InDel molecular marker primer pair of cauliflower variety 'TX65' and application of InDel molecular marker primer pair

Abstract

The invention discloses an InDe molecular marker primer pair of a cauliflower variety 'TX65' and application of the InDe molecular marker primer pair. The method comprises the following steps: screening different InDel loci in a whole genome range by utilizing male and female parent re-sequencing data of a cauliflower variety 'TX65', and designing specific primers for screening to obtain a pair of InDel molecular marker primer pairs, wherein the nucleotide sequences of the InDel molecular marker primer pairs are respectively shown as SEQ ID NO.1 and SEQ ID NO.2; based on PCR amplification reaction, the InDel molecular marker primer pair can quickly and accurately complete 'TX65' cauliflower variety or hybrid seed purity identification in a short time, the number of required detection samples is small, the period is short, the method is simple and quick, the identification result is accurate, the seed production quality of the hybrid 'TX65' can be controlled, and the method is suitable for industrial production. The method solves the problems of long period, large labor investment, inaccurate identification and the like in the identification of the existing cauliflower 'TX65' variety.

Description

Technical Field

[0001] The invention relates to a cauliflower molecular marker primer set and application thereof, in particular to a cauliflower InDel molecular marker primer pair and application thereof in authenticity identification of cauliflower 'TX65' variety or seed purity, belonging to the field of molecular identification of authenticity or seed purity of cauliflower 'TX65' variety. Background Art

[0002] Cauliflower (Brassica oleracea var. Botrytis) is one of the most important vegetable varieties in the world. It is deeply loved by Chinese and Western consumers for its nutritious and delicious flower heads. As a representative of high-quality healthy vegetables, the flower heads composed of its fleshy stems and inflorescence meristems are rich in vitamin C and anti-cancer substances such as glucosinolates, which meet the demand for healthy vegetables.

[0003] As the number of cauliflower varieties increases year by year, the concentrated application of a few backbone parents has made the genetic differences between varieties smaller and smaller, making it difficult to effectively identify them. Effectively managing and identifying cauliflower varieties with similar genetic backgrounds from the source is a major problem that needs to be solved urgently. At present, the identification of cauliflower varieties is mainly based on traditional methods such as morphological marker research, which takes a long time, the conclusions obtained are often not perfect, and it is difficult to eliminate the influence of environmental and human factors. Therefore, it is necessary to establish a rapid identification method based on genotype.

[0004] Molecular markers are markers at the gene level, which detect genetic variation directly at the DNA molecule level. They are not affected by many factors such as tissue and organ types, developmental stages, and habitat conditions. They are highly polymorphic and genetically stable. Insertion-Deletion Length Polymorphism (InDel) markers are length polymorphic variations caused by the insertion or deletion of a certain number of nucleotides at the allele locus. They belong to the third generation of molecular markers, which are mainly developed based on whole genome sequencing. They have a higher density in the genome than SSR (Simple Sequence Repeat) markers, and have the advantages of high marker specificity, good stability, simple detection methods, and economy. They have been successfully applied to the identification of rice, soybeans, cotton and other varieties, overcoming the uncertainty of identifying new varieties based only on morphological characteristics.

[0005] Cauliflower variety 'TX65' is a mid-maturing variety in autumn, harvested 75-80 days after planting, with strong growth potential, strong disease resistance, upright plant shape, and semi-protected head; the flower head is smooth, round, firm, and white, with a single head weighing about 1.5 kg. It is harvested in time after the flower head matures.

[0006] So far, there is no molecular marker and identification method suitable for the cauliflower variety 'TX65'. Developing molecular identification markers suitable for the cauliflower variety 'TX65' will be beneficial to standardizing cauliflower variety registration, strengthening market supervision and enhancing intellectual property protection. Summary of the invention

[0007] One of the objectives of the present invention is to provide an InDel molecular marker primer pair for identifying the authenticity of the cauliflower variety 'TX65' or the purity of the seeds;

[0008] The second object of the present invention is to provide a PCR detection kit for identifying the authenticity of the cauliflower variety 'TX65' or identifying the purity of the seeds of the cauliflower hybrid 'TX65';

[0009] The third purpose of the present invention is to apply the InDel molecular marker primer pair to identify the authenticity or seed purity of the cauliflower variety 'TX65'.

[0010] The above object of the present invention is achieved through the following technical solutions:

[0011] The present invention first extracts genomic DNA of the maternal superior inbred line '24DM-5' and the paternal superior inbred line '24DL-9' of the cauliflower variety 'TX65', performs Illumina double-end sequencing, removes the adapter sequence and data quality control from the obtained raw data, and compares the effective sequencing data with the cauliflower reference genome through BWA software, and removes duplications from the comparison results through SAMTOOLS. The GATK HaplotypeCaller module is used to detect and analyze the InDel variation in the sample; the present invention further uses a python language script to screen the differential InDel sites in the parental genome of the cauliflower variety 'TX65', the InDel size is set to 25-500bp, and the sequencing depth is greater than 4. Based on the reference genome information, the screened sites are located on the genome, and the nucleotide sequences of 200bp upstream and downstream of the InDel marker site are extracted. Primers are designed in batches using Primer3.0 and python language scripts. The designed and synthesized primers were used to perform PCR amplification on the cauliflower variety 'TX65' and its parents, and finally a pair of InDel molecular marker primers that can be used to identify the authenticity or seed purity of the cauliflower variety 'TX65' was screened, thereby completing the present invention.

[0012] One aspect of the present invention provides an InDel molecular marker primer pair for identifying the authenticity of the cauliflower variety 'TX65' or the purity of the seeds. The InDel marker primer pair consists of a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2.

[0013] Another aspect of the present invention is to provide a PCR detection kit for identifying the authenticity of cauliflower variety 'TX65' or identifying the purity of cauliflower hybrid 'TX65' seeds, the PCR detection kit comprising: dNTPs, Taq enzyme, MgCl2, a PCR primer pair consisting of a forward primer shown in SEQ ID NO.1 and a reverse primer shown in SEQ ID NO.2, an amplification buffer and sterile water.

[0014] Another aspect of the present invention is to provide the use of the InDel molecular marker primers of the cauliflower variety 'TX65' to identify the authenticity of the cauliflower variety 'TX65' or the purity of the seeds of the cauliflower variety 'TX65', including: using the InDel marker primer pair, amplifying by PCR and detecting by agarose gel electrophoresis, the polymorphism of the InDel site between different individuals can be displayed, thereby achieving the purpose of identification.

[0015] Specifically, the present invention provides an application of the InDel molecular marker primer pair in authenticity identification of cauliflower hybrid 'TX65' variety, comprising:

[0016] (1) extracting genomic DNA from a cauliflower plant sample to be tested;

[0017] (2) using the extracted sample genomic DNA as a template and the InDel molecular marker primer pair as a PCR primer to establish a PCR amplification system and perform PCR amplification respectively;

[0018] (3) If the band patterns of the amplified products both have the band patterns of the parents of the cauliflower hybrid TX65', the cauliflower variety to be tested is the cauliflower hybrid 'TX65'; if the band patterns of the amplified products do not both have the band patterns of the parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is not the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5.

[0019] The PCR amplification system in step (2) is preferably: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and reverse primer 1.0 μL each, 0.5 unit Taq DNA polymerase 0.2 μL, template 50 ng, add ddH2O to 10 μL;

[0020] The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

[0021] Specifically, the present invention provides an application of the InDel molecular marker primer pair group to the identification of seed purity of cauliflower hybrid 'TX65', and the identification method comprises:

[0022] (1) extracting genomic DNA from a cauliflower seed sample to be tested;

[0023] (2) using the extracted genomic DNA of the seed sample as a template, using forward and reverse primers to establish a PCR amplicon for PCR amplification;

[0024] (3) If the band patterns of the amplified products both have the band patterns of the parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are seeds of the cauliflower hybrid 'TX65'; if the band patterns of the amplified products do not both have the band patterns of the parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are not seeds of the cauliflower hybrid 'TX65'; wherein the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5;

[0025] (4) Calculate the ratio of the number of true 'TX65' cauliflower hybrid seeds to the total number of tested seeds to obtain the seed purity of the 'TX65' cauliflower hybrid seeds.

[0026] The PCR amplification system in step (2) is preferably: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and reverse primer 1.0 μL each, 0.5 unit Taq DNA polymerase 0.2 μL, template 50 ng, add ddH2O to 10 μL;

[0027] The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

[0028] In a preferred embodiment of the present invention, the male parent of the cauliflower variety 'TX65' is preferably cauliflower '24DL-9', and the female parent of the cauliflower variety 'TX65' is preferably cauliflower '24DM-5'.

[0029] The present invention uses the screened InDel molecular marker primers of the cauliflower variety 'TX65' to quickly and accurately complete the purity identification of the cauliflower variety 'TX65' or hybrid seeds in a short time, solves the problems of long identification cycle and large labor input of the existing cauliflower 'TX65' variety, and can quickly, efficiently, stably and accurately detect TX65' based on InDel molecular markers.

[0030] Compared with the prior art, the present invention mainly has the following beneficial effects:

[0031] 1. The present invention utilizes the resequencing data of the parents of the cauliflower variety 'TX65' to screen differential InDel sites in the whole genome and design specific primers, with high accuracy and stable and reliable results.

[0032] 2. The present invention utilizes agarose gel electrophoresis for detection, which has the advantages of simple operation, low cost, high speed, wide application range, etc. compared with polyacrylamide gel electrophoresis.

[0033] 3. The present invention is based on PCR amplification reaction, and can quickly and accurately complete the purity identification of 'TX65' cauliflower variety and hybrid seeds in a short time. The method is simple and fast, the detection cycle is short, and labor costs are saved, and it has a good application and promotion prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1The results of using the InDel molecular marker primer pair of the present invention to detect the authenticity of the cauliflower variety 'TX65' and its parents and 152 cauliflower commercial varieties;In the figure, M is a marker, and lanes 01 to 155 are cauliflower male inbred line 24DL-9, cauliflower female inbred line 24DM-5, TX65, Jinsong 75, Qingnong 92, Zhenong Songhua 80, Zhenong Songhua 85, Zhenong Songhua 90, Shangmei 65, Jinpin 70, Fugui 80, B11, BX110, BX120, CB30, CY-17, DX-8, DX-108, DX-120, DX-142, Fuzi YAMA, H2 194,JN152,JN154,JN155,JN156,JN157,JP63,JP69,JP70,SX60,1522,ID3,ID4,ID7,ID10,ID11,ID16,ID23,ID24,ID3 1,ID32,ID33,ID36,ID37,ID38,ID47,ID41,ID51,ID53,ID55,ID57,ID58,ID60,ID61,ID62,ID63,ID64,ID65,ID68,ID 70,ID71,ID73,ID74,ID82,ID83,ID85,ID88,ID89,ID90,ID92,ID93,ID99,ID100,PK2,PK3,PK4,PK5,PK6,PK8,PK10,P K12,20KV36,20KV39,20KV46,20CP1,20CP2,20CP3,20CP5,20CP6,20CP7,20CP8,20CP9,19QK1,19QK2,19QK6,19QK8,19Q K13,19QK16,19QK33,19QK35,19QK36,19QK42,19QK43,19QK53,19QK67,19QK68,16SY44,16SY51,16SY55,16SY56,16SY 61,16SY62,16SY63,16SY64,16SY69,16SY72,16SY76,16SY79,16SY81,16SY82,16SY89,16SY92,16SY93,16SY94,16SY96 ,16SY104,16SY105,16SY110,16SY112,16SY113,16SY116,16SY117,16SY122,16SY127,16SY128,16SY132,21NY4,21NY 6,21NY8,21NY10,21NY19,21NY21,21NY23,21NY34,21NY37,21NY38,21JN79,21JN74,21JN81,KB2,KB3,KB4,KB18,KB19. ;

[0035] Figure 2 The electrophoresis diagram is a diagram of using the InDel molecular marker primer pair of the present invention to detect the seed purity of the cauliflower variety 'TX65'; in the diagram, M is a marker, and lanes 01-96 are 96 individual plants of the sample to be tested. DETAILED DESCRIPTION

[0036] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0037] Experimental Example 1 Screening for differential InDel sites across the entire genome and designing specific primers for screening

[0038] 1 Test method

[0039] 1.1Illumina high-throughput sequencing

[0040] The genomic DNA of the maternal superior inbred line '24DM-5' and the paternal superior inbred line '24DL-9' of the cauliflower variety 'TX65' was extracted and subjected to Illumina double-end sequencing. After removing the adapter sequence and data quality control from the obtained raw data, the effective sequencing data was aligned with the cauliflower reference genome using the BWA software, and the alignment results were deduplicated using SAMTOOLS. The GATK HaplotypeCaller module was used to detect and analyze the InDel variants in the samples;

[0041] 1.2 Screening of differential InDel sites and design of specific primers

[0042] A python script was used to screen the InDel sites of the differences in the parental genomes of the cauliflower variety 'TX65'. The InDel size was set to 20-500bp, and the sequencing depth was greater than 4. Based on the reference genome information, the screened sites were located on the genome, and it was finally found that the InDel molecular marker was located on chromosome 3 of the cauliflower reference genome 'C-8', and its InDel site was located at nucleotide 6703860, where the base was A or AATCTTCGTTGTTATAGAAATGTTTTCTTGTAGTGTTTTTATTTTTAA AGTTTATATTTGTGAAAAAAACTTTTTTAG (SEQ ID NO.3).

[0043] Extract the nucleotide sequence of 200bp upstream and downstream of the InDel marker site. Use Primer3.0 and python language script to batch design primers, perform PCR amplification on cauliflower 'TX65' variety and its parents, and finally screen out a pair of InDel molecular marker primers that can be used to identify the authenticity or seed purity of cauliflower variety 'TX65':

[0044] Forward primer: TGGACTCGTCGTAATTTCGTTG (SEQ ID NO. 1)

[0045] Reverse primer: AATGCCCGTCTTATGCACG (SEQ ID NO. 2).

[0046] Experimental Example 2: Using InDel molecular marker primer pairs to identify the authenticity of the 'TX65' cauliflower variety

[0047] 1 Test method

[0048] 1.1 Extraction of leaf genomic DNA

[0049] The genomic DNA of cauliflower variety 'TX65' and its parents, as well as 152 commercial varieties were extracted respectively. Specifically, the paternal parent 24DL-9 (the length of its DNA sequence is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4), the maternal parent 24DM-5 (the length of its DNA sequence is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5), TX65 (sold by Tianjin Academy of Agricultural Sciences, its trade name is cauliflower TX65), Jinsong 75, Qingnong 92, Zhe Nong Songhua 80, Zhe Nong Songhua 85, Zhe Nong Songhua 90, Shangmei 65, Jinpin 70, Fugui 80, B11, BX110, BX120, CB30, CY-17, DX-8, DX-108, DX-120, DX-142, Fuzi YAMA, H2 194,JN152,JN154,JN155,JN156,JN157,JP63,JP69,JP70,SX60,1522,ID3,ID4,ID7,ID10,ID11,ID16,ID23,ID24,ID31 ,ID32,ID33,ID36,ID37,ID38,ID47,ID41,ID51,ID53,ID55,ID57,ID58,ID60,ID61,ID62,ID63,ID64,ID65,ID68,ID70 ,ID71,ID73,ID74,ID82,ID83,ID85,ID88,ID89,ID90,ID92,ID93,ID99,ID100,PK2,PK3,PK4,PK5,PK6,PK8,PK10,PK12 ,20KV36,20KV39,20KV46,20CP1,20CP2,20CP3,20CP5,20CP6,20CP7,20CP8,20CP9,19QK1,19QK2,19QK6,19QK8,19QK13 ,19QK16,19QK33,19QK35,19QK36,19QK42,19QK43,19QK53,19QK67,19QK68,16SY44,16SY51,16SY55,16SY56,16SY61,1 6SY62,16SY63,16SY64,16SY69,16SY72,16SY76,16SY79,16SY81,16SY82,16SY89,16SY92,16SY93,16SY94,16SY96,16S Y104,16SY105,16SY110,16SY112,16SY113,16SY116,16SY117,16SY122,16SY127,16SY128,16SY132,21NY4,21NY6,21NY8,21NY10,21NY19,21NY21,21NY23,21NY34,21NY37,21NY38,21JN79,21JN74,21JN81,KB2,KB3,KB4,KB18,KB19 single strain DNA. .

[0050] 1.2 PCR amplification

[0051] Using the genomic DNA of each cauliflower variety described in 1.1 as a template and the InDel molecular marker primer pair screened in Experimental Example 1 as a PCR primer, PCR amplification was performed respectively;

[0052] The PCR amplification system was: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and reverse primer 1.0 μL each, 0.5 units of Taq DNA polymerase 0.2 μL, template 50 ng, add ddH2O to 10 μL;

[0053] The PCR amplification program was as follows: 95°C for 3 min, 35 cycles of (95°C for 15 s, 56°C for 15 s, 72°C for 20 s), and 72°C for 5 min.

[0054] 1.3 Detection and analysis of PCR amplification products

[0055] Add 1 μL 10× Loding Buffer to the amplified product described in 1.2, and perform 2% agarose gel electrophoresis at a constant voltage of 120 V / cM for 90 min, then stain with Gelred and photograph using a gel imaging system. Identify the variety based on the electrophoresis band pattern. If the band pattern of the InDel site has both the band patterns of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is determined to be the cauliflower hybrid 'TX65'.

[0056] 2 Identification results

[0057] Figure 1The figure shows the agarose gel electrophoresis of cauliflower variety 'TX65' and its parents as well as 152 commercial cauliflower varieties using the above method.In the figure, M is the Marker, and the lanes 01 - 155 are respectively the male parent 24DL - 9 of cauliflower variety 'TX65', the female parent 24DM - 5 of cauliflower variety 'TX65', TX65, Jinsong 75, Qingnong 92, Zhenong Songhua 80, Zhenong Songhua 85, Zhenong Songhua 90, Shangmei 65, Jinpin 70, Fugui 80, B11, BX110, BX120, CB30, CY - 17, DX - 8, DX - 108, DX - 120, DX - 142, Fuzi YAMA, H2 194, JN152, JN154, JN155, JN156, JN157, JP63, JP69, JP70, SX60, 1522, ID3, ID4, ID7, ID10, ID11, ID16, ID23, ID24, ID31, ID32, ID33, ID36, ID37, ID38, ID47, ID41, ID51, ID53, ID55, ID57, ID58, ID60, ID61, ID62, ID63, ID64, ID65, ID68, ID70, ID71, ID73, ID74, ID82, ID83, ID85, ID88, ID89, ID90, ID92, ID93, ID99, ID100, PK2, PK3, PK4, PK5, PK6, PK8, PK10, PK12, 20KV36, 20KV39, 20KV46, 20CP1, 20CP2, 20CP3, 20CP5, 20CP6, 20CP7, 20CP8, 20CP9, 19QK1, 19QK2, 19QK6, 19QK8, 19QK13, 19QK16, 19QK33, 19QK35, 19QK36, 19QK42, 19QK43, 19QK53, 19QK67, 19QK68, 16SY44, 16SY51, 16SY55, 16SY56, 16SY61, 16SY62, 16SY63, 16SY64, 16SY69, 16SY72, 16SY76, 16SY79, 16SY81, 16SY82, 16SY89, 16SY92, 16SY93, 16SY94, 16SY96, 16SY104, 16SY105, 16SY110, 16SY112, 16SY113, 16SY116, 16SY117, 16SY122, 16SY127, 16SY128, 16SY132, 21NY4, 21NY6, 21NY8, 21NY10, 21NY19, 21NY21, 21NY23, 21NY34, 21NY37, 21NY38, 21JN79, 21JN74, 21JN81, KB2, KB3, KB4, KB18 and KB19(。 Figure 1 )。

[0058] according to Figure 1 The detection results show that the banding pattern of the InDel site of the cauliflower hybrid 'TX65' has both the banding patterns of the male and female parents of the cauliflower hybrid 'TX65', while the banding patterns of the same InDel site of other varieties do not have both the banding patterns of the male and female parents of the cauliflower hybrid 'TX65'; therefore, the InDel molecular marker primer pair designed and screened in Experimental Example 1 of the present invention can accurately identify the cauliflower hybrid 'TX65' from other cauliflower varieties.

[0059] Experimental Example 3: Identification of the purity of 'TX65' cauliflower hybrid seeds using InDel molecular marker primer pairs

[0060] 1 Test method

[0061] 1.1 Extraction of leaf genomic DNA

[0062] A random sample of 96 hybrid seeds from a batch of 'TX65' cauliflower hybrid seeds.

[0063] Cauliflower hybrid 'TX65' and sample seeds were sown in 72-hole trays at the same time and watered regularly until two true leaves grew; leaves were sampled from each of the 96 hybrid sample seeds. Genomic DNA was extracted from each plant using the conventional CTAB method and stored at -20°C for later use.

[0064] 1.2 PCR amplification

[0065] The PCR amplification was the same as that in Experimental Example 2.

[0066] 1.3 Detection and analysis of PCR amplification products

[0067] The PCR amplification product detection and hybrid variety identification methods are the same as those in Experimental Example 2.

[0068] 2 Identification results

[0069] The results of agarose gel electrophoresis of seed purity identification of cauliflower hybrid 'TX65' using the above method are shown in part. Figure 2 In the figure, M is a marker, and lanes 01-96 are 96 individual strains of the sample to be tested.

[0070] There are 96 true hybrid seeds among the 96 sample seeds, so the purity of this batch of 'TX65' hybrid seeds is 100%, which meets the national standards and is consistent with the field investigation results.

Claims

1. An InDel molecular marker primer pair for cauliflower variety 'TX65', characterized in that: The InDel primer pair consists of a forward primer shown in SEQ ID NO.1 and a reverse primer shown in SEQ ID NO.

2.

2. A PCR detection kit for identifying the authenticity of cauliflower variety 'TX65' or identifying the purity of cauliflower variety 'TX65' seeds, the PCR detection kit comprising: dNTPs, Taq enzyme, MgCl2, a PCR primer pair consisting of a forward primer and a reverse primer, an amplification buffer and sterile water; characterized in that the PCR primer pair is the InDel molecular marker primer pair according to claim 1.

3. Use of the InDel molecular marker primer pair according to claim 1 in the authenticity identification of the cauliflower variety 'TX65'.

4. The use according to claim 3, characterized in that: include: (1) extracting genomic DNA from a cauliflower plant sample to be tested; (2) using the extracted sample genomic DNA as a template and the InDel molecular marker primer pair described in claim 1 as forward and reverse primers to establish a PCR amplification system and perform PCR amplification respectively; (3) If the band patterns of the amplified product have both the band patterns of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be detected is the cauliflower hybrid 'TX65'; if the band patterns of the amplified product do not have both the band patterns of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be detected is not the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.

5.

5. The use according to claim 4, characterized in that: The PCR amplification system described in step (2) is: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and 10 μM reverse primer 1.0 μL each, 0.5 unit Taq DNA polymerase 0.2 μL, template 50 ng, add ddH2O to 10 μL; The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

6. The use according to claim 4, characterized in that: The male parent of the cauliflower variety 'TX65' is cauliflower '24DL-9', and the female parent of the cauliflower variety 'TX65' is cauliflower '24DM-5'; wherein the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.

5.

7. Use of the InDel molecular marker primer pair according to claim 1 in identifying the purity of seeds of cauliflower hybrid 'TX65'.

8. The use according to claim 7, characterized in that include: (1) extracting genomic DNA from a cauliflower seed sample to be tested; (2) using the extracted genomic DNA of the seed sample as a template and the InDel molecular marker primer pair described in claim 1 as a forward primer and a reverse primer to establish a PCR amplification system and perform PCR amplification respectively; (3) If the banding patterns of the amplified products have both the banding patterns of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are seeds of the cauliflower hybrid 'TX65'; if the banding patterns of the amplified products do not have both the banding patterns of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are not seeds of the cauliflower hybrid 'TX65'; (4) Calculate the ratio of the number of true 'TX65' cauliflower hybrid seeds to the total number of tested seeds to obtain the seed purity of the 'TX65' cauliflower hybrid seeds.

9. The use according to claim 8, characterized in that the PCR amplification system in step (2) is: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and 10 μM reverse primer 1.0 μL each, 0.5 unit Taq DNA polymerase 0.2 μL, template 50 ng, add ddH2O to 10 μL; The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

10. The use according to claim 8, characterized in that the male parent of the cauliflower variety 'TX65' is cauliflower '24DL-9', and the female parent of the cauliflower variety 'TX65' is cauliflower '24DM-5'; wherein, The length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5.

Images