TJP1 gene molecular marker related to growth traits of litopenaeus vannamei and application of TJP1 gene molecular marker

Abstract

The invention discloses a TJP1 gene molecular marker related to growth traits of litopenaeus vannamei and application of the TJP1 gene molecular marker, and belongs to the technical field of biology. The molecular marker is an SNP (Single Nucleotide Polymorphism) molecular marker, and the molecular marker is any one of SNP1, SNP2 and SNP3; the SNP1 is located at a 170bp site of a nucleotide sequence as shown in SEQ ID NO.1, and the GG genotype of the SNP1 is a dominant genotype; the SNP2 is located at a 730bp site of a nucleotide sequence as shown in SEQ ID NO.1, and the CC genotype of the SNP2 is a dominant genotype; the SNP3 is located at a 748bp site of a nucleotide sequence as shown in SEQ ID NO. 1, and the AA genotype of the SNP3 is a dominant genotype. The invention provides a theoretical basis for the development of molecular markers related to the growth traits of litopenaeus vannamei.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a TJP1 gene molecular marker related to growth traits of Litopenaeus vannamei and an application thereof. Background Art

[0002] The growth rate of Penaeus vannamei is directly related to the economic benefits of farmers. Cultivating fast-growing shrimp varieties is conducive to increasing aquaculture output and profits and reducing aquaculture costs. Therefore, how to select and breed new varieties of Penaeus vannamei with excellent and stable growth traits is crucial to the long-term development of the aquaculture industry.

[0003] Traditional breeding methods are mainly based on phenotypic selection, which has a long breeding cycle, high investment, and is easily affected by environmental factors, so it is gradually replaced by other methods. At present, molecular marker-assisted breeding has gradually become a new direction for the selection of new aquatic species with its advantages of rapid and accurate selection of economic traits. Among them, SNP, as the third-generation molecular marker, has shown broad application prospects in the selection and breeding of aquatic animals due to its large number, wide distribution, good stability, easy scale and automated detection.

[0004] The TJP1 gene (ZO1 tightjunction protein) belongs to the family of proteins encoding membrane-associated guanylate kinases and is the most common tight junction protein. Studies have shown that it is closely related to intestinal diseases. Currently, research on the functions of the TJP1 gene is mainly conducted on humans, while there are few studies on the vannamei shrimp. Summary of the invention

[0005] The invention provides a TJP1 gene molecular marker related to the growth traits of Penaeus vannamei. The molecular marker is a SNP molecular marker, and the SNP molecular marker is any one of SNP1, SNP2 and SNP3; the SNP1 is located at the 170bp site of the nucleotide sequence shown in SEQ ID NO.1, and the GG genotype of the SNP1 is a dominant genotype; the SNP2 is located at the 730bp site of the nucleotide sequence shown in SEQ ID NO.1, and the CC genotype of the SNP2 is a dominant genotype; the SNP3 is located at the 748bp site of the nucleotide sequence shown in SEQ ID NO.1, and the AA genotype of the SNP3 is a dominant genotype.

[0006] The present invention also provides a product for detecting the above SNP marker, wherein the product contains primers for detecting the above SNP marker.

[0007] Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO.2-3.

[0008] The present invention also provides an application of a reagent for detecting the SNP molecular marker in selective breeding related to growth traits of Penaeus vannamei.

[0009] Preferably, the reagent contains primers with nucleotide sequences as shown in SEQ ID NO.2-3.

[0010] More preferably, the genomic DNA of the tested Litopenaeus vannamei is used as a template, and the genotype of the SNP molecular marker is determined by PCR amplification and sequencing. When the genotype of SNP1 is GG, the individual is selected as a reserve parent for breeding; when the genotype of SNP2 is CC, the individual is selected as a reserve parent for breeding; when the genotype of SNP3 is AA, the individual is selected as a reserve parent for breeding; when the haplotype combination genotype of SNP1, SNP2 and SNP3 is GG CC AA, the individual is selected as a reserve parent for breeding.

[0011] More preferably, the method further comprises a process of extracting genomic DNA of the tested Litopenaeus vannamei.

[0012] More preferably, the PCR amplification system is:

[0013] ddH2O 8.5μL; 2×Accurate Taq premix 12.5μL; 10mM upstream primer 1μL; 10mM downstream primer 1μL; DNA template 2μL.

[0014] More preferably, the PCR amplification reaction is programmed as follows:

[0015] a. Pre-denaturation at 94°C for 10 min; b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 59°C for 1 min, and extension at 72°C for 1 min; c. Final extension at 72°C for 10 min.

[0016] The present invention also provides a method for screening Penaeus vannamei with excellent growth traits, the method comprising the following steps: using primers to detect the genotype of the molecular marker, and then screening the dominant population according to the genotype.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention uses Sanger sequencing technology to detect the genotype of three SNP sites and a haploid domain located on the TJP1 gene, thereby achieving the purpose of early breeding of Penaeus vannamei individuals with excellent growth traits. The method can accelerate the breeding process of Penaeus vannamei growth traits and reduce breeding costs. It provides a theoretical basis for improving the growth traits of Penaeus vannamei. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis diagram of the PCR product of the TJP1 gene of Penaeus vannamei in Example 1; M: DL1000 DNAMaker.

[0020] Figure 2 These are the three genotypes of the SNP1 site on the TJP1 gene of Penaeus vannamei in Example 2: GG, GA and AA.

[0021] Figure 3 These are three genotypes of the SNP2 site on the TJP1 gene of Penaeus vannamei in Example 2: CC, CG and GG.

[0022] Figure 4 These are the three genotypes of the SNP3 site on the TJP1 gene of Litopenaeus vannamei in Example 2: AA, AT and TT.

[0023] Figure 5 This is the linkage disequilibrium analysis result of the three SNPs loci of the TJP1 gene of Penaeus vannamei in Example 2. DETAILED DESCRIPTION

[0024] Example 1 Mining of SNP sites related to growth traits of Litopenaeus vannamei TJP1 gene

[0025] 1. Collection of phenotypic data related to growth traits of Litopenaeus vannamei

[0026] The experimental Penaeus vannamei shrimp used in this example was from Fujian Dongfang Liyang Seedling Breeding Co., Ltd. A fast-growing family (Q1) and a slow-growing family (S1) were selected from the breeding base group based on the breeding data over the years. The breeding time, breeding environment and feeding conditions of the two families were the same. 50 Penaeus vannamei shrimp were randomly selected from the two families, and the growth indicators such as weight (g), total length (cm), body length (cm), carapace length (cm) and meat yield (%) of each Penaeus vannamei shrimp were collected.

[0027] 2. Obtaining genomic DNA of Penaeus vannamei

[0028] After the collection of the indicators described in step 1 was completed, the muscle tissue of each Penaeus vannamei was cut, and the genomic DNA of each shrimp was extracted using a marine animal tissue DNA extraction kit (Beijing Tiangen) and stored at -80°C.

[0029] 3. PCR amplification and sequencing of the TJP1 gene in a mixed pool of Penaeus vannamei

[0030] The genomic DNAs of the 100 Penaeus vannamei shrimps described in step 2 were prepared into a DNA mixed pool sample, that is, 1 μL of the DNA sample from each shrimp was taken out for mixing.

[0031] The base sequence of the TJP1 gene of Penaeus vannamei was found on the NCBI website (Gene symbol: LOC113824346), and the following primers (as shown in Table 1) were designed using Primer Premier 5.0 software. The primers were synthesized by Guangzhou Tianyi Huiyuan Biotechnology Co., Ltd.

[0032] Table 1 Primer sequences

[0033]

[0034] The DNA pool sample was used as a template, and the above primer pairs were used as upstream and downstream primers for PCR amplification of the TJP1 gene. The system (25 μL) of the PCR amplification reaction was composed of: 8.5 μL of ddH2O; 12.5 μL of 2×Accurate Taq premix; 1 μL of 10 mM upstream primer; 1 μL of 10 mM downstream primer; 2 μL of DNA template. The program of the PCR amplification reaction was set as follows: a. 94°C pre-denaturation for 10 min; b. 35 cycles of chain reaction, including: 94°C denaturation for 1 min, 59°C annealing for 1 min, 72°C extension for 1 min; c. 72°C final extension for 10 min. After the PCR product passed the quality inspection, Sanger sequencing was performed, and SeqMan software was used to observe whether there were overlapping peaks in the sequencing peak graph.

[0035] 4. Screening of SNP sites in the TJP1 gene of Litopenaeus vannamei

[0036] Observing the sequencing results of step 3, three overlapping peaks were found in this mixed pool sequencing, that is, there were three SNP sites in total.

[0037] The first overlapping peak is located at the 170 bp site of the nucleotide sequence shown in SEQ ID NO.1, located at the 35th base on the 17-18 intron of the TJP1 gene, where G mutated to A, i.e., I(17-18)-35, recorded as SNP1;

[0038] The second overlapping peak is located at the 730 bp position of the nucleotide sequence shown in SEQ ID NO.1, located at the 164th base on the 18-19 intron of the TJP1 gene, where C mutated to G, i.e., I(18-19)-164, recorded as SNP2;

[0039] The third overlapping peak is located at the 748bp site of the nucleotide sequence shown in SEQ ID NO.1, located at the 182nd base on the 18-19 intron of the TJP1 gene, where A mutated to T, i.e., I(18-19)-182, recorded as SNP3.

[0040] SEQ ID NO.1 shows the TJP1 gene sequence amplified by PCR, and SEQ ID NO.2 and SEQ ID NO.3 show the upstream and downstream primer sequences. The horizontal lines highlight the positions showing three mutant SNP sites.

[0041] >SEQ ID NO.1

[0042] GAACCCGTCCTTGCTTCCTAATG(SEQ ID NO.2)CCCATGATGACCTCAAGAGCAAGCTCCAA CACCCACGATCCCCACATGAACCGTATAGATACTCCCGTTCCTCCTCACAGCCGCCCACCTACCGCAC AGATGACCCTTACAGGTAATGAAATAAAATTGTTCTGAGAAGTGATTTT G(A) TGAATGTTTACATAATC AGGAATTTACAAGTTTCATAATGAAACCTTTGTATGATTCTGTAAATTGTTGCTTTTTATGTAAATTTTTAAGTGTGCTAATATAACTTGTTCTTTGTACAGATCGTCTGACTACAAGCCACTACCTCCACCAAA GAGCAGTAACTACAAACCTGTTCCTCCACCAAAGCCTAAGAACTACAAACCTCAACCACCTGGGAGTATAGAAGGAGGAATGGGCTCATGGGATATGTATGCTGATGCACGGAAGGCATATGAGAGAGGCGCCTAT CACACAACCAGCAATGGAGGACTCAGTGATGATTACAGTGGTCTGGACAGTGGCCAAGGCAGCAGCTTAGATAGGAAGTATGACACGTTTGGAAGATCTTCACATAAGGCAAGTTTCATGTGAATAGTACATCAT CTTCCTCATTTTCTTCTGTTTCTTCTCCCATTATTTTTCTATTCATTCTTCTGTTGTTCTTTCTTATTCTTATTCACTTTGACATCCTCTTCCTCTTTCTCCTCCTTTTCCTGCTTGTCTTCCTCTTCTACCTCCT C(G) CTAGCTTCA TGATGACT A(T)AGTATTGAGATACAAAATATCCATCTGGTTAATTGCTAACACATGCTATCCAATTGCAA C(SEQ ID NO.3)AGGTGGCATCATCAGGTAGCAGA

[0043] Example 2 Association analysis between SNP sites of TJP1 gene and growth traits of Litopenaeus vannamei

[0044] 1. Single-sample PCR amplification and sequencing of the TJP1 gene of Penaeus vannamei

[0045] PCR amplification was performed using 100 genomic DNAs of Penaeus vannamei extracted in Example 1 as templates. PCR reaction primers, PCR reaction conditions and system composition were the same as in Example 1. After the PCR products passed the quality inspection, Sanger sequencing was performed to determine the genotypes of the three SNP sites of each Penaeus vannamei.

[0046] The results showed that the dominant bases of the three SNP sites of the TJP1 gene of the two families of Penaeus vannamei were different. The dominant base of the SNP1 site of the fast-growing family (Q1) was G, while that of the slow-growing family (S1) was A; the dominant base of the SNP2 site of the fast-growing family (Q1) was C, while that of the slow-growing family (S1) was G; the dominant base of the SNP3 site of the fast-growing family (Q1) was A, while that of the slow-growing family (S1) was T. The genotype statistics of the SNPs sites of the TJP1 gene of Penaeus vannamei are shown in Table 2.

[0047] Table 2 Genotype statistics of SNPs loci in TJP1 gene of Litopenaeus vannamei

[0048]

[0049] 2. Association analysis between SNP loci of TJP1 gene and growth trait phenotype data of Litopenaeus vannamei

[0050] SPSS26.0 software was used to perform association analysis on the genotypes of the three SNP loci of each vannamei shrimp obtained in step 1 and the growth trait phenotype data of the corresponding 100 vannamei shrimp collected in Example 1.

[0051] The results showed that the body weight (g) and meat yield (%) of Penaeus vannamei individuals with SNP1 locus genotype GG were significantly higher than those of individuals with genotype GA; the total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei individuals with genotype GG were significantly higher than those of individuals with genotypes GA and AA.

[0052] The body weight (g) and meat yield (%) of Penaeus vannamei individuals with SNP2 locus genotype CC were significantly higher than those of individuals with genotype CG; the total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei individuals with genotype CC were significantly higher than those of individuals with genotypes CG and GG.

[0053] The body weight (g) and meat yield (%) of Penaeus vannamei individuals with AA genotype at SNP3 were significantly higher than those with AT genotype; the total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei individuals with AA genotype were significantly higher than those with AT and TT genotypes.

[0054] The following inference can be made: when the genotype of the molecular marker SNP1 of the TJP1 gene of Penaeus vannamei is GG, the genotype of SNP2 is CC, and the genotype of SNP3 is AA, the shrimp can be retained as a candidate individual with excellent growth traits for breeding. The results of the correlation analysis between the different genotypes of the three SNPs loci of the TJP1 gene of Penaeus vannamei and its growth traits are shown in Table 3, and the results are expressed as mean ± standard deviation.

[0055] Table 3 Correlation analysis between different genotypes of three SNPs in TJP1 gene of Litopenaeus vannamei and its growth traits

[0056]

[0057] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0058] 3. Association analysis between haplotypes of TJP1 gene and growth phenotype data of Litopenaeus vannamei

[0059] Haploview software was used to perform linkage disequilibrium analysis on the genotypes of the three SNP loci; SPSS26.0 software was used to perform association analysis on the haplotype combinations of the three SNP loci and the growth trait phenotypic data of 100 Litopenaeus vannamei collected in Example 1.

[0060] The results showed that the three SNPs formed a haplotype domain, and there were three biologically statistically significant haplotypes (n≥3), namely H1H1 (GG CCAA), H1H2 (GACGAT) and H2H2 (AAGG TT). Among them, the weight (g) and meat yield (%) of the H1H1 haplotype Penaeus vannamei individuals were significantly higher than those of the H1H2 haplotype individuals, but there was no significant difference with the H2H2 haplotype individuals; the total length (cm), body length (cm) and carapace length (cm) of the H1H1 haplotype Penaeus vannamei individuals were significantly higher than those of the H1H2 and H2H2 haplotype individuals.

[0061] The following inference can be made: when the haplotype combination genotype of the three molecular markers is GG CCAA, the shrimp can be retained as a candidate individual for breeding with excellent growth traits. The results of the correlation analysis between the haplotype of the TJP1 gene of Penaeus vannamei and its growth traits are shown in Table 4, and the results are expressed as mean ± standard deviation.

[0062] Table 4 Correlation analysis between haplotypes of TJP1 gene and its growth traits in Penaeus vannamei

[0063]

[0064] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0065] Example 3 Verification of SNP sites related to growth traits of Litopenaeus vannamei TJP1 gene

[0066] In order to further verify the conclusions obtained in Example 2, this example also uses Penaeus vannamei from Fujian Dongfang Liyang Seedling Breeding Co., Ltd. for experiments. According to the breeding data over the years, a fast-growing family (Q2) and a slow-growing family (S2) were selected from the breeding base group. The breeding time, breeding environment and feeding conditions of the two families were the same as those of the Q1 and S1 families in Example 1. 30 Penaeus vannamei were randomly selected from the Q2 and S2 families for verification. The specific operating steps are the same as those of Examples 1 and 2.

[0067] The results showed that the weight (g), total length (cm), body length (cm) and meat yield (%) of the vannamei shrimp individuals with SNP1 locus genotype GG were significantly higher than those of the individuals with genotypes GA and AA; the cephalothorax length (cm) of the vannamei shrimp individuals with genotype GG was significantly higher than that of the individuals with genotype GA.

[0068] The weight (g), total length (cm), body length (cm) and meat yield (%) of Penaeus vannamei individuals with SNP2 locus genotype CC were significantly higher than those of individuals with genotypes CG and GG; the cephalothorax length (cm) of Penaeus vannamei individuals with genotype CC was significantly higher than that of individuals with genotype CG.

[0069] The weight (g), total length (cm), body length (cm) and meat yield (%) of the individuals with genotype AA at SNP3 were significantly higher than those with genotype AT and TT; the head and chest carapace length (cm) of the individuals with genotype AA was significantly higher than that of the individuals with genotype AT. The results of the correlation analysis between the different genotypes of the three SNPs loci of the TJP1 gene of Penaeus vannamei and its growth traits are shown in Table 5, and the results are expressed as mean ± standard deviation.

[0070] Table 5 Correlation analysis between different genotypes of three SNPs loci in TJP1 gene of Litopenaeus vannamei and its growth traits

[0071]

[0072]

[0073] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0074] In addition, the weight (g), total length (cm), body length (cm) and meat yield (%) of the H1H1 haplotype Penaeus vannamei were significantly higher than those of the H1H2 and H2H2 haplotypes; the carapace length (cm) of the H1H1 haplotype Penaeus vannamei was significantly higher than that of the H1H2 haplotype, but there was no significant difference with the H2H2 haplotype. The results of the correlation analysis between the TJP1 gene haplotype of Penaeus vannamei and its growth traits are shown in Table 6, and the results are expressed as mean ± standard deviation.

[0075] Table 6 Correlation analysis between TJP1 gene haplotype and its growth traits in Litopenaeus vannamei

[0076]

[0077] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0078] In summary, Example 3 can verify the inference obtained in Example 2, that is, when the genotype of the TJP1 gene molecular marker SNP1 of the vannamei shrimp is GG, the genotype of SNP2 is CC, and the genotype of SNP3 is AA, the shrimp can be retained as a candidate individual for breeding with excellent growth traits. When the haplotype combination genotype of the three molecular markers is GG CCAA, the shrimp can be retained as a candidate individual for breeding with excellent growth traits.

[0079] Example 4 A method for using molecular markers to assist in screening individuals of Penaeus vannamei with excellent growth traits

[0080] The method includes the following experimental steps:

[0081] (1) Extraction of whole genome DNA of Penaeus vannamei to be tested: The specific operation steps are the same as step 2 of Example 1.

[0082] (2) Amplification and sequencing of the TJP1 gene of the shrimp to be tested: The PCR reaction system, reaction conditions, upstream and downstream primer pairs and Sanger sequencing steps were the same as those in step 1 of Example 2.

[0083] (3) Identification of SNP site genotype of TJP1 gene of Penaeus vannamei to be tested: The method for determining the genotype of the SNP site is the same as step 1 of Example 2 of Example.

[0084] (4) Result determination: Same as Example 3.

[0085] Example 5 A kit for screening individuals of Penaeus vannamei with excellent growth traits using molecular markers

[0086] The kit consists of:

[0087] (1) Primer pair: TJP1-F GAACCCGTCCTTGCTTCCTAATG (SEQ ID NO. 2)

[0088] TJP1-RTCTGCTACCTGATGATGCCACCT(SEQ ID NO.3)

[0089] (2) Reaction system (25 μL): ddH2O 8.5 μL; 2×Accurate Taq premix 12.5 μL; 10 mM upstream primer 1 μL; 10 mM downstream primer 1 μL; DNA template 2 μL.

[0090] (3) The method of using the kit is the same as that in Example 4.

[0091] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A TJP1 gene molecular marker related to growth traits of Penaeus vannamei, characterized in that: The molecular marker is a SNP molecular marker, and the SNP molecular marker is any one of SNP1, SNP2, and SNP3; the SNP1 is located at the 170bp site of the nucleotide sequence shown in SEQ ID NO.1, and the GG genotype of the SNP1 is the dominant genotype; the SNP2 is located at the 730bp site of the nucleotide sequence shown in SEQ ID NO.1, and the CC genotype of the SNP2 is the dominant genotype; the SNP3 is located at the 748bp site of the nucleotide sequence shown in SEQ ID NO.1, and the AA genotype of the SNP3 is the dominant genotype.

2. A product for detecting the SNP marker described in claim 1, characterized in that: The product contains primers for detecting the SNP markers described in claim 1.

3. The product according to claim 2, characterized in that The nucleotide sequence of the primer is shown in SEQ ID NO.2-3.

4. Use of a reagent for detecting the SNP molecular marker described in claim 1 in selective breeding related to growth traits of Penaeus vannamei.

5. The use according to claim 4, characterized in that: The reagent contains primers with nucleotide sequences as shown in SEQ ID NO.2-3.

6. The use according to claim 5, characterized in that: The genomic DNA of the tested Litopenaeus vannamei is used as a template, and the genotype of the SNP molecular marker is determined by PCR amplification and sequencing. When the genotype of SNP1 is GG, the individual is selected as a reserve parent for breeding; when the genotype of SNP2 is CC, the individual is selected as a reserve parent for breeding; when the genotype of SNP3 is AA, the individual is selected as a reserve parent for breeding; when the haplotype combination genotype of SNP1, SNP2 and SNP3 is GG CCAA, the individual is selected as a reserve parent for breeding.

7. The use according to claim 6, characterized in that: The invention also includes the process of extracting the genomic DNA of the tested Penaeus vannamei.

8. The use according to claim 6 or 7, characterized in that: The PCR amplification system is: ddH2O 8.5μL; 2×Accurate Taq premix 12.5μL; 10mM upstream primer 1μL; 10mM downstream primer 1μL; DNA template 2μL.

9. The use according to claim 8, characterized in that: The program setting of the PCR amplification reaction is: a. Pre-denaturation at 94°C for 10 min; b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 59°C for 1 min, and extension at 72°C for 1 min; c. Final extension at 72°C for 10 min.

10. A method for screening Penaeus vannamei with excellent growth traits, characterized in that: The method comprises the following steps: using primers to detect the genotype of the molecular markers described in claim 1, and then screening the dominant population according to the genotype.

Images