SNP (Single Nucleotide Polymorphism) molecular marker related to ear length of corn under low-phosphorus condition and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to ear length of corn under a low-phosphorus condition and application of the SNP molecular marker, and belongs to the technical field of molecular genetic markers. The SNP molecular marker comprises an SNP (Single Nucleotide Polymorphism) (209022198) and an SNP (Single Nucleotide Polymorphism) (209022765) which are positioned on a chromosome 5 of a corn Zm-B73-REFERENCE-NAM-5. 0 reference genome. SNP-209022198 is located at the position of 209022198bp of a No. 5 chromosome of a corn genome, and the variation type is T / C; the SNP-209022765 is located at the position 209022765bp of a chromosome 5 of a corn genome, and the variation type of the SNP-209022765bp is G / A. The SNP molecular marker obviously related to the corn ear length disclosed by the invention can be used for molecular assisted breeding of the corn ear length character under a low-phosphorus condition, and the corn ear length character is screened and a long-ear corn variety is cultivated through molecular breeding improvement, so that the corn yield is increased.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetic markers, and in particular relates to SNP markers related to corn ear length under low-phosphorus conditions and applications thereof. Background Art

[0002] Corn is an important food and cash crop. In 2023, the national grain planting area is 1.499 billion mu, and the corn planting area is 663 million mu. It is crucial to the national economic plan and food security. Phosphorus is one of the three essential elements and seriously affects corn yields. Domestic farmland soil is in a low-phosphorus state. China has suffered serious phosphorus losses and large phosphorus loads for many years, accounting for about 30% of the global anthropogenic phosphorus load of freshwater. And phosphorus is a non-renewable resource. In the agricultural field, phosphorus mainly relies on external phosphate fertilizers, but phosphate fertilizers are expensive, and excessive use can cause serious environmental pollution. Therefore, screening low-phosphorus-tolerant and phosphorus-efficient crop varieties is the main solution to solve the environmental pollution caused by soil phosphorus deficiency and excessive phosphate fertilizers. Corn ear length is an important indicator of yield. Often, the longer the ear length, the higher the yield of the material. Therefore, detecting the genotype of corn ear length under low-phosphorus conditions in corn not only helps to screen out corn germplasm resources that can have higher ear length under low-phosphorus conditions, but also provides a scientific basis for breeding corn varieties with longer ear length under low-phosphorus conditions.

[0003] Genome-wide association study (GWAS) is an important method in crop genetic breeding research. Its theoretical basis is linkage disequilibrium (LD). Its main purpose is to find single nucleotide polymorphisms (SNPs) associated with specific traits. This method detects phenotypes and genotypes and combines the two to find SNPs associated with specific traits. These SNPs are variable sites in the genome and are very likely to affect gene expression, thereby causing phenotypic changes.

[0004] Competitive allele-specific PCR (KASP) is a genotyping technology based on fluorescence detection, mainly used to detect SNP variations. This technology detects SNP sites based on the specific matching of the terminal bases of the primers, that is, the fluorescence reading after the PCR reaction is completed. Generally, this experiment uses a primer set consisting of two specific upstream primers and a universal downstream primer. The terminal bases of the two upstream primers correspond to the two alleles of the SNP site to be tested, and each site has three possible genotypes (homozygous 1, homozygous 2 or heterozygous). The 5' end of primer 1 is connected to the FAM fluorescent label sequence, and the 5' end of primer 2 is connected to the HEX fluorescent label sequence. The probe is usually provided by MIX reagent. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides two SNP molecular markers related to corn ear length under low-phosphorus conditions.

[0006] Specifically, the inventor of this patent has found that there are two SNPs located at 209022198 and 209022765 on chromosome 5 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome that are strongly associated with the maize ear length trait under low phosphorus conditions. The two SNPs are located in the Zm00001eb252100 gene, which is annotated as bHLH transcription factor 29. These two SNP molecular markers can form two major haplotypes TG (H001) and CA (H002). Statistical analysis of ear length phenotypes found that the ear length of the Hap1 inbred line is significantly longer than that of the Hap2 inbred line.

[0007] The SNP molecular markers associated with corn ear length under low-phosphorus conditions provided by the present invention include SNP-209022198 and SNP-209022765; SNP-209022198 is located at 209022198bp on chromosome 5 of the corn genome, and the variation type is T / C; SNP-209022765 is located at 209022765bp on chromosome 5 of the corn genome, and the variation type is G / A.

[0008] The present invention also provides a primer set for detecting molecular markers of corn ear length under low-phosphorus conditions, which consists of four specific forward primers shown in SEQ ID No. 1-3 and SEQ ID No. 4-6 in the sequence table and two universal reverse primers.

[0009] The SNP molecular markers provided by the present invention can be used in the following applications:

[0010] (1) Detect corn ear length under low phosphorus conditions;

[0011] (2) Maize genetic breeding and germplasm resource improvement;

[0012] The present invention also provides a method for detecting corn ear length under low-phosphorus conditions, comprising the following steps: sequencing corn genes, and detecting the genotype of the SNP molecular marker of the present invention according to the sequencing results, and when the haplotype composed of the SNP markers at the 209022198 bp position and the 209022765 bp position on chromosome 5 is TG, the corn has a longer ear length trait. The sequencing method includes but is not limited to whole genome resequencing, targeted sequencing or multiplex PCR sequencing.

[0013] The present invention also provides a breeding method for increasing corn ear length under low-phosphorus conditions, comprising the following steps: performing genotype detection on the above-mentioned SNP markers in corn samples, and selecting corn samples with TG haplotypes for breeding.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The SNP molecular marker significantly associated with corn ear length disclosed in the present invention can be used in the molecular assisted breeding of corn ear length traits, and through molecular breeding improvement, the corn ear length trait can be screened out, and long-ear corn varieties can be cultivated, thereby increasing corn yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a violin plot of the ear length phenotype corresponding to the haplotype formed by the combination of two SNPs in the present invention. Among them, the difference between H001 and H002 is extremely significant (****, P-value<0.0001).

[0017] Figure 2 It is the linkage relationship diagram of the two SNPs in the present invention. SNP-209022198 and SNP-209022765 are strongly linked.

[0018] Figure 3 This is the Manhattan plot of the significant SNP sites on chromosome 5 obtained by GWAS using the MLM model.

[0019] Figure 4 This is the QQ plot of GWAS using the MLM model.

[0020] Figure 5 This is a graph showing the genotyping results using KASP. DETAILED DESCRIPTION

[0021] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0022] Example 1

[0023] 1. Phenotypic determination

[0024] In 2019 and 2021, 359 maize inbred lines were planted in high and low phosphorus plots at the Shangzhuang Experimental Station of China Agricultural University, including 239 temperate and 120 tropical / subtropical inbred lines. The soil available phosphorus content was 2.10 mg / kg in low phosphorus plots and 4.50 mg / kg in normal phosphorus plots in 2019, and 2.72 mg / kg in low phosphorus plots and 4.67 mg / kg in normal phosphorus plots in 2021. The ear length (EL) phenotype was measured under normal phosphorus and low phosphorus conditions, and the secondary index was constructed according to the Best Linear Unbiased Prediction (BLUP) value of each trait:

[0025] LPTI = BLUP under low phosphorus stress / BLUP under normal phosphorus

[0026] 2. Genome-wide association analysis

[0027] 359 maize inbred lines were sequenced by a sequencing company. PLINK software was used to perform quality control on 980K high-density SNP markers (MAF>5%; missing rate<20%), and PLINK was used to calculate the number of independent markers, window size, step size, and r 2 The parameters were set to 50, 50, and 0.2, respectively, and 128,197 independent markers were obtained. PCA analysis was performed using TASSEL software to prevent population stratification. The marker data and the constructed secondary indicators were then associated with a mixed linear model (MLM), and the significance threshold was set to -logP-value>4, and two significant SNP sites in the present invention, SNP-209022198 and SNP-209022765, were obtained (see the specific results). Figure 2 ).

[0028] Haplotype construction was performed using the geneHapR package in R studio software, and four haplotypes consisting of two loci were obtained. Haplotypes with sample numbers <15 were removed, and the remaining two haplotypes were used to draw a violin plot of the LPTI index of spike length using the ggplot package (see the specific results for details). Figure 1 ), the results showed that the ear length of corn under low-phosphorus conditions was significantly different between the haplotype H001 and the haplotype H002 (****, P-value<0.0001), that is, corn with the H001 haplotype had a longer ear length under low-phosphorus conditions.

[0029] Table 1 shows the haplotypes formed by the combination of two SNPs in the present invention and their numbers in the GWAS population

[0030] -------- 209022198 209022765 COUNT ALLELE T / C G / A H001 T G 300 H002 C A 50

[0031] Example 2

[0032] Primer design

[0033] There are SNP mutations at 209022198bp and 209022765bp on chromosome 5 of the maize reference genome Zm-B73-REFERENCE-NAM-5.0, and the polymorphisms are T / C and G / A, respectively. The 100bp flanking sequences before and after the two sites were extracted to design primers, respectively. The two primer sets consist of 3 primers, of which the 5' ends of the two specific forward primers are connected to the FAM and HEX fluorescent linker sequences, respectively, and 1 universal reverse primer. The primers were commissioned to Qingke Biosynthesis, and the primer purification method was ULTRAPAGE. The sequence of primer set 1 is as follows (5' to 3'):

[0034] SEQ ID NO.1 (SNP1-F1):

[0035] GAAGGTGACCAAGTTCATGCT GCTGGTTTGTTGTGGGAACATGT T;

[0036] SEQ ID NO.2 (SNP1-F2):

[0037] GAAGGTCGGAGTCAACGGATT CTGGTTTGTTGTGGGAACATGT C;

[0038] SEQ ID NO.3 (SNP1-R):

[0039] AGAGCTTCAGATTACAAGCAAAGCAAAG

[0040] Among them, the uppercase bases on the left of SEQ ID NO. 1 and 2 are tag sequences.

[0041] PCR was performed on the extracted DNA using specific primers of SEQ ID NO.1-3. If only FAM fluorescence signal was detected in the PCR product, the detection site base was TT; if HEX fluorescence signal was detected, the detection site base was CC; if both FAM and HEX fluorescence signals were detected, the detection site base was TC, and the test material was a heterozygous genotype.

[0042] The sequences of primer set 2 are as follows (5' to 3'):

[0043] SEQ ID NO.4 (SNP2-F1):

[0044] GAAGGTGACCAAGTTCATGCT GTAACTTCTGGCTTGTTCTTGAGG A;

[0045] SEQ ID NO.5 (SNP2-F2):

[0046] GAAGGTCGGAGTCAACGGATT GTAACTTCTGGCTTGTTCTTGAGG G;

[0047] SEQ ID NO.6 (SNP2-R):

[0048] TGCACAATTTCAGTCGGTAGAAAGTGAGT;

[0049] Among them, the capitalized bases on the left of SEQ ID NO. 4 and 5 are tag sequences.

[0050] PCR was performed on the extracted DNA using specific primers of SEQ ID NO.4-6. If only FAM fluorescence signal was detected in the PCR product, the detection site base was AA; if HEX fluorescence signal was detected, the detection site base was GG; if both FAM and HEX fluorescence signals were detected, the detection site base was AG, and the test material was a heterozygous genotype.

[0051] Example 3

[0052] 1. Extract DNA using Magen's plant DNA extraction kit

[0053] (1) 20 corn materials were selected for seedling in a greenhouse, 30 mg of leaves were taken and placed in a 2 ml EP tube and magnetic beads were placed in the tube.

[0054] (2) Mark the tube cap and place it in a centrifuge tube plate. Use liquid nitrogen to quickly freeze the leaves, and then place the frozen sample in a grinder for grinding.

[0055] (3) Add 700 μl of Buffer PAL preheated to 65°C to each tube and mix thoroughly using a vortex machine. After mixing, place the sample in a 65°C water bath for 30 minutes, mixing 2-3 times during the process.

[0056] (4) Add 700 μl of Buffer BDP to each tube, vortex to mix thoroughly, and centrifuge at 12,000 × g for 5 minutes at room temperature.

[0057] (5) Transfer 600 μl of supernatant to a new centrifuge tube, add 600 μl of Buffer GWP, and mix by inverting 6-8 times.

[0058] (6) Place the purification column in a collection tube and transfer the mixture to the purification column twice. Centrifuge at 10,000 × g for 1 minute after each transfer. Discard the filtrate, add 400 μl Buffer GWP to the column, and centrifuge at 10,000 × g for 1 minute.

[0059] (7) Pour off the filtrate, add 750 μl of Buffer SW2 to the column, and centrifuge at 10,000 × g for 1 minute. Pour off the filtrate, and centrifuge at 10,000 × g for another 1 minute.

[0060] (8) Transfer the column to a new 1.5 ml centrifuge tube, add Elution Buffer preheated to 65°C to the column, let stand at room temperature for 3 minutes, and centrifuge at 10,000 × g for 1 minute.

[0061] (9) Discard the binding column, detect the DNA concentration, and dilute the concentration to 10 ng / μl for subsequent experiments.

[0062] 2. KASP experiment

[0063] The KASP experiment used FLU-ARMS for KASP 2×PCRMixV5F produced by Guangzhou Good Biotechnology Co., Ltd. and included the following steps:

[0064] (1) Prepare PCR reaction solution on ice:

[0065] Adding components Dosage (10μl system) DNA samples 4.5μl FLU-ARMS2×PCRMix 5μl Forward specific primer F1 (10 μM) 0.1μL Forward specific primer F2 (10 μM) 0.1μL Reverse universal primer R (10 μM) 0.3μL Refill to 10 μL

[0066] (2) PCR reaction conditions:

[0067]

[0068] The reaction uses a BIORAD CFX96 fluorescence quantitative PCR instrument to read the fluorescence data of the KASP reaction product, and the results of the fluorescence scan are automatically converted into graphics.

[0069] The results of marker typing are as follows Figure 5 As shown, "○" represents the genotype showing FAM fluorescence, "◇" represents the genotype showing HEX fluorescence, and "×" represents the NTC control. The ear lengths of the test materials are shown in Table 2, and the results are in line with expectations.

[0070] Table 2 KASP typing of 20 randomly selected genotypes and their spike length under low-P and normal-P conditions

[0071]

[0072]

[0073] The results show that the two SNP molecular markers provided by the present invention can accurately detect the length of corn ear under low-phosphorus conditions. It is only necessary to detect the haplotype composed of the SNP markers and select corn samples with TG haplotypes for breeding, so as to quickly select corn varieties with longer ear length traits under low-phosphorus conditions.

[0074] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with corn ear length under low phosphorus conditions, characterized in that: The SNP molecular markers include SNP-209022198 and SNP-209022765 located on chromosome 5 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome. SNP-209022198 is located at 209022198bp on chromosome 5 of the maize genome, and the variation type is T / C; SNP-209022765 is located at 209022765bp on chromosome 5 of the maize genome, and the variation type is G / A.

2. A primer set, characterized in that: It comprises a molecular marker for detecting ear length of corn under low phosphorus conditions, the molecular marker is as described in claim 1, and the primer set consists of four specific forward primers shown in SEQ ID No.1-3 and SEQ ID No.4-6 in the sequence table and two universal reverse primers.

3. The SNP molecular marker according to claim 1 is used in any of the following applications: (1) Detect corn ear length under low phosphorus conditions; (2) Corn genetic breeding and germplasm resource improvement.

4. A method for detecting ear length traits of corn under low phosphorus conditions, characterized in that: The steps are as follows: using the genomic DNA of the corn to be tested as a template, PCR amplification is performed using a primer set consisting of six single-stranded DNAs shown in SEQ ID No. 1-3 and SEQ ID No. 4-6 in the sequence table.

5. Application of the method described in claim 4 in detecting ear length of corn under low-phosphorus conditions.

6. A breeding method for increasing corn ear length under low phosphorus conditions, characterized in that: The method comprises the following steps: performing genotype detection on the SNP marker described in claim 1 in corn materials, and selecting corn materials with TG haploid type for breeding.

Images