O to 20μL; the PCR detection reaction conditions were: 25×, 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 1:45min, 72℃ final extension for 5min.

9. The method for constructing a rice embryo-specifically expressed transgenic fluorescent protein gene according to claim 3, characterized in that: In step S4, the extracted plasmid is subjected to Sanger sequencing, using primer Lac-F with a sequence as shown in SEQ ID NO.12 and primer RB-R with a sequence as shown in SEQ ID NO.11 as sequencing primers for sequencing.

10. Use of the gene according to claim 1 or the vector according to claim 2 in screening out non-haploid rice seeds.

Images