Tuberculosis treatment drug target based on mycobacterium DNA gyrase aggregate
By using the cohesion of gyra and Gyrb sub -siblings for the use of DNA rotenase, as a drug target, the existing antibiotic screening problems have the risk of resistance to resistance, developing new anti -tuberculosis drugs. In terms of sexual bacteria, it shows validity.
Patent Information
- Application Number
- CN202411451659.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2025-01-21
AI Technical Summary
The existing antibiotic screening for DNA gyrosase A subunits has the risk of developing drug resistance, and new strategies and targets are urgently needed to explore.
By utilizing the condensates formed by the GyrA and GyrB subunits of mycobacterial DNA gyrase as new drug targets, new anti-tuberculosis drugs are developed by interfering with the bacterial DNA replication and repair mechanisms.
This method reveals the unique physical characteristics of GYRA and GYRB subunit in condensing the body. It provides new ideas for drug design. The potential is to develop new anti -tuberculosis drugs, which can effectively suppress resistance bacteria.
Smart Images
Figure CN119331947A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the fields of biotechnology and pharmaceuticals, and in particular to a tuberculosis therapeutic drug target based on mycobacterium DNA gyrase condensates. Background Art
[0002] Tuberculosis is a global infectious disease caused by Mycobacterium tuberculosis, posing a serious threat to public health. The use of antibiotics has inhibited the spread of tuberculosis, but irrational drug use has led to the emergence of drug resistance, which has brought unprecedented challenges to the prevention and control of tuberculosis worldwide. Faced with this severe drug resistance problem, we urgently need to explore new strategies and develop new drugs.
[0003] Fluoroquinolones play a vital role in the treatment of tuberculosis caused by drug-resistant Mycobacterium tuberculosis. The mechanism of action of this class of drugs mainly involves inhibiting mycobacterial DNA gyrase and topoisomerase IV, which play an important role in the replication, repair and supercoiling of bacterial DNA. DNA gyrase is composed of two GyrA subunits and two GyrB subunits. Fluoroquinolones target the GyrA subunit, inhibiting its function of cutting and connecting DNA chains, effectively blocking the synthesis of bacterial DNA, thereby leading to bacterial death.
[0004] However, irrational drug use leads to mutations in the gyrA gene of mycobacteria, which in turn develops resistance to quinolones. The emergence of this resistance has led to the emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains, posing a serious threat to public health. To address this challenge, a new antibiotic, Evybactin, was screened out from the natural environment. Its target is the A subunit of DNA gyrase. By screening Evybactin-resistant mutants and using whole genome sequencing technology, the researchers found that all resistant mutants carried mutations in the GyrA gene. Whether its clinical promotion can lead to the emergence of MDR and XDR remains to be verified.
[0005] Therefore, there is a risk of drug resistance when directly screening drug candidates targeting the DNA helicase A subunit. In order to meet this challenge, it is urgent to explore new strategies and new drug targets. Summary of the invention
[0006] In order to overcome the problem of the risk of drug resistance by directly screening drug candidates against the DNA helicase A subunit.
[0007] The technical solution of the present invention is: a tuberculosis therapeutic drug target based on mycobacterial DNA gyrase condensate, comprising condensates of GyrA and GyrB subunits of mycobacterial DNA gyrase as active ingredients.
[0008] Preferably, the agglomerates have liquid properties and can be converted into a solid or fibrous state under certain conditions.
[0009] Preferably, the drug target acts by interfering with the mycobacterial DNA replication and repair mechanisms.
[0010] Application of tuberculosis therapeutic drug targets based on mycobacterial DNA gyrase condensates in the treatment of tuberculosis.
[0011] As a preferred method, the drug design idea is as follows:
[0012] S1: GyrA and GyrB subunits were separated by biochemical methods and induced to form liquid condensates under in vitro conditions;
[0013] S2: Study the stability and transformation characteristics of the coacervates at different pH values, temperatures and ionic strengths;
[0014] S3: Screen and synthesize a series of drug candidates to target the condensates of GyrA and GyrB subunits and evaluate their anti-TB activity.
[0015] The beneficial effects of the present invention are as follows: it is proposed to use liquid condensates formed by GyrA and GyrB subunits as a new target for the treatment of tuberculosis, and the unique physical properties of these subunits in the condensate state are revealed, which provides a new idea for drug design. The GyrA and GyrB subunits of mycobacterial DNA gyrase can form condensates with liquid properties under specific conditions, and have the characteristics of converting to a solid or fibrous state. The characteristics of these condensates make them potential drug targets, and new anti-tuberculosis drugs can be developed. Through bioinformatics and experimental verification, it is revealed that the mycobacterial DNA gyrase GyrA and GyrB subunits have the potential to form biological condensates, and their potential as drug targets is demonstrated. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The results show the prediction of disordered regions of mycobacterial DNA gyrase GyrA and GyrB proteins using the PONDER algorithm.
[0017] Figure 2 The AIUPred algorithm is used to analyze the disordered region prediction of mycobacterial DNA gyrase GyrA and GyrB proteins;
[0018] Figure 3The in vitro condensate formation system established using purified fluorescent fusion proteins GyrA-YFP and / or GyrB-mCherry is presented;
[0019] Figure 4 Shown is the fluorescence recovery after photobleaching (FRAP) analysis of DNA gyrase droplets;
[0020] Figure 5 Shown are the predicted aggregation-prone regions in the sequences of DNA gyrase GyrA and GyrB;
[0021] Figure 6 Shown is the effect of DNA gyrase-interacting proteins on the morphology of its liquid condensate;
[0022] Figure 7 Shown is the formation of DNA gyrase fibers under an electron microscope;
[0023] Figure 8 Shown is the effect of DNA gyrase-interacting proteins on mycobacterial viability;
[0024] Fig. 9 Shown is the effect of DNA gyrase-interacting proteins on the infection level of Mycobacterium marinum. DETAILED DESCRIPTION
[0025] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0026] Example 1
[0027] A tuberculosis therapeutic drug target based on mycobacterial DNA gyrase condensates, comprising condensates of GyrA and GyrB subunits of mycobacterial DNA gyrase as active ingredients.
[0028] Preferably, the agglomerates have liquid properties and can be converted into a solid or fibrous state under certain conditions.
[0029] Preferably, the drug target acts by interfering with the mycobacterial DNA replication and repair mechanisms.
[0030] Application of tuberculosis therapeutic drug targets based on mycobacterial DNA gyrase condensates in the treatment of tuberculosis.
[0031] As a preferred method, the drug design idea is as follows:
[0032] S1: GyrA and GyrB subunits were separated by biochemical methods and induced to form liquid condensates under in vitro conditions;
[0033] S2: Study the stability and transformation characteristics of the coacervates at different pH values, temperatures and ionic strengths;
[0034] S3: Screen and synthesize a series of drug candidates to target the condensates of GyrA and GyrB subunits and evaluate their anti-TB activity.
[0035] Experimental Example 1: Identification and verification of the ability of the GyrA and GyrB subunits of mycobacterial DNA gyrase to form bioaggregates
[0036] Bioinformatics tools were used to identify the intrinsically disordered regions (IDRs) in mycobacterial GyrA and GyrB subunits that could form bioaggregates, and the ability of mycobacterial GyrA and GyrB subunits to form aggregates was verified experimentally.
[0037] 1. Bioinformatics prediction
[0038] 1. Protein sequence acquisition
[0039] Data source: Protein sequences of mycobacterial GyrA and GyrB subunits were obtained from the Mycobrowser database (https: / / mycobrowser.epfl.ch / ).
[0040] 2. IDRs prediction
[0041] Tool selection: PONDER (Prediction of Naturally Disordered Regions) and AIUPred (Artificial Intelligence for Prediction of Unstructured Proteins) algorithms were used to predict IDRs in GyrA and GyrB sequences.
[0042] Parameter settings:
[0043] PONDER algorithm (http: / / www.pondr.com / ) settings parameters (XL1-XT).
[0044] AIUPred algorithm (https: / / aiupred.elte.hu / ) sets parameters (Redox state).
[0045] Results: The prediction results using the PONDR XL1-XT algorithm showed that IDRs were widely distributed in both GyrA and GyrB subunits (e.g. Figure 1The AIUPred algorithm further predicted that these IDRs may be affected by redox status, simulating changes under two states: “redox plus” and “redox minus” (as shown in Figure 2). Figure 2 The prediction results showed that the GyrA and GyrB subunits of DNA gyrase have the potential to form condensates.
[0046] 2. Experimental Verification
[0047] 1. In vitro experiments
[0048] Recombinant protein expression:
[0049] In order to obtain the recombinant proteins of mycobacterial DNA gyrase GyrA and GyrB subunits, gene cloning and protein expression techniques were used.
[0050] 1.1 PCR amplification of gene fragments
[0051] - Template: The genomic DNA of the model strain of Mycobacterium tuberculosis, Mycobacterium smegmatis mc2155, is used as the template.
[0052] - Amplified gene fragments: gene fragments encoding GyrA and GyrB subunits.
[0053] - Primer design:
[0054] pET28a-GyrA-YFP
[0055] -28a-GyrA-YFP-F:GTATTTCCAGGGCCATATGatgactgatacgacgctgccg
[0056] -GyrA-LINKER-R:tccacctccacctcctccacctcccgcctcgggtgactcggcgg
[0057] -LINKER-YFP-F:ggaggtggaggaggtggaggtggaatggtgagcaagggcgaggagctgtt
[0058] -28a-GyrA-YFP-R:CGAGTGCGGCCGCAAGCTTCTAttgtacagctcgtccatgc
[0059] pET28a-GyrB-mCherry
[0060] -28a-GB-MC-F:GTATTTCCAGGGCCATATGgtggctgcccagaagaacaat
[0061] -GyrB-LINKER-R:TCCACCTCCTCCACCTCCaacatccaggaagcgaacg
[0062] -LINKER-mCherry-F:
[0063] cttcctggatgttGGAGGTGGAGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGA
[0064] -28a-GB-MC-R:TCGAGTGCGGCCGCAAGCTTTCActtgtacagctcgtccatgc
[0065] 1.2 Preparation of plasmid vector
[0066] The pET28a plasmid was selected as the expression vector (which has a strong promoter and an N-terminal His tag) for protein purification. First, the pET28a plasmid was double-digested with Nde I and Hind III restriction endonucleases (Fermentas, catalog numbers FD0583 and FD0504) to linearize the vector fragment.
[0067] 1.3 Construction of recombinant plasmid
[0068] The gene sequence of GyrA was inserted into the pET28a plasmid to construct pET28a-YFP-GyrA; the D gene sequence of GyrB was inserted into the pET28a plasmid to construct: pET28a-GyrB-mCherry.
[0069] 1.4 Expression and purification of recombinant proteins
[0070] The recombinant plasmids pET28a-YFP-GyrA and pET28a-GyrB-mCherry were transformed into E. coli BL21 (DE3) cells, respectively.
[0071] E. coli was grown in LB medium containing 100 mg / L kanamycin in a shaker at 37°C. The cells were cultured until the OD600 value reached about 0.6, and 0.5 mM IPTG was added to induce the expression of the recombinant protein. Subsequently, the culture temperature was lowered to 16°C and incubated overnight to promote the correct folding and accumulation of the protein.
[0072] The bacteria carrying the recombinant protein were resuspended in buffer A (10 mM sodium phosphate pH 7.6, 150 mM sodium acetate, 0.1 mM magnesium acetate, 0.5 mM DTT, 2.5% glycerol and 10 mM imidazole) and lysed using a Frech Press cell disruptor (JNBIO, China), the lysate was clarified by centrifugation at 12,000 g for 30 min at 4°C, and the supernatant was then incubated with Ni-NTA 6FF agarose beads (Easybio, catalog number BE6947) equilibrated with buffer A for 2 h at 4°C, after which the beads were washed with 15 column volumes (CV) of buffer A containing 20 mM imidazole to remove unbound proteins, and subsequently eluted with buffer A containing 300 mM imidazole to release the target protein.
[0073] The eluted protein was further purified and buffer exchanged by AKTA Purifier 10 chromatography system (GE AKTA Purifier 10, Germany), and component analysis was performed according to the molecular weight exclusion method using Superdex 200Increase 10 / 300GL (Cytiva, catalog number 28990944) or Superdex 75Increase 10 / 300GL (Cytiva, catalog number 29148721) columns. These columns were run in buffer A without imidazole to collect pure, non-aggregated proteins for subsequent applications. The proteins were concentrated using Amicon Ultra-15 centrifugal filters (30 kDa molecular weight cutoff, Millipore, catalog number UFC903024).
[0074] 1.5 Verification of aggregate formation ability
[0075] The purified recombinant protein was mixed. Specifically, the mixture contained 0.25 pmol of linearized pUC19 plasmid DNA and 50 pmol of DNA gyrase (composed of 50 pmol of GyrA and GyrB in equal amounts) and placed in a Grace Bio-Labs CoverWell. TM Phase separation was allowed to occur in an imaging chamber (Sigma, catalog number GBL635051). Samples were incubated at 4°C for specific time points before imaging. Samples were visualized using a Leica TCSSP8 STED confocal microscope equipped with a photomultiplier tube (PMT) detector and a 100x oil immersion objective. Fluorophores were excited and detected using the following wavelengths: 488 nm for EGFP, 514 nm for YFP, and 550 nm for mCherry and Cy3. Fluorescence signals were collected using a 6-channel Spectra X LED light source and a Sedat Quad filter set. Photos were taken ( Figure 3), and fluorescence recovery after photobleaching (FRAP) experiments were performed using a Leica TCSSP8 STED confocal laser scanning microscope equipped with Plan-
[0076] A 514 nm argon-ion laser with 20% power was used to photobleach a circular area with a diameter of approximately 2 μm using an Apochromat 100× / 1.4 oil immersion objective ( Figure 4 ).
[0077] Experiments have shown that the FRAP technology can be used to analyze the dynamic changes of DNA gyrase molecular aggregates, and the results show that the aggregates formed by GyrA and GyrB exhibit liquid properties.
[0078] Experimental Example 2: Potential Assessment of Drug Targets
[0079] In the field of biology, the formation of solid or gel-like phases is often closely related to pathological conditions, such as amyloid fibrils in degenerative diseases and cancers. The appearance of abnormal phases not only interferes with normal physiological processes in cells, but may also directly lead to loss of cell function and even cell death. Inspired by this, the present invention further verifies the molecular condensate solidification phenomenon of DNA gyrase and explores its potential impact on bacterial growth dynamics.
[0080] 1.1 Bioinformatics prediction
[0081] The aggregation tendency of proteins was analyzed using the TANGO algorithm. The TANGO algorithm (version tango2_3) was downloaded from http: / / tango.embl.de / TANGO. The parameters were set as follows: C-terminal protection, N-terminal protection, temperature set to 298 Kelvin, pH value of 7.6, and salt concentration of 150 mM. These conditions were consistent with the experimental conditions of the purified DNA gyrase protein. Specifically, fragments containing more than 5 consecutive amino acid residues and with a score of more than 5% were marked as potential aggregation regions. The prediction results of the TANGO algorithm showed that the sequences of the DNA gyrase GyrA and GyrB subunits contained regions with higher aggregation risk ( Figure 5 ).
[0082] 1.2 Experimental Verification
[0083] 1.2.1 Solid-state transformation of DNA helicase condensates
[0084] Purified recombinant proteins were mixed, specifically the mixture contained 0.25 pmol of linearized pUC19 plasmid DNA and 50 pmol of DNA gyrase [composed of 50 pmol of GyrA and GyrB in equal amounts] and 50 pmol of a truncated form of DNA gyrase interacting protein (A0QSY0). The 1.5 condensate formation ability detection method was used to show that the liquid condensate of DNA gyrase was converted into a fibrous state. The FRAP technology was used to analyze the dynamic changes of the condensate of DNA gyrase molecules. The results showed that these condensates exhibited non-liquid properties ( Figure 6 ).
[0085] To examine the morphological features of protein / peptide aggregates, transmission electron microscopy (TEM) was used. The mixture was diluted 100 times and then the diluted sample was smeared on a carbon-coated Formvar grid (Beijing Zhongjing Technology, catalog number BZ11022) and incubated at room temperature for 1 min. To ensure optimal visual effects, the sample was rinsed twice with sterile, autoclaved distilled water to remove any excess or unbound material, followed by staining with 1% (w / v) uranyl acetate solution for 1 min to enhance contrast and completely dried.
[0086] For imaging, the prepared grids were placed in a Hitachi HT7800 transmission electron microscope (Japan) and observed at different magnifications. Images were captured using the HT7800 system software. The microscope was operated at an accelerating voltage of 80 kV to obtain a detailed view of the aggregate morphology ( Figure 7 ), using electron microscopy technology to show the fibrous structure formed by DNA gyrase under specific interaction conditions.
[0087] Experimental Example 3: Effect of solid-state DNA gyrase aggregates on bacterial growth
[0088] The method for evaluating the viability of solid DNA gyrase aggregates in mycobacteria by electroporation is as follows: first, the Mycobacterium smegmatis mc2155 strain is cultured to the logarithmic growth phase, and then collected and prepared as electroporation competent cells. The competent cells and the truncated version encoding the DNA gyrase interacting protein (A0QSY0) are cloned into the pMV261-L5 plasmid, named Target plasmid or empty plasmid pMV261-L5, and 100 ng of the plasmid is electroporated under 2500 V voltage and 5 ms pulse conditions. Subsequently, the electroporated cells are placed in 7H9 medium containing 0.05% Tween 80 and incubated at 37°C for 4 hours to recover. After recovery, the cells are inoculated on 7H10 agar plates containing 30 mg / L kanamycin and incubated at 37°C for 3 days. The effect of solid DNA gyrase aggregates on the survival of mycobacteria is evaluated by calculating colony forming units (CFUs). Figure 8 showed that solid-state DNA gyrase condensates reduced bacterial survival.
[0089] Experimental Example 4: Zebrafish model to evaluate the effect of target DNA gyrase liquid aggregates on host bacterial load
[0090] The effect of target DNA gyrase aggregate fixation on host bacterial load was evaluated by zebrafish model. First, zebrafish were raised and managed according to the standards of China Zebrafish Resource Center, and AB wild-type zebrafish were selected as experimental subjects. At the 1- to 4-cell stage of zebrafish embryos, the EGFP-expressing M. marinum strain, the M. marinum strain mixed with PBS or 0.5 mg / mL of the truncated form of DNA gyrase interacting protein (A0QSY0) were injected, and each embryo was inoculated with 200-300 CFU. The embryos were incubated in embryo culture water at 28.5°C. From 1 day after fertilization, 0.003% 1-phenylethanol-2-thiourea (PTU) was added to inhibit pigment production. After 72 hours of infection, the embryos were microscopically imaged using Z-axis stack scanning technology, and the fluorescence signals were quantified and analyzed using ImageJ software. Fig. 9 The evaluation showed that DNA gyrase aggregates acted as targeted drug targets and significantly reduced the host's bacterial load.
[0091] Through bioinformatics and experimental verification, it was revealed that the mycobacterial DNA gyrase GyrA and GyrB subunits have the potential to form biocondensates and demonstrate their potential as drug targets.
[0092] The embodiments of the present invention are described in detail above with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge scope of those skilled in the art without departing from the spirit of the present invention.
Claims
1. A tuberculosis therapeutic drug target based on mycobacterial DNA gyrase aggregates, characterized in that: Condensates containing the GyrA and GyrB subunits of mycobacterial DNA gyrase as active ingredients.
2. The tuberculosis therapeutic drug target based on mycobacterial DNA gyrase aggregates according to claim 1, characterized in that: Agglomerates have liquid properties and can be transformed into solid or fibrous states under certain conditions.
3. The tuberculosis therapeutic drug target based on mycobacterial DNA gyrase aggregates according to claim 2, characterized in that: This drug target works by interfering with the mycobacterial DNA replication and repair machinery.
4. Use of the tuberculosis therapeutic drug target based on mycobacterial DNA gyrase aggregates according to claim 3 in drugs for treating tuberculosis.
5. The tuberculosis treatment drug based on mycobacterial DNA gyrase aggregates according to claim 4, characterized in that: The design ideas are as follows: S1: GyrA and GyrB subunits were separated by biochemical methods and induced to form liquid condensates under in vitro conditions; S2: Study the stability and transformation characteristics of the coacervates at different pH values, temperatures and ionic strengths; S3: Screen and synthesize a series of drug candidates to target the condensates of GyrA and GyrB subunits and evaluate their anti-TB activity.