Bladder cancer miRNA marker and application thereof

Abstract

The invention discloses a bladder cancer miRNA marker and application thereof, the bladder cancer miRNA marker is miRNA-12124 and can be used for judging whether bladder cancer is metastatic or not or pre-judging the bladder cancer metastasis risk; the invention further provides application of the bladder cancer marker miRNA-12124 in preparation of a bladder cancer detection reagent and application of the bladder cancer marker miRNA-12124 in preparation of a medicine for inhibiting bladder cancer metastasis. The invention provides a new diagnosis method for clinical diagnosis of bladder cancer metastasis at a molecular level, and provides a new drug target for gene therapy of bladder cancer metastasis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and relates to a bladder cancer miRNA marker and application thereof, and specifically relates to a miRNA-12124 marker associated with bladder cancer metastasis and application thereof. Background Art

[0002] Bladder cancer is mainly divided into non-muscle invasive bladder cancer (NMIBC) and muscle invasive bladder cancer (MIBC), of which NMIBC accounts for a larger proportion, but MIBC is more aggressive and has a relatively poor prognosis. According to the 2020 Global Cancer Statistics Report, there are approximately 573,000 new cases of bladder cancer and 213,000 deaths each year. The metastasis of bladder cancer usually first affects the lymph nodes and may then metastasize to distant organs such as the lungs, liver, and bones. The occurrence of metastasis significantly affects the patient's prognosis and survival rate. The early symptoms of bladder cancer may not be obvious or similar to other urinary system diseases, making diagnosis difficult. Commonly used diagnostic methods include urine cytology, cystoscopy, and imaging examinations.

[0003] miRNA is a class of small RNA molecules that can regulate gene expression. In bladder cancer, abnormal expression levels of specific miRNAs may play a role in the occurrence, development, invasion and metastasis of tumors. Studying these miRNAs will help us understand the molecular mechanisms of bladder cancer and may provide new biomarkers for diagnosis and treatment. In future clinical treatments, miRNAs can not only become new markers for early diagnosis of bladder cancer and related to cancer progression, but also have the potential to treat diseases such as bladder cancer by changing the expression of miRNAs or the expression of their target genes. Finding and identifying miRNAs and their target genes related to the occurrence of bladder cancer will provide a basis for the use of miRNAs in clinical treatment. Summary of the invention

[0004] Based on the existing technology, the purpose of the present invention is to provide a bladder cancer miRNA marker for predicting the risk of bladder cancer metastasis, diagnosing whether bladder cancer metastasis has occurred, and judging whether bladder cancer metastasis has recurred, as well as the specific application of the bladder cancer miRNA marker.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides a bladder cancer miRNA marker, characterized in that the bladder cancer miRNA marker is miRNA-12124, the miRNA-12124 is significantly overexpressed in bladder cancer metastasis tissue, and its nucleotide sequence is shown in SEQ ID NO: 1; the miRNA-12124 is selected from at least one of the following miRNAs: miRNA-12124 initial miRNA, miRNA-12124 precursor miRNA, mature miRNA-12124; the miRNA-12124 initial miRNA can be cleaved in human cells and express mature miRNA-12124; the miRNA-12124 precursor miRNA can be cleaved in human cells and express mature miRNA-12124.

[0006] It should be understood that the miRNA-12124 of the present invention includes functional equivalents of the constituent nucleic acid molecules, ie variants, which exhibit the same function as the complete miRNA-12124 nucleic acid molecules, although they are mutated by deletion, substitution or insertion of nucleotide residues.

[0007] It is well known to those skilled in the art that, in order to ensure the stability of miRNA, protective bases such as TT can be added to one or both ends of miRNA, and the miRNA bases can also be modified without affecting the function of miRNA. Therefore, it is well known to those skilled in the art that, under the condition that the function of miRNA-12124 is not affected, the sequence obtained by base modification of miRNA-12124 or adding bases to both ends is also included in the protection scope of the present invention.

[0008] In the specific embodiments provided by the present invention, the miRNA-12124 used is mature miRNA-12124. Although mature miRNA-12124 is used in some specific embodiments, those skilled in the art can expect that the initial miRNA (pi-miRNA-12124) and the precursor miRNA (pre-miRNA-12124) will be able to obtain the same technical effects as the mature miRNA-12124, because the cell has the ability to further process the initial miRNA (pi-miRNA-12124) and the precursor miRNA (pre-miRNA-12124) into mature miRNA-12124.

[0009] The miRNA-12124 nucleic acid molecule of the present invention can exist in the form of single strand or double strand. The mature miRNA-12124 is mainly in the form of single strand, while the miRNA-12124 precursor is partially self-complementary to form a double strand structure. The nucleic acid molecule of the present invention can be in the form of RNA, DNA, PNA, LNA.

[0010] The miRNA-12124 of the present invention can be natural or artificially synthesized, or obtained by transfecting cells with a vector that can express a DNA fragment of miRNA-12124; the vector includes a viral vector and a eukaryotic vector.

[0011] The viral vector may be any suitable vector, including but not limited to a retroviral vector, a herpes virus (eg, herpes simplex virus, vaccinia virus, and Epstein-Barr virus) vector, an adenoviral vector, an adeno-associated virus vector, and an alphavirus vector.

[0012] The eukaryotic expression vector can be any appropriate expression vector, including but not limited to pCMV-Myc expression vector, pEGFP expression vector, pCDNA3.0 expression vector, pTet expression vector, pTRE expression vector, pEF Bos expression vector, or a vector modified based on a known expression vector, such as pET-21a, pCAMBIA1301, etc.

[0013] The DNA fragment that can express miRNA-12124 can be obtained in the following way: search for the location and specific sequence information of miRNA-12124 on the genome from the miRNA database (https: / / www.ncbi.nlm.nih.gov / gene / ), determine the location of the initial miRNA of miRNA-12124 based on the genome sequence, design specific primers within the range of 500-800bp upstream and downstream of the initial miRNA location of miRNA-12124, and amplify the sequence in the middle of the primers to obtain the DNA fragment expressing miRNA-12124.

[0014] The present invention provides an application of a bladder cancer miRNA marker miRNA-12124 in the preparation of a bladder cancer detection reagent. The bladder cancer detection reagent comprises a tailing reverse transcription reagent and a QPCR reaction reagent. The tailing reverse transcription reagent contains a miRNA-12124 reverse transcription specific primer having a nucleotide sequence as shown in SEQ ID NO: 2; the QPCR reaction reagent contains forward and reverse primers and a probe of the marker miRNA-12124, which are used for quantitatively detecting the expression level of the marker miRNA-12124 in a sample. The nucleotide sequence of the miRNA-12124 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12124 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miR-12124 probe is shown in SEQ ID NO: 5.

[0015] The present invention also provides the use of bladder cancer miRNA marker miRNA-12124 in the preparation of a bladder cancer detection kit, characterized in that the kit contains a tailing reverse transcription reagent and a QPCR reaction reagent, the tailing reverse transcription reagent includes: PolyA polymerase, ATP, dNTPs, reverse transcriptase, miRNA-12124 reverse transcription specific primer and enzyme-free water, wherein the nucleotide sequence of the miRNA-12124 reverse transcription specific primer is as shown in SEQ ID NO: 2; The QPCR reaction reagents include: 10×Buffer, dNTPs, MgCl 2 , DNA Taq polymerase, enzyme-free water, forward and reverse primers and probes of miRNA-12124, and forward and reverse primers and probes of internal reference genes, wherein the nucleotide sequence of the miRNA-12124 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12124 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miR-12124 probe is shown in SEQ ID NO: 5.

[0016] The application of miRNA-12124 of the present invention in the preparation of a chip for predicting the risk of bladder cancer metastasis, diagnosing whether bladder cancer metastasis has occurred, and judging whether bladder cancer metastasis has recurred is characterized in that the chip includes a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, and the oligonucleotide probe specifically corresponds to part or all of the sequence of miRNA-12124.

[0017] The experiment of the present invention proves that the level of miRNA-12124 in the bladder cancer tissue that has metastasized is significantly higher than the level of miRNA-12124 in the bladder cancer tissue that has not metastasized. After the test sample is tested using the bladder cancer detection reagent provided by the present invention or the chip for predicting the risk of bladder cancer metastasis, diagnosing whether bladder cancer has metastasized, and judging whether bladder cancer metastasis has recurred, if the level of miRNA-12124 in the bladder cancer tissue of the subject is significantly increased compared with the level of miRNA-12124 in the bladder cancer tissue that has not metastasized, then it can be judged that the risk of bladder cancer cell metastasis in the subject is high or has already metastasized, thereby taking a plan to prevent bladder cancer cell metastasis or providing a diagnostic basis for the formulation of a clinical treatment plan. If the level of miRNA-12124 in the bladder cancer tissue of the subject is significantly increased compared with the level of miRNA-12124 in the bladder cancer tissue that has not metastasized, it indicates that the bladder cancer cells of the subject have metastasized again.

[0018] The experiments of the present invention prove that miRNA-12124 is related to the metastasis of bladder cancer. On this basis, inhibiting the expression of miRNA-12124 can be used to inhibit the metastasis and invasion of bladder cancer or reduce the risk of bladder cancer metastasis and invasion. Based on this, the present invention also provides the use of miRNA-12124 inhibitors in the preparation of drugs for inhibiting bladder cancer metastasis.

[0019] The present invention provides the use of the marker miRNA-12124 in the preparation of a drug for inhibiting bladder cancer metastasis, characterized in that the drug contains a miRNA-12124 inhibitor, which can inhibit the expression of miRNA-12124 or inhibit the function of miRNA-12124, thereby inhibiting the metastasis and invasion of bladder cancer. The inhibition target of the miRNA-12124 inhibitor is not limited to miRNA-12124 itself, but also includes the upstream and downstream of miRNA-12124, including the genomic sequence encoding miRNA-12124, the miRNA-12124 target gene, and the protein or gene that regulates miRNA-12124.

[0020] The miRNA-12124 inhibitor is selected from: siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that can reduce the expression of miRNA-12124; or constructs or small molecule compounds that can express or form the above-mentioned siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that reduce the expression of miRNA-12124.

[0021] Preferably, the miRNA-12124 inhibitor is an antisense oligonucleotide of miRNA-12124 or a mimic of an antisense oligonucleotide of miRNA-12124.

[0022] Antisense oligonucleotides can be easily designed based on the miRNA-12124 sequence. After the antisense oligonucleotides are transferred into the human body, they can significantly downregulate the expression of miRNA-12124. "Antisense oligonucleotides (AONs)" are also called "antisense nucleotides", which refer to DNA molecules or RNA molecules or their analogs with a length of about 18-26nt (more specifically about 19-22nt).

[0023] In the present invention, the "antisense oligonucleotide" also includes modified antisense nucleotides obtained by means such as nucleic acid lock or nucleic acid chain backbone modification technology, and the modification does not substantially change the activity of the antisense oligonucleotide. More preferably, the modification can improve the stability, activity or therapeutic effect of the antisense oligonucleotide. Locked nucleic acid (LNA) generally refers to a modification technology that connects the 2' oxygen atom and the 4' carbon atom of ribose through a methylene bridge. Antisense drugs developed based on nucleic acid chain backbone modification technology have greatly improved solubility, resistance to nuclease degradation, etc., and are easy to synthesize in large quantities. There are many methods for modifying the backbone of oligonucleotides, including the thio method, such as thio-modifying the deoxynucleotide chain into a thio-deoxynucleotide chain. This method is to replace the oxygen atom of the phosphate bond on the DNA backbone with a sulfur atom, which can resist nuclease degradation. It should be understood that any modification that can maintain most or all of the activity of the antisense oligonucleotide is included in the present invention.

[0024] Furthermore, the present invention provides a drug for inhibiting bladder cancer metastasis, characterized in that the drug contains a miRNA-12124 inhibitor and a pharmaceutically acceptable carrier.

[0025] The carrier includes, but is not limited to, a diluent, a buffer, a suspension, an emulsion, a granule, an encapsulation agent, an excipient, a filler, an adhesive, a spray, a transdermal absorbent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent or an adsorption carrier.

[0026] The drug for inhibiting bladder cancer metastasis can be prepared into but not limited to microinjection, dosage form suitable for transfection, injection, tablet, powder, granule, capsule. The above-mentioned various dosage forms of drugs can be prepared according to conventional methods in the pharmaceutical field.

[0027] The drug for inhibiting bladder cancer metastasis can be administered alone or in combination with other drugs capable of inhibiting bladder cancer metastasis.

[0028] The drug for inhibiting bladder cancer metastasis can be administered ex vivo: miRNA-12124 or an expression vector of miRNA-12124 is introduced or transfected into human autologous or allogeneic cells (or xenogeneic cells) in vitro, and then injected back into the human body after in vitro cell amplification.

[0029] The drug for inhibiting bladder cancer metastasis can be administered in vivo: miRNA-12124 or an expression vector of miRNA-12124 is directly introduced into the body. Such a vector can be viral or non-viral, or even naked DNA or RNA.

[0030] The subject can be a human or other mammal. More specifically, the subject is an organ, tissue, or cell.

[0031] The bladder cancer miRNA-12124 marker and its application provided by the present invention not only provide a new diagnostic method for the diagnosis of bladder cancer metastasis at the molecular level and provide important guidance for clinical treatment, but also provide a new drug target for gene therapy of bladder cancer metastasis, which is expected to significantly improve the treatment effect and survival rate of bladder cancer patients, and has broad clinical value and market prospects in practical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Shows the expression of miRNA-12124 in bladder cancer tissues detected by QPCR: Figure 2 Shows the expression of miRNA-12124 in bladder cancer cell lines detected by QPCR; Figure 3 Showing the inhibitory effect of anti-miRNA-12124 on miRNA-12124 expression. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with specific examples. The examples of the present invention are only used to explain the present invention and are not intended to limit the protection scope of the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] The nucleotide sequences involved in the present invention are shown in Table 1 below.

[0037] Table 1 - Nucleotide sequence listing name Sequence (5'—3') SEQ ID NO miRNA-12124 GAGGAAATGCAGATGCTGGA SEQ ID NO: 1 miR-12124 reverse transcription specific primers CAGTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTVN SEQ ID NO: 2 miR-12124 F TTGAGGAAATGCAGATGC SEQ ID NO: 3 miR-12124 R CAGTGCAGGGTCCGAGGT SEQ ID NO: 4 miR-12124 probe TGCCCAGGTGGCT SEQ ID NO: 5 snRNA U6 F CTCGCTTCGGCAGCACA SEQ ID NO: 6 snRNA U6 R CAGTGCAGGGTCCGAGGT SEQ ID NO: 7 snRNA U6 probe TGCCCAGGTGGCT SEQ ID NO: 8 anti-miRNA-12124 TCCAGCATCTGCATTTCCTC SEQ ID NO: 9 Example 1 Screening of miRNAs associated with bladder cancer metastasis

[0038] 1. Experimental samples: 26 bladder cancer tissues, including 13 bladder cancer samples with metastasis and 13 bladder cancer samples without metastasis.

[0039] Sample acquisition: The above samples are surgical resection specimens of bladder cancer patients, which come from Qilu Hospital of Shandong University and Affiliated Hospital of Qingdao University. The acquisition of all the above specimens has been approved by the Organization Ethics Committee. The clinical data of tissue samples include: gender, age, tumor size, pathological grade, metastasis, recurrence, etc.

[0040] 2. Extraction of total RNA from bladder cancer tissue Add 1 mL Trizo1 to every 100 mg of tissue and grind the tissue block thoroughly with liquid nitrogen. Add about 1 / 5 volume of chloroform, mix thoroughly by inverting for about 1 minute, and let stand at room temperature for 5 minutes. Centrifuge at 4°C, 12,000 rpm for 15 minutes, carefully transfer the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, gently invert and mix, and let stand at room temperature for 10 minutes. Centrifuge at 4°C, 12,000 rpm for 10 minutes, remove the supernatant, add 1 / 2 volume of 70% ethanol to the precipitate, and wash the precipitate by centrifugation at 4°C, 12,000 rpm for 5 minutes. Remove the supernatant, dry the precipitate at room temperature, add an appropriate amount of RNase-free water to fully dissolve it, and measure the OD260 and OD280 values. Use RNase-free DNase I treatment and QIAGEN RNeasy kit to purify total RNA. For detailed operation principles and methods, please refer to the kit manual. The quality of total RNA was evaluated by agarose gel electrophoresis, and the gel imager was used to observe and photograph the RNA and save the image. It is generally believed that 28S:18S>2 can be used to preliminarily determine that the quality of total RNA is good.

[0041] 3. Extraction and labeling of miRNA 3.1 The miRNA was extracted using the miRNAs extraction kit of Ambion Company. The specific operation was carried out according to the corresponding instructions. The sample was labeled with T4 RNA ligase according to the Thomson method. The miRNA labeling method was as follows: 2 μg miRNA and 500 ng 5'-phosphate-cytosine-uracil cy3-3' (Novoprotein, Beijing, China) and 2 units of T4 RNA ligase (Novoprotein, Beijing, China), incubated at 4°C for 2 hours. Each miRNA sample was set with an equal amount of corresponding negative control.

[0042] 3.2 The labeled RNA was precipitated with 0.3 M sodium acetate and 2.5 volumes of ethanol, and then resuspended with 15 μL of hybridization solution containing 3× SSC, 0.2% SDS and 15% formamide. All hybridizations were repeated twice, and LifterSlipTM (Erie, PA USA) was used for hybridization to ensure that the hybridization solution flowed evenly between the chip and the cover slip.

[0043] 3.3 Place the hybridization chamber on the hybridizer BioMixerTMII (CapitalBio Corp, Beijing, China) and hybridize overnight in a 42°C water bath, then wash twice with washing solution.

[0044] 4. miRNA chip operation: The miRNA chip was produced by Biobio Biotech Co., Ltd. and the miRNA expression profile was detected according to the instructions of the manual.

[0045] 5. miRNA screening results: Analysis of the results of the miRNA chip expression profile showed that there was a significant difference in the expression of miRNA-12124 in bladder cancer tissues that had metastasized and in bladder cancer tissues that had not metastasized. Compared with bladder cancer tissues that had not metastasized, the level of miRNA-12124 in bladder cancer tissues that had metastasized was significantly increased by about 4 times. The nucleotide sequence of miRNA-12124 is shown in SEQ ID NO.1.

[0046] Example 2 QPCR detection and verification of differentially expressed miRNA-12124 1. Select miRNA-12124 for large sample QPCR validation based on the detection results of miRNA chip. According to the sample collection method in Example 1, 80 cases of metastatic bladder cancer tissues and 80 cases of non-metastatic bladder cancer tissues were selected.

[0047] 2. The RNA extraction process is the same as in Example 1.

[0048] 3. Tailing reverse transcription The tailing reverse transcription reagent includes: PolyA polymerase, ATP, dNTPs, reverse transcriptase, miRNA-12124 reverse transcription specific primer, and enzyme-free water; the nucleotide sequence of the specially designed miRNA-12124 reverse transcription specific primer is shown in SEQ ID NO:2.

[0049] The reagents prepared in this experiment are as follows: 10×Poly (A) Polymerase Buffer, E. coli Poly (A) Polymerase (5U / μl), ATP (10mM), dNTP Mix (10μM), HiScript Ⅱ Reverse Transcriptase (200U / μL), RNase inhibitor (40μM), miRNA-12124 reverse transcription specific primer (5μM), RNase-free ddH 2 O.

[0050] Tailing reverse transcription reaction: 100pg-1μg RNA template and 2μL 10×Poly (A) Polymerase Buffer, 0.5μL E.coli Poly (A) Polymerase (5U / μl), 1μL ATP (10mM), 1μL dNTP Mix (10μM), 1μL HiScript Ⅱ Reverse Transcriptase (200U / μL), 1μL RNase inhibitor (40μM), 1μL miRNA-12124 reverse transcription specific primer (5μM), RNase-free ddH 2 O to 20 μL, mix well, and place in a gene amplification instrument for tailing and reverse transcription. The reaction conditions are 42°C, 60 min; 85°C, 5 min; 4°C, forever.

[0051] 4. QPCR reaction: QPCR reaction reagents include: 10×Buffer, dNTPs, MgCl 2 , DNA Taq polymerase, enzyme-free water, forward and reverse primers and probes of miRNA-12124, and forward and reverse primers and probes of internal reference genes.

[0052] The reagents prepared for this experiment are as follows: 2×TaqMan miX, forward primer, reverse primer, template cDNA, and enzyme-free water.

[0053] Among them, 2×TaqMan miX contains 10×Buffer, DNA Taq polymerase, MgCl 2 , dNTPs, miR-12124 probe and internal reference gene probe; the forward primer contains miRNA-12124 forward primer and internal reference gene forward primer, and the reverse primer contains miRNA-12124 reverse primer and internal reference gene reverse primer.

[0054] QPCR reaction: A 20 μL reaction system was used, and 3 parallel tubes were set for each sample. All amplification reactions were repeated more than three times to ensure the reliability of the results. The following reaction system was prepared: 2×TaqMan miX 10 μL, forward primer (5 μM / mL) 1 μL, reverse primer (5 μM / mL) 1 μL, template cDNA 2.0 μL, enzyme-free water 6 μL. All operations were performed on ice. The amplification program was: 95°C, 10 min (95°C, 20 s; 60°C, 55 s) * 45 cycles. The TaqMan probe was used as a fluorescent marker, and the PCR reaction was performed on an ABI7500 real-time fluorescence quantitative PCR instrument.

[0055] In the above QPCR reaction, snRNA U6 was selected as the internal reference gene.

[0056] The nucleotide sequences of the forward and reverse primers, probes of the marker miRNA-12124, and the forward and reverse primers, probes of the internal reference gene snRNA U6 involved in the above QPCR reaction system are as follows: The nucleotide sequence of miRNA-12124 forward primer miR-12124 F is shown in SEQ ID NO: 3; The nucleotide sequence of miRNA-12124 reverse primer miR-12124 R is shown in SEQ ID NO: 4; The nucleotide sequence of the miR-12124 probe is shown in SEQ ID NO: 5; The nucleotide sequence of snRNA U6 F is shown in SEQ ID NO: 6; The nucleotide sequence of snRNA U6 R is shown in SEQ ID NO: 7; The nucleotide sequence of the snRNA U6 probe is shown in SEQ ID NO:8.

[0057] The marker miRNA-12124 was relatively quantified by amplification curve analysis and the △CT method.

[0058] 5. Result verification The expression of miRNA-12124 in bladder cancer tissues was detected by QPCR. Figure 1 As shown, compared with bladder cancer tissues without metastasis, the expression level of miRNA-12124 in bladder cancer tissues with metastasis was significantly increased, which was consistent with the results of miRNA chip screening.

[0059] Based on the bladder cancer miRNA marker miRNA-12124, the present invention provides an application of the bladder cancer miRNA marker miRNA-12124 in the preparation of a bladder cancer detection reagent, wherein the bladder cancer detection reagent comprises a tailing reverse transcription reagent and a QPCR reaction reagent, wherein the tailing reverse transcription reagent contains a miRNA-12124 reverse transcription specific primer, and the nucleotide sequence of the miRNA-12124 reverse transcription specific primer is shown in SEQ ID NO: 2; the QPCR reaction reagent contains forward and reverse primers and a probe of the marker miRNA-12124, which are used for quantitatively detecting the expression level of the marker miRNA-12124 in a sample, wherein the nucleotide sequence of the miRNA-12124 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12124 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miR-12124 probe is shown in SEQ ID NO: 5.

[0060] The above-mentioned tailing reverse transcription reagent and QPCR reaction reagent used for QPCR quantitative detection of the marker miRNA-12124 in the present invention can be placed in a kit for easy detection and use.

[0061] The QPCR reaction reagent in the kit can detect the expression level of miRNA-12124 in the bladder cancer tissue of the subject. The detection result is compared with the expression level of miRNA-12124 in the bladder cancer tissue without metastasis. If the expression level of the miRNA-12124 in the bladder cancer tissue is significantly increased, it is judged that the risk of bladder cancer metastasis of the subject is high, or metastasis has occurred, or metastasis has recurred.

[0062] Example 3 Expression of miRNA-12124 in bladder cancer cell lines 1. Cell culture Bladder cancer cell lines T24, RT4, J82, and 5637 were cultured in RPMI1640 medium and 10% fetal bovine serum, and human normal bladder epithelial cell line SV-HUC-1 was cultured in DMEM medium and 10% fetal bovine serum at 37°C and 5% CO. 2 incubator.

[0063] 2. QPCR detection 2.1 Extraction of total cell RNA: Total cell RNA was extracted using the RNA extraction kit from QINGEN according to the instructions.

[0064] 2.2 QPCR detection: The steps are the same as in Example 2.

[0065] 3. Results Analysis like Figure 2 As shown, compared with the human normal bladder epithelial cell line SV-HUC-1, the expression of miRNA-12124 in bladder cancer cell lines T24, RT4, J82, and 5637 was significantly increased (P<0.05).

[0066] The experiments in Examples 1-3 indicate that the marker miRNA-12124 provided by the present invention can be used as a bladder cancer miRNA marker for predicting the risk of bladder cancer metastasis, diagnosing whether bladder cancer metastasis has occurred, and determining whether bladder cancer metastasis has recurred.

[0067] Example 4 Study on the effect of miRNA-12124 on the adhesion ability of bladder cancer cells 1. Design and synthesize antisense oligonucleotides targeting miRNA-12124, namely anti-miRNA-12124.

[0068] The sequence information of miRNA-12124 was found in the miRNA database (https: / / www.ncbi.nlm.nih.gov / gene / ), and anti-miRNA-12124 and random control sequences were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. based on the sequence of miRNA-12124.

[0069] anti-miRNA-12124: 5'-TCCAGCATCTGCATTTCCTC-3', SEQ ID NO: 9; 2. Cell culture: The T24 culture method is the same as in Example 3.

[0070] 3. Cell transfection T24 cells were divided into two groups, namely, negative control group (anti-NC inhibitor) and miRNA-12124 inhibition group (anti-miRNA-12124). The negative control group and inhibition group were transfected with anti-NC inhibitor and anti-miRNA-12124, respectively, using the transfection reagent LipofectamineTM 2000 for transfection. The transfection method was referred to the instruction manual. The working concentrations of anti-NC inhibitor and anti-miRNA-12124 were both 5mM. Cells in each group were collected 48h after transfection for subsequent experiments.

[0071] 4. QPCR detection experiment The steps of total cell RNA extraction and PCR were the same as those in Example 3.

[0072] The results are as follows Figure 3As shown, compared with the negative control group (anti-NC inhibitor), the level of miRNA-12124 in the miRNA-12124 inhibition group (anti-miRNA-12124) was significantly decreased, indicating that anti-miRNA-12124 can effectively inhibit the expression of miRNA-12124.

[0073] 5. Cell Adhesion Assay T24 cells transfected for 48 hours were digested with 0.25% trypsin to form a cell suspension. 4 100 μg / mL was inoculated into a 96-well cell culture plate, 0.1 mL per well. After 60 minutes, non-adherent cells were washed away with PBS at 37°C, and the light absorption value of each well at 490 nm was measured by MTT method. The light absorption value represents the relative number of adherent living cells.

[0074] 6. Results The relative optical density of the miRNA-12124 inhibition group (anti-miRNA-12124) was 0.224±0.037, and the relative optical density of the negative control group (anti-NC inhibitor) was 1.416±0.113. Compared with the negative control group (anti-NC inhibitor), the light absorption value of the miRNA-12124 inhibition group (anti-miRNA-12124) decreased significantly (P<0.05). The above experimental results show that anti-miRNA-12124 can significantly inhibit the adhesion ability of T24 cells, and also indicate that miRNA-12124 is conducive to the adhesion of T24 cells.

[0075] Example 5 Study on the effect of miRNA-12124 on the migration and invasion ability of bladder cancer cells 1. Cell culture is the same as in Example 4 2. Migration experiment T24 cells transfected for 48 hours were digested with trypsin and counted. 10 cells were placed in a 1.5 mL EP tube, and 200 μL serum-free medium was added to resuspend the cells. The cells were added to the transwell chamber, and DMEM medium containing 10% fetal bovine serum was added to the lower chamber. The tube was placed at 37°C and 5% CO. 2 Incubate for 24 hours. Take the transwell chamber, wipe the cells inside with a cotton swab, and gently wash away the remaining cells with PBS. After fixation and staining, take 8 random fields of view under a microscope for counting.

[0076] 3. Invasion assay T24 cells transfected for 48 h were digested with trypsin and counted. 10 5Place cells in a 1.5 mL EP tube, add 200 mL serum-free medium to resuspend the cells, add them to the transwell chamber covered with matrix gel, add 10% FBS DMEM medium to the lower chamber, and place at 37°C, 5% CO 2 Incubate for 24 hours. Take the transwell chamber, wipe the cells inside with a cotton swab, and gently wash away the remaining cells with PBS. After fixation and staining, take 8 random fields of view under a microscope for counting.

[0077] 4. Results Migration assay: Compared with the negative control group (anti-NC inhibitor), the number of cells in the miRNA-12124 inhibition group (anti-miRNA-12124) that passed through the basement membrane of the transwell chamber was reduced by 65%.

[0078] Invasion assay: Compared with the negative control group (anti-NC inhibitor), the number of cells in the miRNA-12124 inhibition group (anti-miRNA-12124) that passed through the basement membrane of the transwell chamber covered with matrix gel was reduced by 67%.

[0079] The above experimental results show that anti-miRNA-12124 can significantly inhibit the migration and invasion ability of T24 cells, and also indicate that miRNA-12124 is beneficial to the migration and invasion of T24 cells.

[0080] The experiments in Examples 4 to 5 above provide experimental support for the use of the bladder cancer marker miRNA-12124 provided by the present invention in the preparation of drugs for inhibiting bladder cancer metastasis. The experiments of the present invention prove that miRNA-12124 is related to the metastasis of bladder cancer. On this basis, inhibiting the expression of miRNA-12124 can be used to inhibit the metastasis and invasion of bladder cancer or reduce the risk of bladder cancer metastasis and invasion. On this basis, the present invention provides the use of miRNA-12124 inhibition in the preparation of drugs for inhibiting bladder cancer metastasis, and drugs for inhibiting bladder cancer metastasis. The drug for inhibiting bladder cancer metastasis contains a miRNA-12124 inhibitor, which can inhibit the expression of miRNA-12124 or inhibit the function of miRNA-12124, thereby inhibiting the metastasis and invasion of bladder cancer. The inhibitory targets of the miRNA-12124 inhibitor are not limited to miRNA-12124 itself, but also include the upstream and downstream of miRNA-12124, including the genomic sequence encoding miRNA-12124, miRNA-12124 target genes, and proteins or genes that regulate miRNA-12124.

[0081] The invention provides a new diagnostic method for clinical diagnosis of bladder cancer metastasis at the molecular level, and also provides a new drug target for gene therapy of bladder cancer metastasis.

[0082] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that for ordinary technicians in this field, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A bladder cancer miRNA marker, characterized in that: The bladder cancer miRNA marker is miRNA-12124, which is significantly overexpressed in bladder cancer metastatic tissue, and its nucleotide sequence is shown in SEQ ID NO: 1; the miRNA-12124 is selected from at least one of the following miRNAs: miRNA-12124 initial miRNA, miRNA-12124 precursor miRNA, mature miRNA-12124; the miRNA-12124 initial miRNA can be cleaved in human cells and express mature miRNA-12124; the miRNA-12124 precursor miRNA can be cleaved in human cells and express mature miRNA-12124.

2. Use of the marker miRNA-12124 in the preparation of a bladder cancer detection reagent, characterized in that: The bladder cancer detection reagent comprises a tailing reverse transcription reagent and a QPCR reaction reagent, wherein the tailing reverse transcription reagent contains a miRNA-12124 reverse transcription specific primer having a nucleotide sequence as shown in SEQ ID NO: 2; The QPCR reaction reagent contains forward and reverse primers and a probe of the marker miRNA-12124, which are used to quantitatively detect the expression level of the marker miRNA-12124 in the sample. The nucleotide sequence of the miRNA-12124 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12124 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miR-12124 probe is shown in SEQ ID NO:

5.

3. Use of the marker miRNA-12124 in the preparation of a bladder cancer detection kit, characterized in that: The kit contains a tailing reverse transcription reagent and a QPCR reaction reagent, wherein the tailing reverse transcription reagent includes: PolyA polymerase, ATP, dNTPs, reverse transcriptase, miRNA-12124 reverse transcription specific primer and enzyme-free water, wherein the nucleotide sequence of the miRNA-12124 reverse transcription specific primer is shown in SEQ ID NO: 2; the QPCR reaction reagent includes: 10×Buffer, dNTPs, MgCl2, DNA Taq polymerase, enzyme-free water, forward and reverse primers and probes of miRNA-12124 and forward and reverse primers and probes of internal reference genes, wherein the nucleotide sequence of the miRNA-12124 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12124 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miR-12124 probe is shown in SEQ ID NO:

5.

4. The use of the marker miRNA-12124 in the preparation of a chip for predicting the risk of bladder cancer metastasis, diagnosing whether bladder cancer metastasis has occurred, and judging whether bladder cancer metastasis has recurred, characterized in that: The chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe specifically corresponds to a part or all of the sequence of miRNA-12124.

5. Use of the marker miRNA-12124 in the preparation of a drug for inhibiting bladder cancer metastasis, characterized in that: The drug contains a miRNA-12124 inhibitor, which can inhibit the expression of miRNA-12124 or inhibit the function of miRNA-12124, thereby inhibiting the metastasis and invasion of bladder cancer. The inhibition target of the miRNA-12124 inhibitor is not limited to miRNA-12124 itself, but also includes the upstream and downstream of miRNA-12124, including the genomic sequence encoding miRNA-12124, miRNA-12124 target gene, and protein or gene that regulates miRNA-12124.

6. Use of the marker miRNA-12124 according to claim 5 in the preparation of a drug for inhibiting bladder cancer metastasis, characterized in that: The miRNA-12124 inhibitor is selected from: siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that can reduce the expression of miRNA-12124; or constructs or small molecule compounds that can express or form the above-mentioned siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that reduce the expression of miRNA-12124.

7. A drug for inhibiting bladder cancer metastasis, characterized in that: The drug contains a miRNA-12124 inhibitor and a pharmaceutically acceptable carrier.

Images