QTL (Quantitative Trait Loci) related to wheat grain roundness as well as KASP primer and application thereof

Abstract

The invention belongs to the field of molecular breeding, and particularly relates to a group of QTLs (quantitative trait loci) related to wheat grain roundness as well as KASP primers and application of the QTLs. According to the specific technical scheme, the major gene locus QGr.cib-5A related to the wheat grain roundness is located on a short arm of a wheat 5A chromosome. By utilizing the QTL and the corresponding KASP molecular marker found by the invention, early generation detection can be carried out on the grain roundness in wheat breeding, the workload is reduced, the breeding period is shortened, the breeding efficiency is improved, and the application prospect is good.

Description

Technical Field

[0001] The invention belongs to the field of molecular breeding, and in particular relates to a group of QTLs related to wheat grain roundness and KASP primers and applications thereof. Background Art

[0002] Wheat is one of the most important and widely planted food crops in my country and even in the world. Wheat grain morphology is an important factor affecting the commercial quality of wheat and has long been the focus of breeders. Traditional identification methods require testing after the seeds are harvested, which affects the efficiency and speed of early generation screening.

[0003] Molecular marker-assisted selection is an effective method to predict corresponding traits through genotype testing. The detection time is not affected by factors such as generation, development time, and growth environment. It is more efficient, scientific, and accurate.

[0004] More and more studies have found that the appearance of wheat grains not only affects consumers' subjective preferences, but also has a direct connection with economic value. Under the same conditions, rounder or fuller wheat grains are easier to grind off the outer bran, thereby producing more high-quality flour. Sahand's prediction model shows that round grains have higher flour yields compared to slender grains, regardless of grain size. At the same time, grain grinding time and flour particle size increase as grain size decreases. Therefore, if wheat quality can be predicted by wheat grain morphological traits, it is expected to effectively save time and economic costs in the quality measurement process. Summary of the invention

[0005] The purpose of the present invention is to provide a group of QTLs related to wheat grain roundness and KASP primers and applications thereof.

[0006] To achieve the above-mentioned purpose of the invention, the technical solution adopted by the present invention is: the major gene locus QGr.cib-5A related to wheat grain roundness, the gene locus is located at 444.8~455.5Mb of the short arm of wheat chromosome 5A.

[0007] Preferably, the gene locus is amplified, identified and recognized by molecular markers 55k-31 and 5A4-15; the molecular marker 55k-31 includes 3 primers, and the sequences are: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; the molecular marker 5A4-15 includes 3 primers, and the sequences are: SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.

[0008] Accordingly, a KASP molecular marker for identifying whether wheat contains QGr.cib-5A, the molecular marker includes molecular markers 55k-31 and 5A4-15;

[0009] The molecular marker 55k-31 includes three primers, and the sequences are: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; the molecular marker 5A4-15 includes three primers, and the sequences are: SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.

[0010] Correspondingly, in the method of using the molecular markers to identify whether wheat contains QGr.cib-5A, if the fluorescence of the PCR amplification product of the sample to be tested of the molecular marker 55k-31 and / or the molecular marker 5A4-15 is detected, it is identified that the wheat contains QGr.cib-5A.

[0011] Correspondingly, in the method for identifying the QGr.cib-5A genotype in wheat using the molecular marker, if the forward primers of the molecular marker 55k-31 and the molecular marker 5A4-15 detect fluorescence, the genotype of the wheat material to be tested is judged to be A, and the corresponding base at 445243555bp is CC, and the corresponding base at 445436340bp is AA; if the reverse primers of the molecular marker 55k-31 and the molecular marker 5A4-15 detect fluorescence, the genotype of the wheat material to be tested is judged to be B, and the corresponding base at 445243555bp is GG, and the corresponding base at 445436340bp is GG.

[0012] Correspondingly, a product for screening round-grain wheat varieties is prepared using the gene locus QGr.cib-5A or the molecular marker.

[0013] Correspondingly, a product for screening long-grain wheat varieties is prepared using the gene locus QGr.cib-5A or the molecular marker.

[0014] Correspondingly, using the method for screening and identifying round-grain wheat varieties using the molecular markers, if the sample to be tested is found to contain QGr.cib-5A, and the corresponding bases are CC and AA, the sample is identified as round-grain wheat.

[0015] Correspondingly, using the method for screening and identifying long-grain wheat varieties using the molecular markers, if the sample to be tested is found to contain QGr.cib-5A, and the corresponding bases are GG, GG, then the sample is identified as long-grain wheat.

[0016] Correspondingly, the gene locus QGr.cib-5A or the molecular marker is used in wheat breeding.

[0017] The present invention has the following beneficial effects:

[0018] The present invention constructs a genetic research population using Zhongke wheat 138 and Chinese spring, and locates a new major effect QTL that can control grain roundness and is environmentally stable: QGr.cib-5A. Based on the major effect QTL, the present invention also provides molecular markers closely linked to it: 55k-31 and 5A4-15. The molecular markers are based on PCR amplification of DNA templates and genotyping of fluorescent signals, and the detection is stable and reliable, fast and accurate, simple to operate, short in detection time, high in throughput, and low in cost.

[0019] The major effect QTL and corresponding molecular markers provided by the present invention have good application prospects. The KASP molecular markers provided by the present invention can be used to detect the grain roundness trait in early generations in wheat breeding, reduce the workload, shorten the breeding years, effectively regulate and shape the wheat grain shape, thereby improving the breeding efficiency, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the genetic location of QTL QGr.cib-5A on wheat chromosome 5A. DETAILED DESCRIPTION

[0021] The present invention discovers and provides a new wheat gene locus: a gene locus closely related to wheat grain roundness: QGr.cib-5A. The gene locus is located at 444.8-455.5Mb on the short arm of chromosome 5A of wheat. The SNP polymorphisms closely linked to the gene locus are: at 445243555bp: CC (Zhongkemai 138) → GG (Chinese Spring); at 445436340bp: AA (Zhongkemai 138) → GG (Chinese Spring). Compared with wheat varieties that do not contain the QGr.cib-5A locus and wheat varieties whose genotype of the QGr.cib-5A locus is GG / GG (445243555 / 445436340), wheat varieties that contain the QGr.cib-5A locus and have a genotype of CC / AA (445243555 / 445436340) have higher grain roundness.

[0022] The present invention also provides molecular markers for identifying the gene loci in wheat plants / lines: 55k-31 and 5A4-15; the positions are: single nucleotide polymorphism (SNP) sites 445243555 and 445436340 respectively. The molecular markers include 3 primers respectively, and the specific primer sequences are shown in Table 1. In Table 1, the left end is 5' and the right end is 3'. It should be noted that: the two pairs of primers provided by the present invention are both inside the QTL; compared with the use of a single primer, the difference in roundness typing of the population using two pairs of primers is more significant.

[0023] Table 1 Primer sequence comparison table

[0024] Primer name Primer sequences Serial Number 55k-31-F GAAGGTGACCAAGTTCATGCTTCTTTGAAGCGTAAACTTCTCTGTG SEQ ID NO:1 55k-31-H GAAGGTCGGAGTCAACGGATTTCTTTGAAGCGTAAACTTCTCTGTC SEQ ID NO:2 55k-31-C GGTGGGCTGTCATGACACTC SEQ ID NO:3 5A4-15-F GAAGGTGACCAAGTTCATGCTCAACACTTGGCTGACCTCAT SEQ ID NO:4 5A4-15-H GAAGGTCGGAGTCAACGGATTCAACACTTGGCTGACCTCAC SEQ ID NO:5 5A4-15-C TCACTAAGATGCATCGACCCAT SEQ ID NO:6

[0025] In Table 1, the forward primer (F) is added with the FAM fluorescent group "GAAGGTGACCAAGTTCATGCT"; the reverse primer (H) is added with the HEX fluorescent group "GAAGGTCGGAGTCAACGGATT". The FAM and HEX tags added to the above primers are examples and not limitations; those skilled in the art can replace the tags according to actual needs, as long as the primers can be distinguished and identified.

[0026] The present invention also provides a method for identifying whether a wheat plant / line contains the gene locus and the genotype of the gene locus, as well as the roundness phenotype of wheat grains by using the molecular marker.

[0027] If no corresponding bases are detected by the two pairs of primers (no fluorescence is detected in the PCR amplification products), it is judged that the wheat material to be tested does not contain the said gene site; if FAM fluorescence is detected, the corresponding bases are CC (445243555) and AA (445436340), respectively, then it is judged that the wheat material to be tested contains the gene site, the genotype is A, and the wheat grain roundness value is higher; if HEX fluorescence is detected, the corresponding bases are GG (445243555) and GG (445436340), respectively, then it is judged that the wheat material to be tested contains the gene site, the genotype is B, the wheat grain roundness value is lower, and the grains are longer.

[0028] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The data obtained are all average values ​​obtained after at least 3 repetitions, and all the data obtained in each repetition are valid data.

[0029] Example 1: Acquisition of QGr.cib-5A and its molecular markers

[0030] 1. A F2 population containing 494 families and a recombinant inbred line (RIL) population containing 184 families were used to locate the QTL loci for grain roundness. The parents of the two families were Zhongkemai 138 (ZKM138) and Chinese Spring (CS).

[0031] Among them, the F2 population was planted in Shifang (SF) from 2018 to 2019; the RIL population was planted in Shifang (SF) from 2021 to 2022 and 2022 to 2023, and in Shuangliu (SL) from 2022 to 2023, and the best linear unbiased evaluation (BLUE) data set was obtained by calculation, which can be regarded as an additional environment. A randomized block design was adopted, with a row length of 1 meter, 10 seeds per row, a row spacing of 0.25 meters, and 2 rows per line. Field management and disease control were managed in accordance with the local wheat planting management method. After the wheat matured, 3 to 6 plants were randomly selected from each family, and the grain roundness and grain size ratio of all environments were investigated using the Wanshen SC-G automatic seed analyzer.

[0032] 2. The wheat 55K SNP chip was used to perform whole-genome scanning on 187 RIL families constructed from Zhongkemai 138×Chinese Spring and the two parents to construct a whole-genome genetic linkage map.

[0033] 3. The F2 population was sampled in a mixed pool, and the DNA of 49 materials with extremely large grains and 49 materials with extremely small grains were mixed and BSE-seq was performed. The DNA, genotype and phenotypic data of the RIL population and the three environments were used to locate QTL using the BIP module of the software IciMapping 4.1. In the end, both the BSE-seq and QTL positioning methods located a QTL controlling grain roundness on the short arm of chromosome 5A of wheat, both of which were: QGr.cib-5A. This site can be detected by different detection methods and can be stably expressed in different environments, indicating that it is a QTL that can stably express and control grain roundness. The physical position of QGr.cib-5A is 444.8~455.5Mb.

[0034] 4. The QGr.cib-5A tightly linked markers are KASP markers 55k-31 and 5A4-15 designed and developed on the PolyMaker website, and the primer sequences are shown in Table 1 of the specific implementation. The amplification system for PCR amplification is shown in Tables 2 and 3.

[0035] Table 2 PCR amplification system one

[0036]

[0037]

[0038] Table 3 PCR amplification system 2

[0039]

[0040] The PCR amplification program included: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing and extension at 61°C for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle, denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, 30 cycles, insulation at 10°C, and collection of fluorescence signals.

[0041] According to the PCR amplification results, the genotyping is as follows: if FAM fluorescence is detected, the corresponding bases are CC (445243555) and AA (445436340), respectively, then the wheat material to be tested is judged to contain the gene site, and the genotype is A; if HEX fluorescence is detected, the corresponding bases are GG (445243555) and GG (445436340), respectively, then the wheat material to be tested is judged to contain the gene site, and the genotype is B; if FAM and HEX signals are detected at the same time, the corresponding bases are CC / GG (445243555) and AA / GG (445436340), respectively, then the wheat material to be tested is judged to contain the heterozygous site of the gene, and the genotype is H.

[0042] Example 2: Molecular marker effect display

[0043] 1. Using the molecular markers of Example 1, according to the amplification system and amplification procedure of Example 1, the QTL mapping population parents Zhongkemai 138 and Chinese Spring were selected for marker polymorphism test, and the DNA of the parents was mixed as a heterozygous control, and the tests were performed separately, and the fluorescence readings were completed. According to the typing results, the materials with alleles CC and AA were divided into group A, and the grain roundness was higher; the materials with alleles GG and GG were divided into group B, and the grain roundness was lower; the materials with CC / GG and AA / GG heterozygous genotypes were divided into group H, and the grain roundness was between the roundness values ​​of genotypes A and B.

[0044] The genotyping results of Zhongkemai 138, Chinese Spring and parental DNA heterozygotes were A, B, and H. It was shown that the 55k-31 and 5A4-15 markers can clearly separate different genotypes, indicating that the markers can successfully mark the polymorphisms of different SNPs at the target site.

[0045] 2. Type the pedigrees of 184 1C-RILs, construct a genetic map, and locate the grain traits; and classify and compare the grain roundness based on the typing results to verify its effectiveness in detecting grain morphology. The genetic position of QTL QGr.cib-5A on wheat chromosome 5A is as follows Figure 1 The QTL positioning results are shown in Table 4.

[0046] Table 4 QTL mapping results for grain roundness in 1C-RIL population

[0047] environment Side mark 1 Side mark 2 LOD value PVE value (%) Additive effect size 2022SF 5A4-15 55k-39 3.60 8.73 0.0084 2023SF 5A4-15 55k-39 3.47 8.38 0.0089 2023SL 55k-30 55k-31 2.51 6.16 0.0085 BLUE 55k-30 55k-31 2.69 6.56 0.0087

[0048] The results in Table 4 show that the QTL exists stably in the four environments, indicating that the site is real and stable.

[0049] The genotyping results are shown in Table 5. Average grain roundness = grain width / grain length.

[0050] Table 5 Genetic analysis and phenotypic status of 1C-RILs population

[0051]

[0052]

[0053]

[0054] The typing results in Table 5 were statistically analyzed and the results are shown in Table 6.

[0055] Table 6 Population genotyping and corresponding phenotypic statistical results

[0056] genotype quantity 2022SF 2023SL 2023SF BLUE A 80 0.50 0.52 0.52 0.52 B 88 0.48*** 0.50*** 0.50*** 0.50***

[0057] The results showed that the KASP primer set could successfully type 184 families, including 80 genotypes of type A, 88 genotypes of type B, and 15 genotypes of type H. The remaining families were not successfully typed due to DNA quality issues and were recorded as type X. Based on the typing results, the phenotypes corresponding to the A and B2 genotypes were statistically analyzed for differences in grain roundness (P < 0.001), indicating that the marker is an effective marker for detecting grain roundness.

[0058] The embodiments described above are only descriptions of the preferred modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations, modifications, and substitutions made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The major gene locus QGr.cib-5A associated with wheat grain roundness is characterized by: The gene locus is located at 444.8-455.5 Mb on the short arm of wheat chromosome 5A.

2. The gene locus according to claim 1, characterized in that: The gene locus is amplified and identified by molecular markers 55k-31 and 5A4-15; The molecular marker 55k-31 includes three primers, and the sequences are: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; the molecular marker 5A4-15 includes three primers, and the sequences are: SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:

6.

3. A KASP molecular marker for identifying whether wheat contains QGr.cib-5A, characterized in that: The molecular markers include molecular markers 55k-31 and 5A4-15; The molecular marker 55k-31 includes three primers, and the sequences are: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3; The molecular marker 5A4-15 includes three primers, and the sequences are: SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:

6.

4. A method for identifying whether wheat contains QGr.cib-5A using the molecular marker of claim 3, characterized in that: If the PCR amplification products of molecular marker 55k-31 and / or molecular marker 5A4-15 are detected to be fluorescent, it is identified that the wheat contains QGr.cib-5A.

5. A method for identifying the QGr.cib-5A genotype in wheat using the molecular marker of claim 3, characterized in that: If the forward primers of molecular marker 55k-31 and molecular marker 5A4-15 detect fluorescence, it is judged that the corresponding base at 445243555bp is CC and the corresponding base at 445436340bp is AA; if the reverse primers of molecular marker 55k-31 and molecular marker 5A4-15 detect fluorescence, it is judged that the corresponding base at 445243555bp is GG and the corresponding base at 445436340bp is GG.

6. A product for screening round-grain wheat varieties prepared using the gene locus QGr.cib-5A described in claim 1 or 2 or the molecular marker described in claim 3.

7. A product for screening long-grain wheat varieties prepared using the gene locus QGr.cib-5A described in claim 1 or 2 or the molecular marker described in claim 3.

8. A method for screening and identifying round-grain wheat varieties using the molecular markers of claim 3, characterized in that: If the sample to be tested contains QGr.cib-5A, and the corresponding bases are CC and AA, the sample is identified as round-grain wheat.

9. A method for screening and identifying long-grain wheat varieties using the molecular markers of claim 3, characterized in that: If the sample to be tested is found to contain QGr.cib-5A, and the corresponding bases are GG, GG, then the sample is identified as long-grain wheat.

10. Use of the gene locus QGr.cib-5A according to claim 1 or 2 or the molecular marker according to claim 3 in wheat breeding.

Images