Herpetospermum pedunculosum gene, herpetospermum pedunculosum Indel molecular marker, herpetospermum pedunculosum detection product and application thereof in sex determination of herpetospermum pedunculosum

Abstract

The invention belongs to the technical field of plant genes and molecular markers, and particularly relates to a herpetospermum pedunculosum gene, a herpetospermum pedunculosum Indel molecular marker, a herpetospermum pedunculosum detection product and application of the herpetospermum pedunculosum detection product in sex determination of herpetospermum The herpetospermum pedunculosum gene is a gene specifically existing in a herpetospermum pedunculosum male plant and does not exist in a female plant. Based on the polymorphism of the herpetospermum pedunculosum gene in a male herpetospermum pedunculosum plant and a female herpetospermum pedunculosum plant, the invention also provides a herpetospermum pedunculosum Indel molecular marker and an amplification primer of the herpetospermum pedunculosum Indel molecular marker, the herpetospermum pedunculosum Indel molecular marker and the amplification primer can efficiently identify the sex of the herpetospermum pedunculosum plant, and the accuracy is as high as 100%; meanwhile, the identification effect is suitable for the herpetospermum pedunculosum of different populations and different development stages, so that the sex identification of the herpetospermum pedunculosum can be realized before the flowering of the herpetospermum pedunculosum, and the method has a very high guidance value for the cultivation, breeding and large-scale production of the herpetospermum pedunculosum.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genes and molecular markers, and particularly relates to a pear-shaped melon gene, a pear-shaped melon Indel molecular marker, a pear-shaped melon detection product and application thereof in pear-shaped melon sex identification. Background Art

[0002] Herpetospermum belongs to the genus Herpetospermum of the Cucurbitaceae family. This species grows in the hillside shrubs, forest edges or roadsides at an altitude of 2300-3500 meters. It is an annual climbing herb with dioecious plants. The seeds of Herpetospermum contain alkaloids, tannins, sterols, amino acids, triterpenes and other ingredients. It has the effects of clearing away heat and detoxifying, and softening the liver. It is mainly used to treat icteric infectious hepatitis and indigestion. It is widely used in Tibetan medicine.

[0003] At present, the field mostly cultivates the melon through artificial cultivation, and seed propagation is the main way to grow the melon. The seeds of the melon are used as medicinal materials, and the economic value of female plants is much higher than that of male plants. However, due to the dioecious nature of the melon, it is impossible to distinguish between male and female from the seed morphology; the morphological characteristics of male and female plants during the vegetative period are very similar, and the male and female sexes cannot be accurately identified before flowering. In addition, the proportion of female melon plants in natural populations is relatively low. If the male plants are artificially removed after flowering, the excessive male plants that have grown will occupy a large amount of space and land resources, which will result in a waste of resources and low yields. Therefore, it is necessary to identify the gender of the melon plant during the seedling stage and before the seedling stage, and to provide more resources and space for the female plants by artificially removing a certain amount of male plants to increase seed yield.

[0004] Traditional plant sex identification is mostly based on the external morphology of male and female plants, or based on their physiological and biochemical differences, chromosome karyotypes, isozyme maps, specific protein content and nucleotide differences. However, these methods mostly determine the differences between male and female plants based on the morphology of mature individuals, and the accuracy of seedling identification is low. With the development of molecular biotechnology, more and more methods using molecular markers are used for sex identification of dioecious plants, which improves the above problems. For example, in some studies, the sex of Porphyra edulis is identified based on specific SCAR molecular markers. However, there are currently no genes in the art that can identify the sex of Porphyra edulis and Indel molecular markers developed based on the genes. Summary of the invention

[0005] The object of the present invention is to provide a pomelo gene, a pomelo Indel molecular marker, a pomelo detection product and their application in pomelo sex identification. The pomelo gene is a gene that specifically exists in male pomelo plants and does not exist in female plants. The Indel molecular marker developed based on the above characteristics can realize the identification of pomelo, especially the sex identification of pomelo.

[0006] The present invention provides a P. melanocarpa gene, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0007] The present invention also provides a Cucurbita oleracea Indel molecular marker, wherein the Cucurbita oleracea Indel molecular marker has a deletion or insertion polymorphism of a nucleotide as shown in SEQ ID NO:1 or SEQ ID NO:2.

[0008] The present invention also provides amplification primers for the Indel molecular marker of P. melanocarpa described in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the amplification primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0009] The present invention also provides the use of the Pomelo gene described in the above technical solution, the Pomelo Indel molecular marker described in the above technical solution, or the amplification primer described in the above technical solution in one or more of the reagents, kits, liquid probes and chips used for Pomelo detection.

[0010] The present invention also provides a product for detecting pomelo, which includes the amplification primers described in the above technical solution; the type of the product includes one or more of a reagent, a kit, a liquid probe and a chip.

[0011] The present invention also provides the use of the pomelo gene described in the above technical solution, the Indel molecular marker described in the above technical solution, the amplification primer described in the above technical solution, or the pomelo detection product described in the above technical solution in identifying pomelo.

[0012] Preferably, the identifying of the Pomelo includes identifying the gender of the Pomelo.

[0013] Preferably, the Pear melon includes a Pear melon whose developmental stage is the seedling stage and / or before the seedling stage.

[0014] Preferably, the identification is performed based on the PCR amplification band or PCR amplification sequence of the P. melanocarpa Indel molecular marker.

[0015] The present invention also provides a method for identifying the sex of Porcupine melon, comprising the following steps:

[0016] Using the genomic DNA of the to-be-tested P. melanocarpa as a template, PCR amplification is performed using the amplification primers described in the above technical solution to obtain a PCR amplification product;

[0017] Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result;

[0018] The sex of the tested melon is identified according to the electrophoresis detection result:

[0019] When the electrophoresis test results show a specific PCR amplification band of 369 bp, the tested melon is a male plant;

[0020] When the result of the electrophoresis test shows that there is no specific PCR amplification band of 369 bp, the tested Melon is a female plant.

[0021] Beneficial effects:

[0022] The present invention provides a melon gene, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2. The melon gene of the present invention is a gene that specifically exists in male melon plants and does not exist in female plants.

[0023] Based on the polymorphism of the Ponzu gene in male and female Ponzu plants, the present invention also provides a Ponzu Indel molecular marker and an amplification primer for amplifying the Ponzu Indel molecular marker. The Ponzu Indel molecular marker and the amplification primer can efficiently identify the sex of Ponzu plants with an accuracy of up to 100%. At the same time, the identification effect is applicable to Ponzu of different populations and different developmental stages, and thus the sex of Ponzu can be identified before it blooms, which has a high guiding value for the cultivation, breeding and large-scale production of Ponzu. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0025] Figure 1 The comparison result of specific genomic fragments in male plants of Melon officinalis in Example 1;

[0026] Figure 2 This is a graph showing the gel electrophoresis test results of the PCR primer pair M-219605R in Example 2 in four population samples of Gastrodia elata;

[0027] Figure 3 This is a graph showing the gel electrophoresis test results of the PCR primer pair chr573789139 in Comparative Example 1 in four population samples of Pallonia ovata;

[0028] Figure 4 This is a graph showing the gel electrophoresis test results of the PCR primer pair 960-CDS-1 in Comparative Example 2 in four population samples of Pallonia ovata;

[0029] Figure 5 The figure is the gel electrophoresis test result of the PCR primer pair chr5-9-p1 in the four population samples of the melon in comparative example 3;

[0030] Figure 6 The figure is the gel electrophoresis test result of PCR primer pair 6797098-1FA in four population samples of P. melanocarpa in comparative example 4;

[0031] Figure 7 This is a graph showing the gel electrophoresis test results of PCR primer pair 21965-FS-5 in comparative example 5 in four population samples of Melon officinalis. DETAILED DESCRIPTION

[0032] The present invention provides a P. melanocarpa gene, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0033] The present invention discovered a gene that specifically exists in male plants of G. melon by resequencing a population of G. melon, and the gene does not exist in female plants of G. melon. At the same time, through comparison, it was found that there is a SNP site at the 145th base of the gene, and the SNP has a G / T polymorphic variation. The nucleotide sequence of the G. melon gene obtained is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and is specifically as follows:

[0034] The nucleotide sequence shown in SEQ ID NO:1 is: 5'-TCCCGTCATCGGCGAGTTTCTTA ACGCAGGTTCGCTCAAGGATGTGAGCTGTCCCGTCAACGAAGACCTCTCACTTTCAACTAACAAAGAATCTCCGTTTCTTGTCTCCCTTGGCGCTAATGAAAGCGTCAGTCATTCTGTGGCGTCGGAACCGTCTTCAACGACGTCGTTTCTAGGCATCATTCGGCGGGGCTTGCC CTTTGATCTCAACGAACCTCCGCCGTATTGGCTGTAAATGAACCGATTGCGCGTAGAAGCGAAATTTCAGTACTTATTTTCTTCTCTTAACATCCTTTGTTCTATTTACTTGTATTATCCGCAATCATTTTCTGCAATTGAACTTAAAAGGCTGTCGCCTCTCCTTCAGAA-3';

[0035] The nucleotide sequence shown in SEQ ID NO:2 is: 5'-TCCCGTCATCGGCGAGTTTCTTA ACGCAGGTTCGCTCAAGGATGTGAGCTGTCCCGTCAACGAAGACCTCTCACTTTCAACTAACAAAGAATCTCCGTTTCTTGTCTCCCTTGGCGCTAATGAAAGCGTCAGTCATTCTGTGGCTTCGGAACCGTCTTCAACGACGTCGTTTCTAGGCATCATTCGGCGGGGCTTGCC CTTTGATCTCAACGAACCTCCGCCGTATTGGCTGTAAATGAACCGATTGCGCGTAGAAGCGAAATTTCAGTACTTATTTTCTTCTCTTAACATCCTTTGTTCTATTTACTTGTATTATCCGCAATCATTTTCTGCAATTGAACTTAAAAGGCTGTCGCCTCTCCTTCAGAA-3'.

[0036] The bases in bold italics in the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 are the positions where the SNP site exists.

[0037] The present invention also provides a Cucurbita oleracea Indel molecular marker, wherein the Cucurbita oleracea Indel molecular marker has a deletion or insertion polymorphism of a nucleotide as shown in SEQ ID NO:1 or SEQ ID NO:2.

[0038] The present invention also provides amplification primers for the Indel molecular marker of P. melanocarpa described in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the amplification primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0039] The nucleotide sequences shown in SEQ ID NO:3 and SEQ ID NO:4 of the present invention are as follows:

[0040] The nucleotide sequence shown in SEQ ID NO: 3 is: 5'-TCCCGTCATCGGCGAGTTTCT-3'; the nucleotide sequence shown in SEQ ID NO: 4 is: 5'-TTCTGAAGGAGAGGCGACAGC-3'.

[0041] The present invention also provides the use of the Pomelo gene described in the above technical solution or the Pomelo Indel molecular marker described in the above technical solution or the amplification primer described in the above technical solution in one or more of the reagents, kits, liquid phase probes and chips for Pomelo detection. As an embodiment, the product described in the present invention is a kit.

[0042] The present invention also provides a product for the detection of melon, the product comprising the amplification primers described in the above technical solution; the type of the product comprises one or more of a reagent, a kit, a liquid phase probe and a chip. As an embodiment, the type of the product of the present invention is a kit. As an embodiment, the product of the present invention also includes a PCR amplification reagent. The present invention does not specifically limit the source and specification of the PCR amplification reagent, and a PCR amplification reagent from a conventional source in the art can be used.

[0043] The present invention is based on the polymorphism of the Ponzu gene in male and female Ponzu plants, and also provides a Ponzu Indel molecular marker and an amplification primer for amplifying the Ponzu Indel molecular marker. The Ponzu Indel molecular marker and the amplification primer can efficiently identify the sex of Ponzu plants with an accuracy of up to 100%. Meanwhile, the identification effect is applicable to Ponzu of different populations and different developmental stages, and further the sex of Ponzu can be identified before the Ponzu blooms, which has a high guiding value for the cultivation, breeding and large-scale production of Ponzu.

[0044] Based on the above advantages, the present invention also provides the use of the Pomelo gene described in the above technical solution, or the Indel molecular marker described in the above technical solution, or the amplification primer described in the above technical solution, or the Pomelo detection product described in the above technical solution in identifying Pomelo. As an embodiment, the identification of Pomelo described in the present invention includes identifying the sex of Pomelo. As an embodiment, the Pomelo described in the present invention includes Pomelo whose development stage is the seedling stage and / or before the seedling stage; as another embodiment, the Pomelo is a Pomelo whose development stage is the seedling stage. As an embodiment, the present invention performs the identification based on the PCR amplification band or PCR amplification sequence of the Indel molecular marker.

[0045] The present invention also provides a method for identifying the sex of Porcupine melon, comprising the following steps:

[0046] Using the genomic DNA of the to-be-tested P. melanocarpa as a template, PCR amplification is performed using the amplification primers described in the above technical solution to obtain a PCR amplification product;

[0047] Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result;

[0048] The sex of the tested melon is identified according to the electrophoresis detection result:

[0049] When the electrophoresis test results show a specific PCR amplification band of 369 bp, the tested melon is a male plant;

[0050] When the result of the electrophoresis test shows that there is no specific PCR amplification band of 369 bp, the tested Melon is a female plant.

[0051] As an embodiment, the present invention extracts genomic DNA of the tested kiwi. The present invention does not specifically limit the method for extracting the genomic DNA, and the conventional extraction method in the art can be used for extraction, such as extraction using a commercially available kit or a traditional CTAB method. As an embodiment, the tested kiwi of the present invention includes kiwis whose development stage is the seedling stage and / or before the seedling stage; as another embodiment, the kiwi is a kiwi whose development stage is the seedling stage. In a specific embodiment, the kiwi is a kiwi leaf in the seedling stage.

[0052] After obtaining the genomic DNA of the to-be-tested tangerine, the present invention performs PCR amplification using the amplification primers described in the above technical solution to obtain a PCR amplification product. As an embodiment, the PCR amplification system of the present invention includes the following components: 2×TaqPCRMasterMix 12.5μL, upstream primer 1μL with a concentration of 10μM / L, downstream primer 1μL with a concentration of 10μM / L, genomic DNA 1μL and ddH 2 As an embodiment, the PCR amplification program of the present invention is: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, a total of 37 cycles; 72°C extension for 7 min.

[0053] After obtaining the PCR amplification product, the present invention performs electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result. As an embodiment, the electrophoresis detection of the present invention is agarose gel electrophoresis detection; as another embodiment, the agarose gel is 1% to 2% agarose gel.

[0054] The present invention identifies the sex of the tested tangerine melon according to the result of the electrophoresis test: when the result of the electrophoresis test shows a specific PCR amplification band of 369 bp, the tested tangerine melon is a male plant; when the result of the electrophoresis test shows no specific PCR amplification band of 369 bp, the tested tangerine melon is a female plant. As an embodiment, when the electrophoresis test results show other situations except the above two situations, the test is re-performed to confirm whether it is a problem caused by the test operation.

[0055] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1

[0057] The discovery of the kiwifruit gene was done in the following steps:

[0058] 1. Sample Collection

[0059] The samples were 20 male and 24 female Melon leaves collected in Shangri-La in 2022. The collected leaf materials were preserved in silica gel for subsequent total DNA extraction and PCR amplification experiments.

[0060] 2. Genomic DNA Extraction and Resequencing

[0061] The CTAB method was used to extract genomic DNA from 20 male and 24 female individuals of Melon pear, and the quality and quantity of the DNA were evaluated by 0.8% agarose gel, Nanodrop 2000 spectrophotometer and Qubit fluorescence spectrophotometer. Specifically, the quality of the DNA was evaluated by spectrophotometer, and the ratio of A260 / A280 was about 1.8, indicating that the purity of the DNA met the requirements for library construction and sequencing; the Qubit fluorescence spectrophotometer was used to accurately quantify the DNA, and the total amount of DNA required for a single library of the detection sample was greater than or equal to 10 ng.

[0062] The genomic DNA of each individual was randomly fragmented into 350 base pair fragments, and the library was prepared using the Vazyme NDM607-01 kit and paired-end sequencing was performed on the Illumina PE 150 platform.

[0063] Fastp 0.12.4 was used with default parameters to control the quality of the raw data and obtain clean data. Then, the read data from 20 male and 24 female plants were compared with the reference genome using BWA0.7.17-r1188 and default parameters, and the duplicate read data were deduplicated using Picard software; Indel (insertion and deletion variation) detection was performed using the genome analysis software GATK4.2.2.0, and multiple specific genomic fragments were found in male samples of Porcupine melon, while female samples of Porcupine melon did not contain this specific genomic fragment. The nucleic acid sequences of multiple genomic fragments are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9; At the same time, through comparison, it was found that the specific genomic fragments shown in SEQ ID NO:1 or SEQ ID NO:2 also had individual differences in different male samples of Porcupine melon, and there was a C / T polymorphic SNP site in individual male samples of Porcupine melon (such as Figure 1 Therefore, the nucleotide sequence of this specific genomic fragment is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the SNP site is located at the 145th base position of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. The specific genomic fragment has 86.42% similarity with the ethylene response transcription factor 12 gene in Momordica charantia (NCBI: LOC111025114).

[0064] The nucleotide sequence shown in SEQ ID NO:5 is as follows: 5'-GCCCTAGCTCACGGAATTTGTG AAGGTATATGGATTGACAGGATACTCGAAGAACTGAAATTATCTCAAAATGATCCTATACGAAAATATTGTGATAACAAGGCGATCATCGCTATAACTCATAATCATGTTCTACATGATAGGACAGCATATTGAAGTTGACAAGCATTTCATAAAGGAGAAGATTGATGCAGGTGTAATATGTTGTTAGGACACCACCTAACGGAATCAAGAACAACGATGTATTGCAATGAAAAGGTAAAAGAATTACAAGATAAGCAAGTGTTTAAAGGTACTTGCACCCTCCCATCTTGAGAACTATCTCAAGCCCTAATCCACTTAACCATTGACTACCTTCCTCTAATCTCACTCCCTCTATTTATAACCATATACTCTAACTAACTTCCTAAGTAATTACCCTATATGCCCTTACTACTAAACTTACAAAGGATAAACAACAATTAACCAATTAAGATAAAGATTTTGAAAAGATAAAACAGGCAAAAGATTTAGAAAGAGAACACCAGGAGGAAGCCTTCAGGCAGGCTGCTTCATACAATCTAGCC-3';

[0065] The nucleotide sequence shown in SEQ ID NO:6 is: 5'-AGGAGTGAGAAAGAGGCCGTG GGGGCGTTACGCAGCTGAGATTCGCGATCCATGGAAGAAGAGCAGGGTATGGCTCGGTACTTTTGACACACCGGAAGAGGCTGCTCATGCTTACGACGGAGCTGCCAGGTCTCTACGTGGTGCGAAAGCAAAAACTAACTTTCCCCCGCCGATTAAGGCTGGTCTCTCCTTCGACCTTAACGTCTCCTCTGGATCTCACTTGTGTACCTCCCACTCCGGTCATCCCGTCATCGGCGAGTTTCTTAACGCAGGTTCGCTCAAGGATGTGAGCTGTCCCGTCAACGAAGACCTCTCACTTTCAACTAACAAAGAATCTCCGTTTCTTGTCTCCCTTGGCGCTAATGAAAGCGTCAGTCATTCTGTGGCGTCGGAACCGTCTTCAACGACGTCGTTTCTAGGCATCATTCGGCGGGGCTTGCCCTTTGATCTCAACGAACCTCCGCCG-3';

[0066] The nucleotide sequence shown in SEQ ID NO:7 is: 5'-GCCCTAATCCACTTAACCATTGA CTACCTTCCTCTAATCTCACTCCCTCTATTTATAACCATATACTCTAACTAACTTCCTAAGTAATTACCCTATATGCCCTTACTACTAAACTTATCAACAAGTTGGCTATGGAAGATATCTACAAGCAAGCTCGAGGGGGAGTGTTGGATTTCCTTGATATCTTTTATAATATTTGTTGTGTATTATGTGTATAATTACTATTTTTTTTTAAACAGGACACAAAAGTTTTCATTGA-3';

[0067] The nucleotide sequence shown in SEQ ID NO:8 is as follows: 5'-CAATTGTTAGCCTAGTCCTAGTT CATTTCTGAAATTTCTGATTTTGGCTCCGACCTCTCTCTCTACTTTGTGAACGATTTCTCTTAAAGATTCTTCGCTCAACTGACTCTAACTCTCTCTCGTACTCTAGATTGGTCCATTGGTTTCAAAGATACTTGTTATTCTTACTTGCTTGTTTGTGGTGTAAAATAATGTTATTCTCTAAGAATTTGTGATTTCTGTTCTTGTCGCTATGTTTTAACTTGTGTTGGGTTTGTTGTTTTCCAGCTCTATGAATTTTGATTAGTTTTTCGGATGGCTTTATTTTTTCGTAGCTACTAAATGTTGTGGATCTGGAGTAGGCTTTTTTTTTTCTCTCCGAGATTATAATTTTTGTTTTACTTCTTTGCTTTCTTATGATTTTGTTCATTTTCTTACATGAGTCTGTTTGTTTTTTACAATTTTGTGGCATCTATGTTGTCTGAATTTGAACTTTGAAAATGCGGGACACATGTAATATTGGTTTGCATAAACTATTTCCATGTCTTGGACTGAGCCTCTGTTTCTTCTTAGATTACTTATTTTGTTCATTAAATTGGAGGAAGATACAACAGATTATTCAGGTGAAAGGAGTTTTTTGTAATACAAAAGCAGAAGTTTATAACTATTTGGTTGGCCGAGTAACAATGTTTGTTATTAACCTATTCTTAAACGGAAATTCCTAATA-3';

[0068] The nucleotide sequence shown in SEQ ID NO:9 is: 5'-TAGCTAAAATTGTTGTACCTCGC -3'.

[0069] Example 2

[0070] Development of Indel markers and amplification primers for Ponzu and identification of Ponzu sex

[0071] 1. Indel markers and amplification primers of P. melanocarpa

[0072] Based on the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 of the pear gene obtained in Example 1, the PCR primer pair M-219605R for identifying the sex of pear was designed using Oligo software. The primer information is shown in Table 1.

[0073] Table 1 Primer pair M-219605R for amplification of Indel marker of P. melanocarpa and its related information

[0074]

[0075] 2. Identification of the sex of the melon

[0076] 2.1 Sample collection

[0077] The samples of the melon were collected from the Alpine Botanical Garden in Shangri-La, Yunnan, with 12 male and female plants; the samples of the melon were collected from Wengshang Village in Shangri-La, Yunnan, with 12 male and female plants; the samples of the melon were collected from Geza Village in Shangri-La, Yunnan, with 10 female plants and 12 male plants; the samples of the melon were collected from Chentang, Tibet, with 5 male and female plants, a total of 80 leaf samples from four populations, all of which were samples of the mature stage of the melon plants. All leaf materials were preserved in silica gel.

[0078] 2.2 Extraction of genomic DNA

[0079] The genomic DNA of the 80 plants in step 2.1 was extracted using the CTAB method.

[0080] 2.3 PCR amplification

[0081] Using the genomic DNA extracted in step 2.2 as a template, the PCR primers in step 1 were used to amplify M-219605R to obtain a PCR amplification product. The amplification system is as follows:

[0082] PCR amplification system:

[0083]

[0084] PCR amplification procedure:

[0085] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 37 cycles; extension at 72°C for 7 min.

[0086] 2.3 Electrophoresis detection

[0087] The PCR amplification product obtained in step 2.2 was tested on 1% to 2% agarose gel electrophoresis and the results were observed and recorded under ultraviolet light. Figure 2 As shown, Figure 2 The marker used in the experiment is BM5000+DNAMarker (the brand of marker is Biomed). The markers used in the following comparative examples are the same and will not be described in detail.

[0088] Depend on Figure 2 It can be concluded that when the PCR primer pair M-219605R of the present invention was used to detect four population samples, the male samples of P. melanocarpa had an amplification product of 369 bp, while the female samples had no PCR product, and the detection accuracy rate reached 100%.

[0089] Comparative Example 1

[0090] Based on the nucleotide sequence shown in SEQ ID NO:5 of the Pear Cake gene obtained in Example 1, the PCR primer pair chr573789139 for identifying the sex of Pear Cake was designed using Oligo software. The primer information is shown in Table 2.

[0091] Table 2 PCR primer pair nucleotide sequence of chr573789139

[0092] chr573789139 primer Sequence (5'-3') serial number Upstream primer GCCCTAGCTCACGGAATTTGTGAAG SEQ ID NO:10 Downstream primer GGCTAGATTGTATGAAGCAGCCTGC SEQ ID NO:11

[0093] The primer pairs in Table 2 were used to identify the sex of the melon. The detection sample, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are as follows: Figure 3 shown.

[0094] Depend on Figure 3 It can be concluded that the PCR primer pair chr573789139 cannot accurately identify the gender of the Pomelo sample.

[0095] Comparative Example 2

[0096] Based on the nucleotide sequence shown in SEQ ID NO:6 of the pear-shaped melon gene obtained in Example 1, the PCR primer pair 960-CDS-1 for identifying the sex of pear-shaped melon was designed using Oligo software. The primer information is shown in Table 3.

[0097] Table 3 Nucleotide sequence of PCR primer pair 960-CDS-1

[0098] 960-CDS-1 Primer Sequence (5'-3') serial number Upstream primer AGGAGTGAGAAAGAGGCCGTG SEQ ID NO:12 Downstream primer CGGCGGAGGTTCGTTGAGATC SEQ ID NO:13

[0099] The primer pairs in Table 3 were used to identify the sex of the melon. The test sample, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are as follows: Figure 4 shown.

[0100] Depend on Figure 4 It can be concluded that the PCR primer pair 960-CDS-1 cannot accurately identify the gender of the Pomelo sample.

[0101] Comparative Example 3

[0102] Based on the nucleotide sequence shown in SEQ ID NO:7 of the Pear Cake gene obtained in Example 1, the PCR primer pair chr5-9-p1 for identifying the sex of Pear Cake was designed using Oligo software. The primer information is shown in Table 4.

[0103] Table 4 PCR primer pair chr5-9-p1 nucleotide sequence

[0104] chr5-9-p1 primer Sequence (5'-3') serial number Upstream primer GCCCTAATCCACTTAACCATTG SEQ ID NO:14 Downstream primer TCAATGAAAACTTTTGTGTCCTG SEQ ID NO:15

[0105] The primer pairs in Table 4 were used to identify the sex of the melon. The detection sample, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in FIG. Figure 5 shown.

[0106] Depend on Figure 5 It can be concluded that the PCR primer pair chr5-9-p1 cannot accurately identify the gender of the P.

[0107] Comparative Example 4

[0108] Based on the nucleotide sequence shown in SEQ ID NO:8 of the pear gene obtained in Example 1, the PCR primer pair 6797098-1FA for identifying the sex of pear was designed using Oligo software. The primer information is shown in Table 5.

[0109] Table 5 Nucleotide sequences of PCR primer pair 6797098-1FA

[0110] 6797098-1FA Primer Sequence (5'-3') serial number Upstream primer CAATTGTTAGCCTAGTCCTAGTTCATTTC SEQ ID NO:16 Downstream primer TATTAGGAATTTCCGTTTAAGAATAGGTT SEQ ID NO:17

[0111] The primer pairs in Table 5 were used to identify the sex of the melon. The test sample, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in FIG. Figure 6 shown.

[0112] Depend on Figure 6 It can be concluded that the PCR primer pair 6797098-1FA cannot accurately identify the gender of the P.

[0113] Comparative Example 5

[0114] Based on the nucleotide sequence shown in SEQ ID NO:9 of the Pear Cake gene obtained in Example 1, the PCR primer pair 21965-FS-5 for identifying the sex of Pear Cake was designed using Oligo software. The primer information is shown in Table 6.

[0115] Table 6 Nucleotide sequence of PCR primer pair 21965-FS-5

[0116] 21965-FS-5 Primer Sequence (5'-3') serial number Upstream primer TAGCTAAAATTGTTGTACCTCG SEQ ID NO:18 Downstream primer TAGAGATGTCCATTTAACTTGCT SEQ ID NO:19

[0117] The primer pairs in Table 5 were used to identify the sex of the melon. The test sample, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in FIG. Figure 7 shown.

[0118] Depend on Figure 7 It can be concluded that the PCR primer pair 21965-FS-5 cannot accurately identify the gender of the Pomelo sample.

[0119] It can be concluded from the above embodiments that although the genomic fragments shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9 obtained by sequencing are all genomic fragments that specifically exist in male plants of Porphyra edulis and do not exist in female plants of Porphyra edulis, a large number of experiments have verified that the genomic fragments shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9 and the primers designed based on them cannot achieve the function of identifying the sex of Porphyra edulis. It can be seen that the Porphyra edulis Indel molecular markers and primers described in the present invention can achieve specific amplification of the Porphyra edulis gene and accurately identify the sex of Porphyra edulis with an accuracy rate of 100%.

[0120] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A melon gene, characterized in that The nucleotide sequence of the P. melanocarpa gene is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. A Pear Cucurbita Indel molecular marker, wherein the Pear Cucurbita Indel molecular marker has a deletion or insertion polymorphism of the nucleotides shown in SEQ ID NO: 1 or SEQ ID NO:

2.

3. The amplification primers for the Indel molecular marker of P. melanocarpa according to claim 2, characterized in that: The nucleotide sequences of the upstream primer and the downstream primer of the amplification primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

4. Use of the Pomelo gene described in claim 1 or the Pomelo Indel molecular marker described in claim 2 or the amplification primer described in claim 3 in one or more of reagents, kits, liquid phase probes and chips for Pomelo detection.

5. A product for detecting melon, characterized in that: The product comprises the amplification primers according to claim 3; the type of the product comprises one or more of a reagent, a kit, a liquid phase probe and a chip.

6. Use of the Pomelo gene described in claim 1, the Pomelo Indel molecular marker described in claim 2, the amplification primer described in claim 3, or the Pomelo detection product described in claim 5 in identifying Pomelo.

7. The use according to claim 6, characterized in that: The identifying of the pomelo includes identifying the gender of the pomelo.

8. The use according to claim 6 or 7, characterized in that: The kiwifruit includes kiwifruit whose development stage is the seedling stage and / or before the seedling stage.

9. The use according to claim 6 or 7, characterized in that: The identification is performed based on the PCR amplification band or PCR amplification sequence of the Indel molecular marker of the Pomelo.

10. A method for identifying the sex of a melon, characterized in that: The steps include: Using the genomic DNA of the to-be-tested Pomaceous Cucurbita as a template, and performing PCR amplification with the amplification primers described in claim 3, to obtain a PCR amplification product; Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result; The sex of the tested melon is identified according to the electrophoresis detection result: When the electrophoresis test results show a specific PCR amplification band of 369 bp, the tested melon is a male plant; When the result of the electrophoresis test shows that there is no specific PCR amplification band of 369 bp, the tested Melon is a female plant.

Images