Molecular marker related to brown leaf rust resistance, primer pair and application of molecular marker

Abstract

The invention relates to the technical field of biomolecular detection, in particular to a molecular marker related to brown leaf rust resistance, a primer pair and application of the molecular marker and the primer pair. According to the invention, 559 parts of materials are utilized to carry out whole genome association analysis on the resistance to the brown leaf rust in three environments, and one SNP closely associated with the brown leaf rust is found on a 2B chromosome short arm of hexaploid wheat. The molecular marker capable of screening materials on a large scale is developed by utilizing the SNP, the tight correlation degree with the leaf rust resistance is verified by utilizing 414 parts of materials, the molecular marker provided by the invention is finally developed and obtained, and the development of the molecular marker provides a simple and effective new screening marker for wheat leaf rust resistance breeding. By utilizing the molecular marker linked with the resistance site QLr.hazu-2BS. 1, the disease-resistant wheat strain can be quickly and accurately screened, the breeding period is shortened, the experiment cost is reduced, and the wheat leaf rust resistance breeding process is accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of biomolecule detection, and in particular to a molecular marker related to leaf rust resistance, a primer pair and an application thereof. Background Art

[0002] Wheat leaf rust is a fungal disease caused by Puccinia triticina that occurs widely around the world. Wheat leaf rust seriously harms wheat yields, reducing yields by 5%-20% during outbreaks and reaching a peak reduction of 50%. In my country, due to climate change and low variety diversity caused by large-scale wheat cultivation, the epidemic area of ​​wheat leaf rust has expanded from the Huanghuai River Basin to the main wheat producing areas. Therefore, ensuring stable and high yields of wheat is crucial to China's food production security.

[0003] Chemical agents can effectively control leaf rust, but they are costly and unfriendly to the environment, humans, and animals. Therefore, improving wheat with different resistance genes and breeding new wheat varieties resistant to leaf rust remain the most effective ways to solve this problem. To date, more than 100 wheat leaf rust resistance genes have been reported, of which 83 have been formally named. In addition, with the continuous variation of physiological races, only a few genes currently still maintain effective resistance. Therefore, the continuous excavation of new leaf rust resistance genes can not only cope with the continuous variation of physiological races, but also has important theoretical and practical significance for the use of gene layout and disease-resistant breeding to prevent wheat rust.

[0004] At present, there are two main methods for mining resistance sites, namely, quantitative trait loci (QTL) mapping based on parental populations and genome-wide association analysis (GWAS) mapping based on natural populations. QTL mapping is a statistical method that associates quantitative traits with specific regions in the genome to determine the location of genes that control quantitative traits in the genome. However, QTL mapping has many limitations and requires a large number of parental genetic populations, phenotypes of consecutive generations, and relatively few polymorphisms. GWAS is a new strategy based on linkage instability that uses high-density single nucleotide polymorphisms (SNPs) for comparative analysis or correlation analysis at the genome-wide level. Compared with traditional QTL mapping analysis, GWAS has the advantages of high detection efficiency and accuracy, short cycle time, high throughput, low cost, and can study multiple traits at the same time. Therefore, more and more scientists are using GWAS to quickly discover resistance genes.

[0005] In recent years, the development of DNA technology and the reduction of genotyping costs have made the analysis of complex traits easier and more efficient. In addition, the availability of the wheat reference genome and the advancement of sequencing technology have helped to accurately determine the locations of QTLs and potential candidate genes. KASP markers have been widely used due to their convenience and low cost (Christopherson et al. 1997; Stadhouders et al. 2010). However, there have been no reports on molecular markers associated with the wheat leaf rust resistance locus QLr.hazu-2BS.1. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker, a primer pair and an application thereof related to leaf rust resistance, so as to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention is closely related to the trait of leaf rust resistance, and SNP typing is obtained by KASP technology, which can accurately, efficiently and at low cost identify the trait of plant leaf rust resistance.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides a molecular marker (2B-209172) related to leaf rust resistance. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a C / T mutation exists at the 18th base of the sequence.

[0009] The present invention provides a KASP primer pair for detecting the above molecular markers, the primer pair comprising a first upstream primer with a nucleotide sequence as shown in SEQ ID NO.4, a second upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0010] The present invention provides a detection product for the above-mentioned molecular marker, and the detection product comprises the above-mentioned KASP primer pair.

[0011] Preferably, the detection product includes a detection reagent, a detection kit or a detection chip.

[0012] The present invention provides the use of the above-mentioned molecular marker, the above-mentioned KASP primer pair or the above-mentioned detection product in any one of the following:

[0013] (1) Application in identifying the resistance of plants to leaf rust;

[0014] (2) Application in screening and / or predicting plant varieties or strains with high resistance to leaf rust;

[0015] (3) Application in screening and / or predicting improved plant varieties or strains with high resistance to leaf rust;

[0016] (4) Application of molecular markers in plant breeding.

[0017] Preferably, the plant is a herbaceous plant.

[0018] More preferably, the herbaceous plant is wheat.

[0019] The present invention provides a method for identifying the resistance of a plant to leaf rust, comprising the following steps:

[0020] Using the genomic DNA of the plant sample to be tested as a template, performing PCR amplification on the template using the above-mentioned KASP primer pair, and performing genotyping according to the amplification result;

[0021] If the genotyping result is TT, the plant sample to be tested is determined to be a plant with high resistance to leaf rust; if the genotyping result is CC, the plant sample to be tested is determined to be a plant with low resistance to leaf rust.

[0022] Preferably, the PCR amplification system is: KASP PCR MIX 2.44 μL, Primer mix 0.056 μL and template 2.5 μL; the volume ratio of the first upstream primer, the second upstream primer and the downstream primer in the Primer mix is ​​1:1:1.

[0023] Preferably, the PCR amplification program is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; gradient annealing / extension at 55°C-61°C for 60 s, 10 cycles; denaturation at 94°C for 20 s; final extension at 55°C for 60 s.

[0024] Preferably, the plant is a herbaceous plant.

[0025] More preferably, the herbaceous plant is wheat.

[0026] The present invention discloses the following technical effects:

[0027] The present invention uses 559 materials to conduct a genome-wide association analysis of leaf rust resistance in three environments, and finds a SNP closely associated with leaf rust on the short arm of chromosome 2B of hexaploid wheat, and this SNP is located at the disease resistance site QLr.hazu-2BS.1. The present invention uses this SNP to develop a molecular marker 2B-209172 (KASP marker 2B-209172) that can be used for large-scale screening of materials, and the specific embodiment of the present invention uses 414 materials to verify the degree of close correlation with leaf rust resistance, and finally develops KASP marker 2B-209172. The development of this molecular marker provides a simple and effective new screening marker for wheat leaf rust resistance breeding. At the same time, using the KASP marker 2B-209172 linked to the resistance site QLr.hazu-2BS.1, disease-resistant wheat strains can be quickly and accurately screened, saving breeding years and experimental costs, and accelerating the breeding process of wheat leaf rust resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 The disease severity distribution map of 414 wheat materials; A is the disease severity distribution of materials with genotype A (CC) in the XX (2024) environment, and B is the disease severity distribution of materials with genotype B (TT) in the XX (2024) environment; the X-axis represents the severity of the disease, and the Y-axis represents the number of materials in each severity category;

[0030] Figure 2 The results of validating KASP molecular marker 2B-209172 for 414 wheat materials; A is the KASP marker detection at the QLr.hazu-2BS.1 locus, the X-axis and Y-axis represent the fluorescence signals corresponding to allele 1 and allele 2 detected using FAM and HEX dyes, respectively, blue dots represent susceptible genotypes, orange dots represent resistant genotypes, and green dots represent heterozygous genotypes; B is the single marker analysis of KASP molecular marker 2B-209172 in the XX (2024) environment, the colors represent the response type to the disease, red indicates susceptible, green indicates resistant, ****P<0.0001. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] The following experimental methods, unless otherwise specified, are conventional methods. The experimental materials used in the following experiments, unless otherwise specified, can be purchased from conventional biochemical reagent stores. The primers used in the present invention are synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd.

[0037] Example 1

[0038] 1. Phenotypic analysis of wheat leaf rust

[0039] The 559 wheat materials used in the whole genome association analysis of this example include 307 cultivated varieties, 107 local varieties, 15 colored wheats, and 130 foreign varieties from CIMMYT; the 414 wheat materials used for the verification of KASP marker 2B-209172 are from the above 559 materials, including 307 cultivated varieties and 107 local varieties.

[0040] The materials were planted in Zhoukou, Henan (ZK) and Wuhan, Hubei (WH) in the 2020 and 2021 sowing seasons, and in Xinxiang, Henan (XX) in the 2022 and 2023 sowing seasons; 3 g of each material was sown in a single row, with a row length of 1.5 meters and a row spacing of 25 cm. The highly susceptible variety Kenong 199 to leaf rust was used as the susceptible control and induced row, and all materials were subjected to standard field production management before harvest.

[0041] When the induced leaves grew to the jointing stage, field inoculation was carried out. The leaf rust species used in this experiment were 22105, 22107, 18054 and 18057 (the leaf rust species were 22105, 22107, 18054 and 18057, which were disclosed in the document "Identification and Toxicity Analysis of Physiological Races of Wheat Leaf Rust in my country in 2013", and were promised to be released to the outside world for 20 years). During inoculation, the four species were mixed in equal amounts, and heat-shocked at 42°C for 5 minutes to activate the leaf rust spores; the activated mixed spores were suspended in light mineral oil (Soltrol 170) at a concentration of 1.0-1.5 mg / ml, and the suspension was sprayed onto the induced leaves using a spray bottle.

[0042] Phenotypes were investigated 45-60 days after inoculation according to the maximum disease severity, and the severity was scored from 0 to 100%, and the strains were divided into disease-resistant (≤20%), intermediate (20% < MDS ≤40%), and susceptible (40% < MDS ≤100%). The phenotypic data were statistically analyzed using Excel and SAS-9.2. The results are as follows: Figure 1 And as shown in Table 1.

[0043] Table 1 Correlation analysis of four environmental phenotypes

[0044] 20ZK 21WH 22XX 21WH 0.39* - - 22XX 0.40* 0.42* - 23XX 0.34* 0.31* 0.52*

[0045] Note: *P<0.0001.

[0046] Depend on Figure 1 As shown in Table 1, the distribution of leaf rust disease severity in the four environments is continuous from 0 to 100%, and the phenotypic correlation among the four environments is between 0.31 and 0.52, which is a significant correlation, indicating the accuracy and availability of the data.

[0047] 2. Genotype data analysis

[0048] The MGISEQ-2000 platform was used to resequence 559 wheat materials with a sequencing depth of 2×-6×. PLINK-1.9 software was used to filter out SNPs with a deletion rate of >20% and an allele frequency of <5%, and 547.1Gb of genotype data were obtained, totaling 8,765,920 high-quality SNPs. These SNPs are distributed on 21 wheat chromosomes. The B genome group contains the most SNPs, with 4,556,759, followed by the A genome with 3,719,374, and the D genome with the least, containing 489,787. The distribution of SNPs on chromosomes is also different, with the most on chromosome 7B, with 1,047,964, and the least on chromosome 4D, with 33,309 (Table 2).

[0049] Table 2 Distribution of SNPs on chromosomes

[0050] chromosome Chromosome length (Mb) Number of SNPs Labeling density ( / Mb) Chr1A 596 657,405 1103 Chr1B 700 444,137 634 1D 498 88,980 179 ChR2A 787 413,190 525 B 812 738,583 910 dX 653 89,842 138 Chr3A 754 318,466 422 ChR3B 847 642,612 759 Chr3D 616 63,976 104 4A 750 1,018,351 1,358 BnB 670 526,541 786 4D 515 33,309 65 Chr5A 709 317,073 447 5B 711 499,434 702 5D 567 59,188 104 6A 619 302,895 489 6B 727 657,488 904 6DJ 493 59,105 120 7A 741 691,994 934 7B 760 1,047,964 1,379 7D 639 95,387 149 Agenome 4,956 3,719,374 750 Bgenome 5,227 4,556,759 872 Dgenome 3,981 489,787 123 ChrALL 14,164 8,765,920 619

[0051] Note: Chr: chromosome; genome: genome.

[0052] 3. Correlation analysis

[0053] Fastlmm / v0.2.32 software was used to associate the phenotypes of 559 wheat materials with the filtered SNP data, and it was found that the QLr.hazu-2BS.1 locus had 184 SNPs significantly associated with leaf rust resistance, which could be located in three environments: ZK, WH, and XX. The locus was located on the short arm of chromosome 2B in Chinese Spring, with a physical interval of 51.13-73.40Mb, and the markers on the left and right sides were SNP-13159072 and SNP-13255957, respectively (Table 3).

[0054] Table 3 Physical location of leaf rust resistance locus QLr.hazu-2BS.1 on chromosome

[0055]

[0056] 4. Development of KASP molecular markers

[0057] The significant site SNP-13209172 at the QLr.hazu-2BS.1 site was developed into the KASP molecular marker 2B-209172, whose nucleotide sequence is shown in SEQ ID NO.1, and there is a C / T mutation at the 18th base of the sequence.

[0058] SEQ ID NO.1: GGGCCAGCTGGACTATGYGGCATGGGCGTGGCCCAGGAGGCAACTGGGGTCGCTGAGGAGGCAGAAGAGGAG, where Y is C / T.

[0059] 5. Development of primer pairs and amplification methods

[0060] Primers were designed based on the information of the SNP sites in the molecular markers screened in Example 1, and the specific steps were as follows:

[0061] (1) To obtain SNP site information, it is required that the base sequences of the two parents at the SNP position are different, and there are no other SNPs 20bp upstream and 40bp downstream of the SNP. SNP information can be obtained through whole genome sequencing or resequencing.

[0062] (2) Extract parental DNA and dilute to 5-50 ng / μL for later use.

[0063] (3) Primer design

[0064] 1) Count 20 bp upstream from the base where the SNP is located as the left primer f, and the base of the SNP is the 20th base of the left primer, so there are left primers f1 and f2;

[0065] 2) Use primer design software or primer design website PolyMarker (https: / / www.polymarker.info / ) to fix the left primer f, and obtain the right primer R through BLAST. The product size must be less than 60bp;

[0066] 3) The left primers f1 and f2 are added with linkers FAM and HEX (the sequence of linker FAM: GAAGGTGACCAAGTTCATGCT, SEQ ID NO.2; the sequence of linker HEX: GAAGGTCGGAGTCAACGGATT, SEQ ID NO.3) respectively, and the sequences are F1 and F2, that is, F1 = A1f1, F2 = A2f2;

[0067] 4) Synthesize sequences F1, F2, and R and use ULTRPAGE purification method.

[0068] (4) Dissolve the primer powder to make the concentrations of F1 and F2 36 μM and R 90 μM. Then mix the three primers at a volume ratio of 1:1:1 to make a primer mix.

[0069] (5) Screening of KASP primer pairs

[0070] At least 2 wells were run for each primer, each parent and F1. The PCR amplification system is shown in Table 4 , and the PCR amplification program is shown in Table 5 .

[0071] Table 4 PCR amplification system

[0072] Components Volume (μL) DNA 2.5 KASPPCRMIX 2.44 Primermix 0.056

[0073] Table 5 PCR amplification program

[0074] program temperature time Cycle (times) Pre-denaturation 94℃ 15min 1 transsexual 94℃ 20s 1 Renaturation / Extension 61℃-55℃ 60s(-0.6℃ / cycle) 10 transsexual 94℃ 20s 1 Final extension 55℃ 60s 30

[0075] (6) After amplification, use fluorescent quantitative PCR to read the band

[0076] The tape reading procedure is as follows:

[0077] 25℃for 5s+Plate Read (25℃ for 5s+Plate Read); after the band reading is completed, select the fluorescence type FAM, HEX and ROX, and choose Allelic Discrimination for analysis.

[0078] (7) Primers with obvious clustering are selected as candidate primer pairs. The candidate primer pairs are used for the population. If the clustering effect is obvious, they can be used as KASP primer pairs.

[0079] (8) Filter results

[0080] The information of the KASP primer pair with the most obvious clustering effect is shown in Table 6.

[0081] Table 6 Sequences of KASP primer pairs

[0082]

[0083] 6. Application of KASP primer pairs

[0084] Afterwards, the association between the KASP molecular marker and leaf rust was verified in 414 wheat materials by t-test. The specific steps were as follows:

[0085] In the sowing season of 2023, 414 wheat materials (numbers as shown in Table 7) were planted in Xinxiang, Henan (XX); 3 g of each material was sown in a single row, with a row length of 1.5 meters and a row spacing of 25 cm. The highly susceptible variety Kenong 199 to leaf rust was used as a susceptible control and an induced row, and all materials were subjected to standard field production management before harvest.

[0086] When the induced lines grow to the jointing stage, field inoculation is carried out. The leaf rust species used in this experiment are 22105, 22107, 18054 and 18057. When inoculating, the four species are mixed in equal amounts and heat-shocked at 42°C for 5 minutes to activate the leaf rust spores; the activated mixed spores are suspended in light mineral oil (Soltrol 170) at a concentration of 1.0-1.5 mg / ml, and the suspension is sprayed onto the induced lines using a spray bottle.

[0087] The phenotypes were investigated according to the maximum disease severity 45-60 days after inoculation. The severity was scored from 0 to 100% and divided into disease-resistant type (≤20%), intermediate type (20%<MDS≤40%) and susceptible type (40%<MDS≤100%). The disease resistance classification results are shown in Table 7.

[0088] At the same time, the KASP primer pairs screened in step "5. Development of primer pairs and amplification methods" were used to perform PCR amplification on these 414 materials to detect the genotype of each material. The PCR amplification procedure and system were the same as those in Tables 4 and 5. The amplification results are shown in Figure 2 And as shown in Table 7.

[0089] Table 7 Phenotypes and genotypes of 414 wheat materials

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] Note: a NA indicates missing data; b A represents the susceptible genotype (CC), B represents the resistant genotype (TT), and H represents the heterozygous genotype (CT).

[0100] The results are as follows Figure 2 The results showed that there was a very significant correlation between marker 2B-209172 and the phenotypic data in the XX (2023) environment (P < 0.0001). In the XX (2023) environment, 95.41% of the materials containing this site were resistant to the disease, while 94% of the materials without this site were susceptible to the disease in the XX (2023) environment (Table 7 and Table 8). Figure 2). Moreover, as recorded in Table 7, the disease severity of 414 wheat materials is basically consistent with the genotype. The difference between the phenotype and genotype of individual materials may be caused by other disease-resistant genes or antagonistic genes in the materials. In addition, the QLr.hazu-2BS.1 locus has the highest proportion in local wheat varieties, which is 70.09%, and the proportion in cultivated varieties is lower, which is 46.58%, indicating that a certain proportion of this locus is lost during the breeding process of wheat varieties. The KASP molecular marker 2B-209172 developed for the QLr.hazu-2BS.1 resistance locus can detect the presence of this locus at the molecular level, effectively improving the utilization efficiency of the resistance locus, shortening the breeding period, and accelerating the breeding process of wheat leaf rust resistance.

[0101] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker associated with leaf rust resistance, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and there is a C / T mutation at the 18th base of the sequence.

2. A KASP primer pair for detecting the molecular marker according to claim 1, characterized in that: The primer pair includes a first upstream primer having a nucleotide sequence as shown in SEQ ID NO.4, a second upstream primer having a nucleotide sequence as shown in SEQ ID NO.5, and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.

6.

3. A molecular marker detection product according to claim 1, characterized in that: The detection product comprises the KASP primer pair described in claim 2.

4. The detection product according to claim 3, characterized in that: The detection product includes a detection reagent, a detection kit or a detection chip.

5. Use of the molecular marker according to claim 1, the KASP primer pair according to claim 2, or the detection product according to claim 3 or 4 in any of the following: (1) Application in identifying the resistance of plants to leaf rust; (2) Application in screening and / or predicting plant varieties or strains with high resistance to leaf rust; (3) Application in screening and / or predicting improved plant varieties or strains with high resistance to leaf rust; (4) Application of molecular markers in plant breeding.

6. The use according to claim 5, characterized in that: The plant is a herbaceous plant.

7. A method for identifying the resistance of a plant to leaf rust, characterized in that: The following steps are involved: Using the genomic DNA of the plant sample to be tested as a template, performing PCR amplification on the template using the KASP primer pair described in claim 2, and performing genotyping according to the amplification result; If the genotyping result is TT, the plant sample to be tested is determined to be a plant with high resistance to leaf rust; if the genotyping result is CC, the plant sample to be tested is determined to be a plant with low resistance to leaf rust.

8. The method according to claim 7, characterized in that The PCR amplification system is: KASPPCR MIX 2.44 μL, Primer mix 0.056 μL and template 2.5 μL; the volume ratio of the first upstream primer, the second upstream primer and the downstream primer in the Primer mix is ​​1:1:

1.

9. The method according to claim 7, characterized in that: The PCR amplification program is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; gradient annealing / extension at 55°C-61°C for 60 s, 10 cycles; denaturation at 94°C for 20 s; and final extension at 55°C for 60 s.

10. The method according to claim 7, characterized in that The plant is a herbaceous plant.

Images