Method for inducing high expression of delta-globin gene, composition and application

Abstract

The invention belongs to the technical field of gene editing, and discloses a method for inducing high expression of a delta-globin gene, a composition and application. The invention provides a method for inducing high expression of a delta-globin gene. The method comprises the following steps: artificially introducing a regulation motif into a positive-sense strand or an antisense strand of an HBD gene regulation region through a gene editing technology; the regulation and control motif is at least one of CCNCACCCCT, NTG-N (7-8)-WGATAR and CCAAT (C-CAAT); or at least one of the GGGTGNGG, the YTATCW-N (7-8)-CAN and the ATTGG. The HBD gene is edited by using a gene editing technology to induce high expression of the delta globin. And overexpression of exogenous globin genes is not needed, so that the safety risk of gene therapy is reduced. And the method can be suitable for diseases caused by various types of beta-hemoglobin deletion or mutation, and is not limited to diseases caused by a certain mutation site.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing, and in particular to a method, composition and application of inducing high expression of delta-globin gene. Background Art

[0002] Hemoglobin is composed of globin and heme, and plays a major role in carrying and transporting oxygen in the human body. In healthy adults, 95% of hemoglobin is HbA, which is composed of 2 α-globin chains and two β-globins; 2%-3.5% is HbA2, which is composed of 2 α-globin chains and two δ-globins.

[0003] β-thalassemia is a group of hereditary hemolytic diseases, mainly due to gene mutation or gene deletion that causes reduced synthesis of hemoglobin β chains, resulting in an imbalance in the synthesis ratio of α and β chains, α chain accumulation, and ultimately a series of changes such as hemolysis. Currently, the main treatment options for thalassemia are regular blood transfusions and iron removal, but this program still has the problem of chronic damage to multiple organ functions. Hematopoietic stem cell transplantation is considered to be an effective solution for the radical cure of thalassemia, but most patients find it difficult to obtain a suitable match, and there are varying degrees of graft-versus-host reaction (GVHD) after allogeneic transplantation. In addition, the high cost of transplantation treatment also makes it difficult to promote.

[0004] In recent years, gene editing technology has made great progress. The emergence of technologies such as CRISPR-Cas9, base editors, and lead editors has made the application prospects of gene editing technology more extensive. There are already a number of programs using CRISPR-Cas9 for gene editing to clinically treat β-thalassemia / sickle cell disease, and they have achieved remarkable success. δ-globin is also a type of β-globin. It combines with α-globin to form HbA2 (α2δ2), which is a ubiquitous and effective hemoglobin in adults, but its content is extremely low. Studies have shown that HbA2 has a lower affinity for oxygen, and HbA2 is ubiquitous in cells, while HbF is only present in 10%-30% of cells. Therefore, HbA2 is considered to be a more suitable globin than HbF (α2γ2) as a replacement for β-deficient globin. δ-globin can balance the pathophysiological changes caused by a series of α and β imbalances caused by β-globin deficiency, and achieve the purpose of treating β-thalassemia. Therefore, research on enhancing the expression of δ-globin may become a new target for the treatment of β-thalassemia and SCD. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method, composition and application for inducing high expression of delta-globin gene.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a method for inducing high expression of a delta-globin gene, wherein a regulatory motif is artificially introduced into the sense strand or antisense strand of the HBD gene regulatory region by gene editing technology;

[0008] The artificially introduced sites include at least one of -64 to -68 upstream of TSS of HBD, -89 to -81 upstream, -93 to -85 upstream, -100 to -92 upstream, -108 to -100 upstream, -119 to -111 upstream, -1470 to -1454 upstream, -78 to -62 TSS, +214 to +229 downstream, +1375 to +1391 downstream, and +1703 to +1719 downstream;

[0009] The regulatory motif is at least one of CCNCACCCT, NTG-N(7-8)-WGATAR, CCAAT; or at least one of GGGTGNGG, YTATCW-N(7-8)-CAN, ATTGG;

[0010] The N is any one of A, T, G, and C; the W is T or A; the R is A or G; and the Y is T or C.

[0011] The present invention utilizes gene editing technology to edit the HBD gene to induce high expression of delta globin. The method introduces CCNCACCCT, NTG-N(7-8)-WGATAR and / or CCAAT motifs or their antisense complementary chains into the promoter region of the HBD gene, forms a positive regulatory element in the non-coding region of the HBD gene, and promotes high expression of delta globin in hematopoietic stem / progenitor cells.

[0012] As a preferred embodiment of the method described in the present invention, the artificial introduction method includes at least one of sequence deletion, sequence insertion, and sequence mutation.

[0013] As a preferred embodiment of the method described in the present invention, the regulatory motif is any one of CCAAT, CCACACCCT, TTATCAATTCTACTCAG, TTATCTTAAACCAACAG, CTGGGGTTTCTGATAG, CTATCTCTTCTCCGCAG, and CTGGCTCTACAGATAG.

[0014] As a preferred embodiment of the method described in the present invention, the gene editing technology utilizes any one of the editing systems such as CRISPR-Cas editing system, base editor (BE), prime editing (PE), TALEN, ZFN, etc.

[0015] As a further preferred embodiment of the method described in the present invention, the nucleotide sequence of the ssODN used in the CRISPR-Cas editing system includes at least one sequence as shown in SEQ ID No.17 to SEQ ID No.22, SEQ ID No.50 to SEQ ID No.54, or the corresponding antisense complementary sequence thereof;

[0016] The nucleotide sequence of the sgRNA used includes at least one sequence as shown in SEQ ID No.25 to SEQ ID No.28, SEQ ID No.56 to SEQ ID No.60; and / or, the gRNA further comprises a chemical modification, preferably one or more of 3'-phosphorothioate, 2'-O-methyl, 2'-O-methyl, 2'-F modification, 2'-ribose 3'-phosphorothioate, deoxy and 5' phosphate modification; more preferably, the three ribonucleotides at the 5' and 3' ends of the gRNA are 2'-O-methyl modified, and the four ribonucleotides at the 5' and 3' ends are phosphorothioate bond modified. In a second aspect, the present invention provides a composition for gene editing of a delta-globin gene regulatory region, comprising ssODN; the ssODN contains at least one of CCNCACCCT, NTG-N(7-8)-WGATAR, CCAAT; or at least one of GGGTGNGG, YTATCW-N(7-8)-CAN, ATTGG;

[0017] The N is any one of A, T, G, and C; the W is T or A; the R is A or G; and the Y is T or C.

[0018] As a preferred embodiment of the composition of the present invention, the ssODN nucleotide sequence includes at least one sequence shown in SEQ ID No. 17 to SEQ ID No. 22, SEQ ID No. 50 to SEQ ID No. 54, or the corresponding antisense complementary sequence.

[0019] (1) The CCNCACCCT, NTG-N(7-8)-WGATAR, CCAAT, GGGTGNGG, YTATCW-N(7-8)-CAN, and ATTGG sequences in the ssODN are located at any position on the ssODN, including the replacement sequence, the 5' homology arm, the 3' homology arm, the junction between the 5' homology arm and the replacement sequence, or the junction between the 3' homology arm and the replacement sequence;

[0020] (2) the 5' homology arm and the 3' homology arm are symmetrical or asymmetrical;

[0021] (3) the 5' homology arm and / or the 3' homology arm are selected from the sense strand or the antisense strand of the non-coding region of the ζ-globin gene;

[0022] (4) the 3' end of the 5' homology arm in the ssODN is 0-20 bases away from the 5' end of the 3' homology arm;

[0023] (5) the length of the 5′ homology arm and / or the 3′ homology arm is 20 to 300 nt; and,

[0024] (6) The number of bases in the replacement sequence is 0-6.

[0025] The ssODN is chemically modified, such as phosphorothioate modified; the chemical modification is preferably to modify the 5' end and the 3' end of the ssODN; more preferably to modify the 5' end and the first 3 nucleotides of the 3' end of the ssODN.

[0026] As a further preferred embodiment of the composition of the present invention, the composition further comprises sgRNA; the nucleotide sequence of the sgRNA comprises at least one sequence as shown in SEQ ID No.25 to SEQ ID No.28, SEQ ID No.56 to SEQ ID No.60.

[0027] In a third aspect, the present invention provides a reagent for gene editing of the δ-globin gene regulatory region, comprising the composition.

[0028] In a fourth aspect, the present invention provides a hematopoietic stem / progenitor cell, which is obtained by transferring the composition into the hematopoietic stem / progenitor cell.

[0029] Preferably, the hematopoietic stem / progenitor cells include CD34+ hematopoietic stem / progenitor cells;

[0030] Preferably, the cells are derived from mammals; preferably, from humans or mice.

[0031] In a fifth aspect, the present invention uses the composition and the hematopoietic stem / progenitor cells in the preparation of a drug for treating a disease caused by β-hemoglobin deficiency or mutation, including β-thalassemia or sickle cell anemia.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention introduces CCNCACCCT, CCAAT or NTG-N(7-8)-WGATAR motifs into the non-coding region of the HBD gene, and edits the bases within the non-coding region of the δ-globin HBD gene by insertion, deletion, base substitution, etc. to activate or enhance the expression of δ-globin, thereby increasing the expression of HBD. There is no need to overexpress exogenous globin genes, which reduces the safety risk of gene therapy. In addition, activating the expression of the δ-globin gene can be applied to various types of diseases caused by β-hemoglobin deficiency or mutation, and is not limited to diseases caused by a certain mutation site. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of the locations of the CCAAT and CCNCACCCT transfer elements to be introduced into the upstream region of the HBD gene TSS and the location of the transcription element of β-globin.

[0035] Figure 2 Schematic diagram of gene Sanger sequencing results before and after electroporation editing at different sites in K562 cells.

[0036] Figure 3 The figures show the editing efficiency (3a), qPCR detection (3b) and TOF detection (3c) results of introducing CCAAT and CCNCACCCT transcription elements into K562 cells and CD34+HSPC cells.

[0037] Figure 4 This is a diagram showing the NGS sequencing results of introducing the NTG-N(7-8)-WGATAR element into CD34+ HSPC cells.

[0038] Figure 5 The figures show the editing efficiency (5a), qPCR detection (5b) and TOF detection (5c) results of introducing NTG-N(7-8)-WGATAR transcription elements into K562 cells and CD34+HSPC cells. DETAILED DESCRIPTION

[0039] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0040] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials and reagents used, unless otherwise specified, can all be obtained from commercial sources. The non-coding region of the HBD gene includes 2 kb upstream of the transcription start site (TSS), introns, and 2 kb of the 3' flanking region (Chromosome 11: 5232838-5236483; NCBI number: NC_000011.10, genome version GRCh38.p14).

[0041] Example 1: Introduction of binding sequences of NF-Y and KLF1 transcription factors into K562 cells

[0042] By introducing NF-Y and KLF1 binding sites into the upstream region of the HBD gene transcription start site (TSS), the specific locations of the candidate sites are as follows:

[0043] Region 1 (CCAAT), between -64 and -68 upstream of the TSS of the HBD gene (promoter), the original sequence is CCAAC;

[0044] Region 2 (TSS-81), between -89 and -81 upstream of the TSS of the HBD gene, with the original sequence TGAAACCCT;

[0045] Region 3 (TSS-85), between -93 and -85 upstream of the TSS of the HBD gene, with the original sequence CTAATGAAA;

[0046] Region 4 (TSS-92), between -100 and -92 upstream of the TSS of the HBD gene, with the original sequence TCACAAACT;

[0047] Region 5 (TSS-100), between -108 and -100 upstream of the TSS of the HBD gene, with the original sequence TTTCATTCT;

[0048] Region 6 (TSS-111), between -119 and -111 upstream of the TSS of the HBD gene, the original sequence is GAAGGTTCA.

[0049] According to the sequence characteristics of the candidate regions mentioned above and the cut point positions predicted by the CRISPR-Cas9 gene editing system, the mutation target types that are more suitable for the sequences in each region are analyzed, as shown in Table 1. The underlined bases represent the bases that need to be replaced, which are the desired results after gene editing. In the present invention, the length of the replacement base is 1-9 bases, and the effect achieved is deletion, replacement, insertion, or a combination of deletion, replacement, and insertion.

[0050] The six regions of the non-coding region of the δ-globin gene underwent changes such as replacement, deletion, and insertion of a few bases to form CCAAT or CCACACCCT and its antisense sequence structure, among which CCAAT is the binding sequence of NF-Y and CCNCACCCT is the binding site of KLF1.

[0051] Table 1 Wild-type sequence and target edited sequence of HBD target editing region

[0052] area SEQ ID Number and area Target site and edited sequence (5′-3′) CCAAT SEQ ID No.1 wild type TTATCTTAAACCAACCTGCTCACTG CCAAT SEQ ID No.2 Mutant 01 <![CDATA[TTATCTTAAA CCAAT CTGCTCACTG]]> TSS-81 SEQ ID No.3 wild type CACAAACTAATGAAACCCTGCTTATCTTA TSS-81 SEQ ID No.4 Mutant 02 <![CDATA[CACAAACTAA CC A C ACCCTGCTTATCTTA]]> TSS-85 SEQ ID No.5 wild type TTCTCACAAACTAATGAAACCCTGCTTAT TSS-85 SEQ ID No.6 Mutant 03 <![CDATA[TTCTCACAAA CC A CACCCT CCCTGCTTAT]]> TSS-92 SEQ ID No.7 wild type TTTTTCATTCTCACAAACTAATGAAACCC TSS-92 SEQ ID No.8 Mutant 04 <![CDATA[TTTTTCATTC C READ CC CTAATGAAACCC]]> TSS-100 SEQ ID No.9 wild type AAGGTTCATTTTTCATTCTCACAAACTAA TSS-100 SEQ ID No.10 Mutant 05 <![CDATA[AAGGTTCATT C READ CC CTCACAAACTAA]]> TSS-111 SEQ ID No.11 wild type ATAGTGGAATGAAGGTTCATTTTTCATTC TSS-111 SEQ ID No.12 Mutant 06 <![CDATA[ATAGTGGAAT CC A CACC C T TTTTTCATTC]]>

[0053] In order to achieve the formation of DSB by cutting the DNA double strand near the editing site in the selected region in Table 1, the present invention selects the spCas9 CRISPR-Cas system (derived from Streptococcus pyogenes) or Cas12 with higher cutting efficiency, analyzes the target sites with higher cutting efficiency, and selects site_1 to site_6 as candidate target sites. The target site DNA sequences and PAM sequences (NGG or NTTT) recognized by them are shown in Table 2 (SEQ ID No. 13 to SEQ ID No. 15).

[0054] Table 2 Target sites recognized by sgRNA / crRNA in the HBD noncoding region

[0055] SEQ ID Location sgRNA recognition site and PAM (5′-3′) Targeted area DNA strand SEQ ID No.13 site_1 TCCTCCCTGCTCCAGTGAGC AGG CCAAT,TSS-81 Antisense strand SEQ ID No.14 site_2 TTTA AGATAAGCAGGGTTTCATTA TSS-85, TSS-92 Antisense strand SEQ ID No.15 site_3 TTTC ATTAGTTTGTGAGAATGAAA TSS-100 Antisense strand SEQ ID No.16 site_4 TTTG TGAGAATGAAAAATGAACCT TSS-111 Antisense strand

[0056] According to the expected mutation type shown in Table 1, and the DNA chain (sense chain or antisense chain) recognized by sgRNA and crRNA in Table 2, the corresponding ssODN for guiding gene editing and repair is designed (Table 3, SEQ ID No. 17 to SEQ ID No. 22). The ssODN structure in the present invention includes a 5' homology arm, a replacement sequence, and a 3' homology arm. It should be noted that the CCAAT sequence, CCACACCCT sequence or the corresponding antisense complementary sequence in the ssODN structure can be located at any position on the ssODN, including the replacement sequence, the 5' homology arm, the 3' homology arm, and the junction of the 5' homology arm and the replacement sequence, and the junction of the 3' homology arm and the replacement sequence. The homology arms on both sides of the ssODN can be symmetrical or asymmetrical (the lengths of the two sides are different). For the convenience of system comparison, the ssODN with symmetrical homology arms is uniformly used for experiments in the present invention. The length of the homology arms on both sides of ssODN can be 20nt-300nt. For the convenience of system comparison, the embodiment of the present invention uses ssODN with a length of about 60nt on both sides of the homology arms for example. ssODN can be the sense strand or the antisense strand of the editing region DNA (the homology arm sequence is the same as the corresponding sense strand or the same as the antisense strand). In the present invention, ssODN uniformly selects the DNA strand identical to the sgRNA recognition site as the ssODN master sequence. In addition to the homology arm sequences on both sides, the sequence in ssODN can be 0, 1, 2, 3, 4, 5, 6 bases, and the effect achieved is deletion, replacement, insertion, or a combination of deletion, replacement, and insertion. The effect achieved can be to change more than one base on the genome, such as the deletion or replacement of 1-20 bases. As shown in Table 3, the underlined bases are the homology arms on both sides, with a length of about 60nt, and the bases not underlined between the homology arms on both sides are the replacement bases. The first three nucleotides at both ends of ssODN were modified with phosphorothioate to enhance the stability of ssODN and improve its activity in gene editing.

[0057] Table 3 ssODN sequences and their applicable regions

[0058]

[0059]

[0060] Use the sgRNA corresponding to the target site in Table 4, the first 20 bp is the recognition site sequence of the sgRNA, the following 80 nt is the universal sgRNA backbone sequence SEQ ID No.23: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU, the backbone sequence of the crRNA is SEQ ID No.24: UAAUUUCUACUCUUGUAGAU).

[0061] Table 4 sgRNA sequences

[0062]

[0063] Commercially available spCas9 protein (purchased from Kaixia Biotechnology, #Cas-EE109) ​​and Cas12 protein (purchased from Kaixia Biotechnology, #CAS-EE123) and chemically synthesized sgRNA (sequences are shown in Table 4 for the corresponding sgRNA / crRNA, the ends are chemically modified, the three ribonucleotides at the 5' and 3' ends are 2'-O-methyl modified, and the four ribonucleotides at the 5' and 3' ends are modified with phosphorothioate bonds), incubated in vitro to form a ribonucleoprotein (RNP) complex, and the corresponding ssODN is added as the homologous repair template chain, and the RNP complex and ssODN are delivered into K562 cells by electroporation. After 48 hours of culture of the electrotransfected K562 cells, the cells were collected to extract genomic DNA, and the corresponding gene fragments were amplified by PCR for sequencing. The PCR primers for the corresponding sites are shown in Table 5, and the sanger sequencing base sequences before and after electrotransfection editing are shown in Figure 1 AF in the sequencing results. The gene editing efficiency was analyzed by TIDE software ( Figure 2 It can be seen that the editing efficiency of the 9 selected sites is more than 20%.

[0064] Table 5 PCR primer names and sequences at different sites

[0065]

[0066] K562 cells were cultured for 7 days and 1×10 6RNA was extracted from each cell and reverse transcribed into cDNA. qPCR was performed with GAPDH as the internal reference. The qPCR primers for the HBD gene were forward primer 5'CAACCTCAAGGGCACTTTTT3' (SEQ ID No. 31), reverse primer 5'AAGGGCACTTTTTCTCAGC 3' (SEQ ID No. 32), forward primer 5'CCATGGGGAAGGTGAAGGTC3' (SEQ ID No. 33), and reverse primer 5'GAAGGGGTCATTGATGGCAAC3' (SEQ ID No. 34). The RT-QPCR results showed that the expression of δ-globin was increased to varying degrees, among which TSS-85 had the most significant effect, which could reach a 20-fold increase.

[0067] Example 2: Electroporation of ssODN and spCas9 (or Cas12) protein / sgRNA RNP into human hematopoietic stem / progenitor cells to achieve efficient gene editing and increase HBD expression

[0068] Human CD34-positive hematopoietic stem cells (HSPCs) derived from peripheral blood were revived and incubated in X-VIVO 500 cells enriched with human cytokines (SCF, TPO, Flt3L, 100 ng / mL each). TM -15 Serum-free Hematopoietic Cell Medium for two days, and the ssODN and spCas9 / sgRNA RNP in Example 1 were delivered to HSPCs using the EO-100 program provided by the Lonza-4D electroporator. After electroporation, the cells were cultured in X-VIVO TMThe cells were recovered and cultured for one day, and then cultured in medium containing EPO (used at a concentration of 24 IU / mL, manufacturer: PeproTech, catalog number: 100-64-250UG), SCF (used at a concentration of 100 ng / mL, manufacturer: novoprotein, catalog number: GMP-CD53), human AB serum (used at a concentration of 5%. Manufacturer: GEMINI, catalog number: 100-512), insulin (used at a concentration of 10 μg / mL, manufacturer: sigma, catalog number: I2643-50MG), transferrin (used at a concentration of 330 ug / mL, manufacturer: sigma, catalog number: T4132-500MG), heparin (used at a concentration of 2 IU / mL, manufacturer: sigma, catalog number: H3149-500KU-9), IL-3 (used at a concentration of 5 ng / mL, manufacturer: sino biology, catalog number: 11858-HNAE), hydrocortisone (used at a concentration of 1umol / L, manufacturer: Selleck, catalog number: S1696), glutamic acid (used at a concentration of 1%, manufacturer: Thermo, catalog number: 25030081) and other additives were cultured in IMDM culture medium. 2×10 5 Genomic DNA was extracted from the cells, and then the corresponding sequence fragments were amplified by PCR for Illumina sequencing (the sequencing primers for the corresponding sites were the same as those for K562 cells in Table 5). The sequencing results showed that a high editing efficiency could also be achieved in CD34+HSPCs.

[0069] At D14 of HSPC differentiation induction, 1×10 6 After RNA was extracted from cells, it was reverse transcribed into cDNA, and qPCR was performed with GAPDH as the internal reference (primers were the same as K562). The RT-QPCR results showed that the RNA level of δ-globin was increased, among which TSS-85 had the most significant effect, increasing by 3-4 times ( Figure 2 b).

[0070] On day 21 of HSPC differentiation induction, 2-4×10 6 The cells were subjected to MALDI-TOF MS to detect the expression of different globin proteins ( Figure 2 C) The results showed that the protein level of δ-globin was also increased in TSS-81, TSS-85, and TSS-92.

[0071] Example 3: Introduction of NTG-N(7-8)-WGATAR sequence into the non-coding region of the HBD gene of K562 cells and human hematopoietic stem cells

[0072] By gene editing technology, the NTG-N(7-8)-WGATAR sequence or NAG-N(7-8)-WGATAR sequence is artificially formed in the sense chain or antisense chain of the non-coding region of the HBD gene, so that the non-coding region of the HBD gene forms an enhancer element containing the NTG-N(7-8)-WGATAR sequence, the NAG-N(7-8)-WGATAR sequence or the corresponding antisense complementary sequence, wherein the antisense complementary sequence corresponding to the WGATAR sequence is YTATCW, wherein W is T or A, R is A or G, Y is T or C, and N is A, G, C or T.

[0073] By analyzing the sequence within about 2kb upstream of the HBD transcription start site (TSS), introns, and 1kb downstream of the 3' tail, the inventors found that the sequences of many segments can form the sequence structure of NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR after a few base substitutions, deletions, insertions, etc. By analyzing whether there is an NGG (PAM recognized by spCas9) sequence near the target mutant base in these segments, and whether the cut point is in the target sequence to be edited, five candidate target regions with the greatest potential for efficient gene editing were finally obtained, from near to far from the transcription start site:

[0074] Region VII (T1400), upstream of the TSS of the HBD gene (promoter) between −1470 and −1454, sequence TTATCAATTCTACTGTT;

[0075] Region eight (T60), between −78 and −62 of the HBD gene promoter, with the sequence TTATCTTAAACCAACCT;

[0076] Region nine (N70), located in the first intron of the HBD gene, between +214 and +229 downstream of the TSS, with the sequence CTTGGGTTTCTGATAG;

[0077] Region 10 (N800) is located in the second intron of the HBD gene, between +1375 and +1391 downstream of the TSS, with the sequence CTACCTCTTCTCCGCAG;

[0078] Region 11 (W60) is located at the 3' end of the HBD gene, between +1703 and +1719 downstream of the TSS, with the sequence CTGAGGCTCTACAGATAG.

[0079] According to the sequence characteristics of the five candidate regions and the cleavage point positions predicted by the CRISPR-Cas9 gene editing system, the mutation target types that are more suitable for the sequences in each region are analyzed, as shown in Table 6. The underline indicates the base that needs to be replaced, which is the desired result after gene editing, and "-" indicates deletion of the base. In the present invention, the length of the replacement base is 0-6 bases, and the effect achieved is deletion, replacement, insertion, or a combination of deletion, replacement, and insertion.

[0080] The five regions of the non-coding region of the δ-globin gene were altered by substitution, deletion, insertion, etc. of a few bases to form a sequence structure of NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR.

[0081] Table 6 The wild-type sequence of CTG-N(7-8)-WGATR to be introduced into the non-coding region of the HBD gene and the sequence obtained after editing

[0082] area SEQ ID Number and area Target site and edited sequence (5′-3′) T1400 SEQ ID No.35 wild type CGTAATTTATCAATTCTACTGTTGGTAAG T1400 SEQ ID No.36 Mutant 07 <![CDATA[CGTAATTTATCAATTCTACT CAG GGTAAG]]> T60 SEQ ID No.37 wild type CCCTGCTTATCTTAAACCAACCTGCTCAC T60 SEQ ID No.38 Mutant 08 <![CDATA[CCCTGCTTATCTTAAACCAA CAG GCTCAC]]> N70 SEQ ID No.39 wild type AAGACTCTTGGGTTTCTGATAGGCACTG N70 SEQ ID No.40 Mutant 09 <![CDATA[AAGACTCT G GGGTTTCTGATAGGCACTG]]> N800 SEQ ID No.41 wild type ATCTGCCTACCTCTTCTCCGCAGCTCTTG N800 SEQ ID No.42 Mutant 10 <![CDATA[ATCTGCCTA T CTCTTCTCCGCAGCTCTTG]]> W60 SEQ ID No.43 wild type AGGTTCCTGAGGCTCTACAGATAGGGAGCA W60 SEQ ID No.44 Mutant 11 AGGTTCCTG--GCTCTACAGATAGGGAGCA

[0083] Table 7 Target sites recognized by sgRNA for introducing CTG-N(7-8)-WGATR into the HBD non-coding region

[0084] SEQ ID Location sgRNA recognition site and PAM (5′-3′) Applicable areas DNA strand SEQ ID No.45 site_5 TAATTTATCAATTCTACTGT TGG T1400 Chain of Justice SEQ ID No.46 site_6 TCCTCCCTGCTCCAGTGAGC AGG T60 Antisense strand SEQ ID No.47 site_7 TGTAGACAGAGAAGACTCTT GGG N70 Chain of Justice SEQ ID No.48 site_8 ACCTCTTCTCCGCAGCTCTT GGG NN800 Chain of Justice SEQ ID No.49 site_9 GGTGTGTAAGAAGGTTCCTG AGG W60 Chain of Justice

[0085] According to the expected mutation type shown in Table 6, and the DNA chain (sense chain or antisense chain) recognized by sgRNA in Table 7, the corresponding ssODN guiding gene editing and repair is designed (Table 8, SEQ ID No. 50 to SEQ ID No. 54). In the present invention, the ssODN structure includes a 5' homology arm, a replacement sequence, and a 3' homology arm. It should be noted that the NTG-N (7-8) -WGATAR sequence, the NAG-N (7-8) -WGATAR sequence or the GATA or TATC sequence in the corresponding antisense complementary sequence in the ssODN structure can be located at any position on the ssODN, including the replacement sequence, the 5' homology arm, the 3' homology arm, and the junction between the 5' homology arm and the replacement sequence, and the junction between the 3' homology arm and the replacement sequence. The homology arms on both sides of the ssODN can be symmetrical or asymmetrical (the lengths of the two sides are different). For the convenience of system comparison, the ssODN with symmetrical homology arms is uniformly used for experiments in the present invention. The length of the homology arms on both sides of ssODN can be 20nt-300nt. For the convenience of system comparison, the embodiment of the present invention uses ssODN with a length of about 60nt on both sides of the homology arms for example. ssODN can be the sense strand or the antisense strand of the editing region DNA (the homology arm sequence is the same as the corresponding sense strand or the same as the antisense strand). In the present invention, ssODN uniformly selects the DNA strand identical to the sgRNA recognition site as the ssODN master sequence. In addition to the homology arm sequences on both sides, the sequence in ssODN can be 0, 1, 2, 3, 4, 5, and 6 bases, and the effect achieved is deletion, replacement, insertion, or a combination of deletion, replacement, and insertion. The effect achieved can be to change more than one base on the genome, such as the deletion or replacement of 1-20 bases. As shown in Table 8, the underlined bases are the homology arms on both sides, with a length of about 60nt, and the bases not underlined between the homology arms on both sides are the replacement bases. The first three nucleotides at both ends of ssODN were modified with phosphorothioate to enhance the stability of ssODN and improve its activity in gene editing.

[0086] Table 8 ssODN sequences and their applicable regions

[0087]

[0088] Backbone sequence SEQ ID No.55:

[0089] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU.

[0090] Table 9 sgRNA sequences

[0091]

[0092] Using commercial (purchased from Kaixia Bio, #Cas-EE109) ​​spCas9 protein and chemically synthesized sgRNA (sequence see Table 9 corresponding sgRNA, the end is chemically modified, the three ribonucleotides at the 5' end and 3' end are 2'-O-methyl modified, and the four ribonucleotides at the 5' end and 3' end are modified by thiophosphate bonds), incubated in vitro to form a ribonucleoprotein (RNP) complex, and the corresponding ssODN is added as the homologous repair template chain, and the RNP complex and ssODN are delivered into K562 / CD34+HSPC by electroporation. After 48 hours of cell culture after electroporation, the cells were collected to extract genomic DNA, and the corresponding gene fragments were amplified by PCR for sequencing. The PCR primers for the corresponding sites are shown in Table 10. The NGS deep sequencing results of the edited sites are shown in Table 10. Figure 4 and Figure 5 a. K562 was cultured for 7 days, and CD34+HSPC was differentiated. The relative expression of RNA level was measured at D14. RT-QPCR was used with GAPDH as the internal reference. The results showed that the activation effect of T60 in K562 was more than 30 times, and the RNA level of δ-globin in CD34+HSPC cells was 3-4 times that of the control group. MALDI-TOF MS was performed on CD34+HSPC cells at differentiation D21, and the results showed that the protein level of this site was also increased.

[0093] Table 10 PCR primer names and sequences at different sites

[0094] SEQ ID Primer name Sequence (5'-3') Applicable areas SEQ ID No.61 HBD-T1400-F TAGTTTGAACTCACCTCTGG TSS1400 SEQ ID No.62 HBD-T1400-R ACACATGCATGTGTGTATCC TSS1400 SEQ ID No.63 HBD-sanger-F ATCTCTAGAGGCAAAGAAGAACTTT T60 SEQ ID No.64 HBD-sanger-R AGGGCATTGACAGCAGTCTT T60 SEQ ID No.65 HBD-N70-F CAAAGTGAACGTGGATGCAG N70 SEQ ID No.66 HBD-N70-R CTTAGGGTTGCCCATAACAG N70 SEQ ID No.67 HBD-N800-F GGGAATAACCTGGGGATCAG N800 SEQ ID No.68 HBD-N800-R CAGCCACCACCTTCTGATAG N800 SEQ ID No.69 HBD-W60-F AGAATGTTCAGCTCAACTTCC W60 SEQ ID No.70 HBD-W60--R GCCTTGTACGGTTCCCTTG W60

[0095] The present invention forms CCAAT, CCNCACCCT, and NTG-N(7-8)-WGATAR as enhancer elements in different regions of the δ-globin gene, and significantly improves the expression of the δ-globin gene and protein after the gene-edited cells differentiate into red blood cells. Therefore, the present invention has potential application value in the gene therapy of diseases caused by β-hemoglobin deficiency or mutation (such as β-thalassemia or sickle cell anemia).

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A method for inducing high expression of δ-globin gene, characterized in that: The regulatory motifs were artificially introduced into the sense strand or antisense strand of the HBD gene regulatory region through gene editing technology; The artificially introduced sites include at least one of -64 to -68 upstream of TSS of HBD, -89 to -81 upstream, -93 to -85 upstream, -100 to -92 upstream, -108 to -100 upstream, -119 to -111 upstream, -1470 to -1454 upstream, -78 to -62 TSS, +214 to +229 downstream, +1375 to +1391 downstream, and +1703 to +1719 downstream; The regulatory motif is at least one of CCNCACCCT, NTG-N(7-8)-WGATAR, CCAAT; or at least one of GGGTGNGG, YTATCW-N(7-8)-CAN, ATTGG; The N is any one of A, T, G, and C; the W is T or A; the R is A or G; and the Y is T or C.

2. The method according to claim 1, characterized in that The regulatory motif is any one of CCAAT, CCACACCCT, TTATCAATTCTACTCAG, TTATCTTAAACCAACAG, CTGGGGTTTCTGATAG, CTATCTCTTCTCCGCAG, and CTGGCTCTACAGATAG.

3. The method according to claim 1, characterized in that: The gene editing technology utilizes any one of the editing systems such as CRISPR-Cas editing system, base editor, guide editor, TALEN, ZFN, etc.

4. The method according to claim 3, characterized in that The nucleotide sequence of the ssODN used in the CRISPR-Cas editing system includes at least one sequence as shown in SEQ ID No.17 to SEQ ID No.22, SEQ ID No.50 to SEQ ID No.54, or the corresponding antisense complementary sequence thereof; The nucleotide sequence of the sgRNA used includes at least one sequence shown in SEQ ID No.25 to SEQ ID No.28, SEQ ID No.56 to SEQ ID No.

60.

5. A composition for gene editing of a delta-globin gene regulatory region, characterized in that: Including ssODN; the ssODN contains at least one of CCNCACCCT, NTG-N(7-8)-WGATAR, CCAAT; or at least one of GGGTGNGG, YTATCW-N(7-8)-CAN, ATTGG; The N is any one of A, T, G, and C; the W is T or A; the R is A or G; and the Y is T or C.

6. The composition according to claim 5, characterized in that The ssODN nucleotide sequence includes at least one sequence shown in SEQ ID No. 17 to SEQ ID No. 22, SEQ ID No. 50 to SEQ ID No. 54, or the corresponding antisense complementary sequence.

7. The composition according to claim 5, characterized in that The composition also includes sgRNA; the nucleotide sequence of the sgRNA includes at least one sequence shown in SEQ ID No.25 to SEQ ID No.28, SEQ ID No.56 to SEQ ID No.

60.

8. A reagent for gene editing of the δ-globin gene regulatory region, characterized in that: The invention comprises a composition according to any one of claims 5 to 7.

9. A hematopoietic stem / progenitor cell, characterized in that: The composition is obtained by transferring the composition according to any one of claims 5 to 7 into hematopoietic stem cells.

10. Use of the composition according to any one of claims 5 to 7 and the hematopoietic stem / progenitor cells according to claim 9 in the preparation of a drug for treating diseases caused by β-hemoglobin deficiency or mutation.

Images