Enhancing clustering efficiency and kinetics

Abstract

The present invention relates to a copolymer comprising: a plurality of first monomers comprising terminal functional groups attached to at least two different primers; a plurality of second monomers comprising a second functional group different from the terminal functional group and selected from the group consisting of a phenyl group, a methoxypropyl group, a glycosyl group, a vinyl pyrrolidone group, and an imidazole group; and a plurality of third monomers, the third monomers being different from the first monomers and the second monomers. The copolymers can be used in flow cells and can enhance clustering efficiency and kinetics.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 349,907, filed on June 7, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] The sequence listing submitted herewith is hereby incorporated by reference in its entirety. The file name is ILI234BPCT_IP-2282-PCT_Sequence_Listing.xml, the file size is 15,652 bytes, and the file creation date is May 19, 2023. Background Art

[0005] Genetic analysis, and in particular nucleic acid sequencing, is increasingly important in modern society as it has proven useful in a variety of applications. For example, genetic analysis has been used to predict a person's risk of contracting certain diseases (diagnosis), to determine the probability of therapeutic benefit versus risk of side effects for a person considering taking certain treatments (prognosis), and to identify missing persons, perpetrators of crimes, victims of crime, and casualties of war (forensic identification). Due to the rapidly growing demand for reliable genetic information related to an organism, disease, or individual, improvements in the throughput of analytical methods have been under investigation. Summary of the invention

[0006] In the examples disclosed herein, nucleic acid sequencing involves the generation of clusters. Clusters are clonal groupings of template deoxyribonucleic acid (DNA) chains bound to the surface of a flow cell. Each cluster is seeded with a single template DNA chain / construct, which is clonally amplified by bridge amplification until the cluster has multiple copies. Each cluster on the flow cell produces a single sequencing read. Various mechanisms for improving the efficiency and / or kinetics of clustering are disclosed herein. This improvement may be due to enhanced availability of flow cell primers, reduced formation of primer dimers, and / or increased accessibility of polymer hydrogels to sequencing proteins and enzymes. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly not identical parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0008] Figure 1A is a top view of an exemplary flow cell;

[0009] Figure 1B is an enlarged partial cross-sectional view of a first example of a flow channel of a flow cell;

[0010] Figure 1C is an enlarged partial cross-sectional view of a second example of a flow channel of a flow cell;

[0011] Figure 1D is an enlarged partial cross-sectional view of a third example of a flow channel of a flow cell;

[0012] Figure 2 is a schematic view of a first primer set and a second primer set that can be used in a flow cell disclosed herein;

[0013] Figure 3 is a graph depicting intensity (Y-axis) versus primer concentration (μM, X-axis) at 30 minutes for a flow cell in which different polymers were attached to the surface of a recess (ie, nanopore);

[0014] Figure 4 is a graph depicting the number of templates per nanowell (Y-axis) versus the number of primers per nanowell (X-axis) for a flow cell grafted for 30 minutes and a flow cell grafted for 60 minutes;

[0015] Figure 5 is a graph depicting the amount of template for each primer (Y-axis) versus the concentration of primer input (μM, X-axis) introduced into the corresponding lanes of the flow cell grafted with three different primers (P5 / P7, P15 / P7, and copper-free P15 / P7);

[0016] Figure 6 is a graph depicting Cal Fluor Red (CFR) intensity (readings × 1000, Y axis) versus grafting concentration (μM, X axis) for flow cells pretreated with alkaline buffer and with carbonate buffer;

[0017] Figure 7 is a graph depicting the average percentage of clusters passing through the filter (Y-axis) versus cluster time (minutes, X-axis) for flow cells exposed to pretreatment and not exposed to pretreatment;

[0018] Figure 8 is a graph depicting the average percentage of recesses occupied by amplicon clusters (Y-axis) versus cluster time (minutes, X-axis) for flow cells exposed to pretreatment and not exposed to pretreatment;

[0019] 9A to 9C is a graph depicting the C1 intensity (Y-axis, Fig.9A ), Q30 score (%, Y axis, Fig. 9B ) and error rate (%, Y axis, Fig. 9C) having a standard control lane (i.e., poly(ethylene glycol) (PEG) in the clustered mixture but not attached to the polymer in the recessed portion of the flow cell) and a second control lane (where no PEG is in the clustered mixture or attached to the polymer in the recessed portion of the flow cell), wherein three flow cell lanes have varying concentrations of PEG attached to the polymer in the recessed portion of the flow cell;

[0020] FIG. 10A to FIG. 10C is a graph depicting the C1 intensity (Y-axis, Fig. 10A ), Q30 score (%, Y axis, Fig. 9B ) and error rate (%, Y axis, Fig. 9C ) curve: The flow cell has the same 9A to 9C the standard control lane and the second control lane, wherein the four lanes have the same concentration of PEG attached to the polymer in the recess of the flow cell but reacted for different times;

[0021] FIG. 11A to FIG. 11D is a graph depicting single nucleotide polymorphism (SNP) accuracy (%, Y axis, for the flow cell with the two control lanes and the three lanes with different concentrations of PEG attached to the polymer. Fig.11A )、SNP recall rate (%, Y axis, Fig. 11B ), insertion-deletion mutation (indel) accuracy (%, Y axis, Fig. 11C ) and indel recall (%, Y axis, Fig.11D ); and

[0022] FIG. 12A to FIG. 12D is a graph depicting SNP accuracy (%, Y axis, for the flow cell with the two control lanes and the four lanes with the same concentration of PEG attached to the polymer but using different reaction times. Fig. 12A ), SNP recall rate (%, Y axis, Fig. 12B ), indel accuracy (%, Y axis, Fig. 12C ) and indel recall (%, Y axis, Fig.12D ) curve graph.

[0023] definition

[0024] It should be understood that, unless otherwise indicated, the terms used herein are to be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0025] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0026] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0027] The terms top, bottom, lower, upper, and above are used herein to describe the various components of the flow cell and / or the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation.

[0028] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0029] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor variations (up to + / - 10%) from the value.

[0030] "Acrylamide monomer" is a monomer with the structure A monomer or a monomer containing an acrylamide group. Examples of monomers containing an acrylamide group include azidoacetamidopentyl acrylamide: N,N-Dimethylacrylamide: And N-isopropylacrylamide: Other acrylamide monomers may be used.

[0031] As used herein, an aldehyde is an organic compound containing a functional group having the structure -CHO including a carbonyl center (i.e., a carbon double-bonded to an oxygen) in which the carbon atom is also bonded to a hydrogen, and an R group such as an alkyl or other side chain. The general structure of an aldehyde is:

[0032] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is completely saturated (i.e., does not contain double bonds and triple bonds). The alkyl group may have 1 to 20 carbon atoms. Typical alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc. As an example, the name "C1-C4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl.

[0033] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0034] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0035] As used herein, "aryl" refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When aryl is a ring system, each ring in the ring system is aromatic. Aryl groups may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0036] An "amine" or "amino" functional group refers to a -NRaRb group, wherein Ra and Rb are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0037] As used herein, the term "attachment" refers to the state in which two things are joined, fastened, adhered, connected or combined with each other, directly or indirectly. For example, the bond formed can be covalent or non-covalent. A covalent bond is characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0038] An "azide" or "azido" functional group refers to -N3.

[0039] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the main chain of the ring system. When the carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged or spiro-connected manner. The carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclic group can have 3 to 20 carbon atoms. Examples of carbocycles include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl and spiro[4.4]nonanyl.

[0040] As used herein, the term "carboxylic acid" or "carboxyl" refers to -COOH.

[0041] As used herein, "cycloalkylene" refers to a fully saturated carbocyclic ring or ring system that is attached to the rest of the molecule through two points of attachment.

[0042] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbon ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbon ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.

[0043] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. One example is cyclooctyne. Another example is bicyclononyne. Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.

[0044] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Generally speaking, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0045] As used herein, the term "recess" refers to a discrete concave feature in a substrate having a surface opening at least partially surrounded by a gap region of the substrate. A recess may have any of a variety of shapes at its opening in the surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of a recess taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0046] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0047] As used herein, the term "epoxy" (also known as a glycidyl or oxirane group) refers to

[0048] "Epoxy-functionalized silsesquioxanes" include silsesquioxane cores functionalized with epoxy groups. As used herein, the term "silsesquioxane" refers to a hybrid intermediate (RSiO) between silicon dioxide (SiO2) and organosilicon (R2SiO2). 1.5) chemical composition. Exemplary silsesquioxanes include polyhedral oligomeric silsesquioxanes (available under the trade name Commercially available from Hybrid Plastics Inc. Examples of polyhedral oligomeric silsesquioxanes may be as described by Kehagias et al., Microelectronic Engineering 86 (2009) pp. 776-778, which is incorporated by reference in its entirety. The composition is of the formula [RSiO 3 / 2 ] n An organosilicon compound wherein n is an even number ranging from 6 to 14 and at least some of the R groups are epoxy groups. Other examples of R groups include azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or in addition for example alkyl, aryl, alkoxy and / or haloalkyl groups. The resin composition disclosed herein may include one or more different cage or core silsesquioxane structures as monomer units. In some examples, all R groups of the polyhedral oligomeric silsesquioxane are epoxy groups. An example of this type of epoxy-functionalized silsesquioxane is a glycidyl polyhedral oligomeric silsesquioxane having the following structure:

[0049]

[0050] Another example of this type of epoxy-functionalized silsesquioxane is an epoxycyclohexylethyl-functionalized polyhedral oligomeric silsesquioxane having the following structure:

[0051]

[0052] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can be performed, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell enables detection of reactions occurring in the flow cell. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc. within the flow channel.

[0053] As used herein, a "flow channel" or "channel" may be a region defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between a substrate and a cover, and thus may be in fluid communication with one or more recesses defined in the substrate. A flow channel may also be defined between two substrate surfaces bonded together.

[0054] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms (i.e., elements other than carbon, including but not limited to nitrogen, oxygen, and sulfur) in the ring backbone. When heteroaryl is a ring system, each ring in the ring system is aromatic. A heteroaryl group may have 5-18 ring members.

[0055] As used herein, "heterocycle" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. The heterocycles can be joined together in a fused, bridged or spiro manner. The heterocycle can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In the ring system, heteroatoms can be present in non-aromatic rings or aromatic rings. The heterocyclic group can have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N or S.

[0056] As used herein, the term "hydrazine" or "hydrazine" refers to a -NHNH2 group.

[0057] As used herein, "hydroxy" refers to an -OH group.

[0058] As used herein, the term "gap region" refers to, for example, a region of a substrate that separates recesses. For example, a gap region may separate one recess of an array from another recess of the array. Two recesses that are separated from each other may be discrete, i.e., lack physical contact with each other. In many examples, the gap region is continuous and the recesses are discrete, for example, as in the case of multiple recesses defined in an otherwise continuous surface. The gap region may have a surface material that is different from the surface material of the recesses defined in the surface. For example, the recess may have a polymer hydrogel and a primer set therein, and the gap region may be free of the polymer hydrogel and the primer set.

[0059] As used herein, "nitrile oxide" refers to "R a C≡N + O - " group, where R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloroamide-T or by the action of a base on an imidic chloride [RC(Cl)=NOH] or by reaction between hydroxylamine and an aldehyde.

[0060] As used herein, "nitrone" refers to Group, where R 1 , R 2 and R 3 It can be R as defined in this article a Group and R b Any of the groups, except that R 3 Not hydrogen (H).

[0061] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is a monomeric unit of a nucleic acid sequence. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position of ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) may be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0062] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers referred to herein as amplification primers are used as the starting point for template amplification and cluster generation. An exemplary primer set may include "universal" forward and reverse primers, which include sequences that can anneal to the universal primer binding sequence in the template strand / construct. Another example of a primer set may include two different primer subgroups. The primer subgroups are related, wherein one group includes a non-cleavable first primer and a cleavable second primer, and another group includes a cleavable first primer and a non-cleavable second primer. These primer subgroups allow a single template strand to be amplified and aggregated between two primer subgroups, and forward and reverse strands can also be generated on adjacent portions of a polymer hydrogel, because the cleavage group is present on the opposite primers of these subgroups. The 5' end of each primer in the primer set may be modified to allow coupling reaction with the functional group of the polymer hydrogel. Other primers referred to herein as sequencing primers are used as the starting point for DNA synthesis. The length of any primer may be any number of base lengths and may include a variety of non-natural nucleotides. In one example, the sequencing primers are short, ranging from 10 to 60 bases, or 20 to 40 bases.

[0063] The term "substrate" refers to a structure to which various components of a flow cell (e.g., polymer hydrogels, primers, etc.) can be added. The substrate can be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The substrate is generally rigid and insoluble in aqueous liquids. The substrate can be inert to the chemicals present in the recessed portion. For example, the substrate can be inert to the chemicals used to attach primers, for sequencing reactions, etc. The substrate can be a single-layer structure or a multilayer structure (e.g., including a carrier and a patterned resin on the carrier). Examples of suitable substrates will be further described herein.

[0064] A "thiol" functional group refers to -SH.

[0065] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0066] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. Tetrazole may be optionally substituted.

[0067] Polymer hydrogel

[0068] The flow cell disclosed herein includes a polymer hydrogel in a swimming lane or recess. A polymer hydrogel is a gel material that is swellable when absorbing a liquid and shrinkable when the liquid is removed, such as by drying. In each example disclosed herein, the polymer hydrogel is an acrylamide copolymer. Each example of an acrylamide copolymer includes at least two different monomers, one of which includes a terminal functional group capable of attaching a primer in a primer set to the polymer hydrogel. Some examples of acrylamide copolymers also include another monomer that adjusts the hydrogel properties. Other examples of acrylamide copolymers include strained alkyne-activated polyethylene glycol (PEG) attached to some terminal functional groups. Each exemplary polymer hydrogel will now be described in more detail.

[0069] In one example, the acrylamide copolymer is represented by the following structure (I):

[0070]

[0071] Where: R A is a terminal functional group capable of attaching the primer to the polymer hydrogel, and is selected from an azide group, an amino group, an alkyne group, an aldehyde group, a hydrazine group, a carboxyl group, a hydroxyl group, a tetrazole group, a tetrazine group, a nitrile oxide group, a nitrone group, a thiol group, and a combination thereof; R B , R C , R D and R E Each independently selected from H and alkyl; -(CH2) p - each of which may be optionally substituted; p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; and m is an integer in the range of 1 to 100,000. In some cases, the terminal functional group R A Therefore, some terminal functional groups R A Primers can be attached, while other terminal functional groups R A Can be attached to an underlying substrate.

[0072] A specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM).

[0073] One of ordinary skill in the art will recognize that the arrangement of the recurring "n" and "m" features in Structure (I) is representative, and that the monomer subunits may be present in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof). In some examples, the acrylamide copolymer in Structure (I) is a linear polymer. In some other examples, the acrylamide copolymer in Structure (I) is a lightly cross-linked polymer.

[0074] The molecular weight of the acrylamide copolymer in structure (I) may be in the range of about 5 kDa to about 1500 kDa or about 10 kDa to about 1000 kDa, or in one specific example may be about 312 kDa.

[0075] In other examples, the polymer hydrogel may be a variation of structure (I). In one example, the acrylamide unit may be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by Replace, where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group (rather than H, as in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can also be used. In this example, in addition to the recurring "n" and "m" features, structure (I) can also include Where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0076] As yet another example of a polymer hydrogel, the recurring "n" feature in structure (I) may be replaced with a monomer comprising a heterocyclic azido group having structure (II):

[0077]

[0078] Wherein: R1 is H or C1-C6 alkyl; R2 is H or C1-C6 alkyl; L is a linker comprising a straight chain having 2 to 20 atoms selected from carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain comprising 1 to 4 atoms selected from carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0079] As yet another example, the polymer hydrogel may comprise recurring units of each of structures (III) and (IV):

[0080]

[0081] Where R 1a , R 2a , R 1b and R 2b Each of R is independently selected from H, alkyl or phenyl; 3a and R 3b Each of is independently selected from hydrogen, alkyl, phenyl or C7-C14 aralkyl; and each L1 and L2 is independently selected from an alkylene linker or a heteroalkylene linker.

[0082] It should be understood that any polymer hydrogel may contain multiples of each monomer used to form the hydrogel.

[0083] In addition to those monomers listed in structure (I) or variations of structure (I), or in addition to structures (III) and (VI), any polymer hydrogel disclosed herein may further comprise another monomer. The additional monomer may be selected to adjust hydrogel properties such as charge or hydrophilicity, which may contribute to faster clustering kinetics. In these examples, the copolymer comprises: a plurality of first monomers comprising a terminal functional group to which at least two different primers are attached; a plurality of second monomers comprising a second functional group different from the terminal functional group and selected from a phenyl group, a methoxypropyl group, a saccharide group, and an imidazole group; and a plurality of third monomers, the third monomer being different from the first monomer and the second monomer.

[0084] In these examples, the first monomer can be any example of the "n" feature that appears repeatedly in structure (I), and the third monomer can be any example of the "m" feature that appears repeatedly in structure (I). In a specific example, the terminal functional group (e.g., R in structure (I) A ) is an azide group, and the third monomer is acrylamide.

[0085] In a specific example of the copolymer, the first monomer accounts for about 0.1% to about 20% of the copolymer; the second monomer accounts for about 0.1% to about 20% of the copolymer; and the third monomer accounts for about 60% to less than 100% of the copolymer. In another specific example, the first monomer accounts for about 5% to about 15% of the copolymer; the second monomer accounts for about 5% to about 15% of the copolymer; and the third monomer accounts for about 70% to about 90% of the copolymer.

[0086] As described above, the second monomer comprises a functional group different from the terminal functional group of the first monomer and selected from a phenyl group, a methoxypropyl group, a saccharide group, a vinyl pyrrolidone group and an imidazole group. As a specific example, the second monomer may be selected from N-phenyl acrylamide: and N-(3-methoxypropyl)acrylamide: As another specific example, the second monomer may be selected from 2-hydroxy-1-methoxypropyl methacrylate: Phenyl acrylate: Benzyl Methacrylate: and glycosyloxyethyl methacrylate: The imidazole-containing monomer may be any vinyl derivative of imidazole, such as 1-vinylimidazole: 2-vinylimidazole: And 4-vinylimidazole:

[0087] In this specific example, each of the first monomer, the second monomer, and the third monomer can be incorporated into the copolymer backbone during polymerization. Suitable polymerization techniques include free radical polymerization, reversible addition-fragmentation chain transfer (RAFT) polymerization, atom transfer radical polymerization (ATRP), nitroxide-mediated free radical (NMP) polymerization combined with RAFT or ATRP, NMP with an additional crosslinking step, cobalt-mediated polymerization, ionic polymerization, or any other polymerization method that directly or indirectly produces the desired architecture.

[0088] The resulting copolymer can be a random copolymer with the first monomer, the second monomer, and the third monomer randomly positioned along the main chain. In some cases, the monomers can be incorporated statistically along the main chain. The polymerization can also be controlled to generate a block copolymer in which each block of the main chain contains the first monomer, the second monomer, or the third monomer, or to generate an alternating copolymer with the first monomer, the second monomer, and the third monomer alternating along the main chain.

[0089] Alternatively, a second monomer comprising a phenyl group, a methoxypropyl group, a glycosyl group or an imidazole group can be attached to the side chain of the copolymer backbone by a coupling reaction (e.g., azide coupling) with the terminal functional group of the polymerized first monomer. This type of attachment will depend on the other functional groups of the second monomer and whether they are capable of reacting with the terminal functional group of the first monomer.

[0090] The addition of a second monomer (as defined in this specific example of a polymer hydrogel) and / or a third monomer (e.g., dimethylacrylamide) can help reduce the occurrence of homologous primer dimer formation (e.g., two identical primers hybridizing to each other) and / or heterologous primer dimer formation (e.g., two different primers hybridizing to each other). The reduction in primer dimer formation may be due to a reduction in hydrogen bonding and chain-chain interactions within the polymer hydrogel. The reduction in primer dimer formation then leaves more primers available for clustering, which increases clustering kinetics.

[0091] Other examples of polymer hydrogels include those having the same R as that of structure (I) (e.g., the recurring "n" feature in structure (I) A ) or a variation of structure (I) or a strained alkyne-activated polyethylene glycol (PEG) attached to some terminal functional groups of a copolymer containing structures (III) and (VI). In these examples, the terminal functional group can be any functional group capable of reacting with the strained alkyne of the activated polyethylene glycol (PEG) (e.g., via a copper-free click reaction). In a specific example, the polymer hydrogel includes an acrylamide copolymer comprising a terminal azide group in at least some of the side chains; and a strained alkyne-activated polyethylene glycol (PEG) attached to some of the terminal azide groups.

[0092] Some specific examples of strained alkyne activated polyethylene glycol include dibenzocyclooctyne (DBCO) activated polyethylene glycol, monofluorinated cyclooctyne activated polyethylene glycol, difluorinated cyclooctyne activated polyethylene glycol, biaryl azacyclooctyne ketone activated polyethylene glycol and bicyclo [6.1.0] nonyne activated polyethylene glycol. In each of these examples, the weight average molecular weight of the PEG portion of the strained alkyne activated polyethylene glycol is in the range of about 1,000 g / mol to about 20,000 g / mol.

[0093] After the copolymer is synthesized using any of the polymerization techniques disclosed herein, the strained alkyne-activated polyethylene glycol can be attached to the terminal functional groups of the copolymer. The strained alkyne-activated polyethylene glycol can be added to the copolymer, and the mixture can be exposed to conditions suitable for the click reaction to occur (e.g., in water at about 90° C. for about 2 hours). The strained alkyne-activated polyethylene glycol can be incorporated into the copolymer before the strained alkyne-activated polyethylene glycol is applied to the surface of the flow cell, after the strained alkyne-activated polyethylene glycol is applied to the surface of the flow cell and before primer grafting occurs, after the strained alkyne-activated polyethylene glycol is applied to the surface of the flow cell and at the same time as primer grafting, or after the strained alkyne-activated polyethylene glycol is applied to the surface of the flow cell and after primer grafting occurs.

[0094] In one example, the concentration of the strained alkyne-activated polyethylene glycol in the polymer hydrogel is in a range from about 0.5 mM to about 0.2 mM.

[0095] The addition of polyethylene glycol (PEG) to the polymer hydrogel facilitated the recombinase binding events and enhanced the clustering kinetics.

[0096] As described herein, some terminal functional groups of the polymer hydrogel (e.g., R A ) can attach primers to the polymer hydrogel, and other terminal functional groups can attach the polymer hydrogel to the underlying substrate. In other examples, the polymer hydrogel can include additional monomers that include functional groups capable of attaching to the underlying substrate. Some examples of substrate attachment functional groups include amino groups, alcohol groups, aryl groups, and charged groups. Suitable anionic charged groups include sulfate or carboxylic acid. Suitable cationic charged groups include ammonium ions, guanidinium ions, or imidazolium ions. When included, the additional monomer can be incorporated into the copolymer backbone during polymerization.

[0097] Flow cell

[0098] Any of the examples of polymer hydrogels described herein (eg, structure (I), copolymers comprising three different monomers, copolymers comprising strained alkyne-activated polyethylene glycol (PEG), etc.) can be used in different examples of flow cells.

[0099] An example of a flow cell 10 is shown in Figure 1A The flow cell 10 may include two patterned or non-patterned structures bonded together, or one patterned or non-patterned structure bonded to a cover.

[0100] The patterned structure, the non-patterned structure, or the patterned or non-patterned structure and the cover can be attached to each other by a spacer (not shown). The spacer can be any material that seals multiple parts of the patterned or non-patterned structure together or seals multiple parts of the patterned or non-patterned structure with the cover. As an example, the spacer can be an adhesive, a radiation absorbing material that facilitates bonding, etc. In some examples, the spacer is a radiation absorbing material, such as The patterned or unpatterned structure or the patterned structure and the cap may be bonded using any suitable technique such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art.

[0101] The flow channel 12 is defined between two patterned or non-patterned structures, or between one patterned or non-patterned structure and a cover. Figure 1A The example shown includes eight flow channels 12. Although eight flow channels 12 are shown, it should be understood that any number of flow channels 12 (e.g., a single flow channel 12, four flow channels 12, etc.) may be included in the flow cell 10. Each flow channel 12 may be isolated from each other flow channel 12 so that a fluid introduced into a flow channel 12 does not flow into an adjacent flow channel 12. Some examples of fluids introduced into a flow channel 12 may introduce reaction components (e.g., lysis fluid, DNA sample, polymerase, sequencing primer, nucleotides, etc.), washing solution, deblocking agent, etc.

[0102] The flow channel 12 can have any desired shape. In one example, the flow channel 12 has a substantially rectangular configuration. The length of the flow channel 12 depends in part on the size of the substrate on which the patterned or non-patterned structure is formed. The width of the flow channel 12 depends in part on the size of the substrate on which the patterned or non-patterned structure is formed, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing at the perimeter of the patterned or non-patterned structure.

[0103] When microcontact printing, aerosol printing, or inkjet printing is used to deposit separate materials defining the walls of the spacer and flow channel 12, the depth of the flow channel 12 (which does not include the depth of any lanes 26 or recesses 20, 20' defined in the patterned or non-patterned structure) can be as small as a monolayer thickness. For other examples, the depth of the flow channel 12 may be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth may be in the range of about 10 μm to about 100 μm. In another example, the depth may be in the range of about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of the flow channel 12 may be greater than, less than, or between the values ​​specified above.

[0104] Each flow channel 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be positioned at opposite ends of the flow cell 10. The inlet and outlet of the respective flow channel 12 may alternatively be positioned at any position along the length and width of the flow channel 12 that enables the desired fluid flow.

[0105] The inlet allows fluid to be introduced into the flow channel 12, and the outlet allows fluid to be withdrawn from the flow channel 12. Each of the inlet and outlet is fluidly connected to a fluid control system (including, for example, a reservoir, pump, valve, waste container, etc.) that controls fluid introduction and discharge.

[0106] Figure 1B , Figure 1C and Figure 1D Various examples of architectures within flow channel 12 are depicted.

[0107] Each structure includes a substrate, such as a single-layer base support 14 (e.g. Figure 1B as shown) or a multilayer structure 16 (as shown Figure 1C and Figure 1D shown).

[0108] Examples of suitable single layer base supports 14 include epoxysilicone, glass, modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxides, silicon dioxide, fused silica or silicon dioxide-based materials, aluminum silicates, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaOx ), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc.

[0109] An example of a multi-layer structure 16 includes a base support 14 and at least one other layer 18 thereon, such as Figure 1C and Figure 1D shown.

[0110] Some examples of the multilayer structure 16 include glass or silicon as the base carrier 14, with tantalum oxide (e.g., tantalum pentoxide or another tantalum oxide (TaO x )) or another ceramic oxide coating (eg, layer 18). The coating can be patterned using any of the examples disclosed herein.

[0111] Other examples of multilayer structures 16 include a base support 14 (e.g., glass, silicon, tantalum pentoxide, or any other base support 14 material) and a patterned resin as another layer 18. It should be understood that the layer 18 may be selectively deposited or deposited and patterned to form the recessed portion 20 and the gap region 22 ( Figure 1C ) or multiple depth recesses 20' and gap regions 22 ( Figure 1D ) can be used for the patterned resin.

[0112] As an example of a patterned resin, an inorganic oxide may be selectively applied to the base support 14, such as via vapor deposition, aerosol printing, or inkjet printing, to define a pattern in the layer 18. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), and the like.

[0113] As another example of a patterned resin, a polymer resin may be applied to the base support 14 and then patterned to define a pattern in the layer 18. Suitable deposition techniques include chemical vapor deposition, dip coating, bubble coating, spin coating, spray coating, whipped dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), imprinting techniques, embossing techniques, molding techniques, microetching techniques, and the like. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins (e.g., epoxy-functionalized silsesquioxanes), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxides), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., available from Bellex). ) and their combinations.

[0114] In one example, a single base support 14 (whether used alone or as part of a multi-layer structure 16) can be a circular sheet, panel, wafer, die, etc. having a diameter in the range of about 2 mm to about 300 mm (e.g., about 200 mm to about 300 mm), or can be a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). For example, the width of the die can range from about 0.1 mm to about 10 mm. Although example dimensions have been provided, it should be understood that a single base support 14 having any suitable dimensions can be used.

[0115] Figure 1B The architecture shown in is a non-patterned structure. The substrate of the non-patterned structure can be a single-layer base support 14. In this example, the single-layer base support 14 has a swimming lane 26 surrounded by an edge region 30. Any suitable technology (such as photolithography, nanoimprint lithography (NIL), stamping technology, embossing technology, molding technology, micro-etching technology, etc.) can be used to form the swimming lane 26. The swimming lane 26 provides a designated area for the polymer hydrogel 28. The edge region 30 provides a bonding area where two non-patterned structures can be attached to each other or one of the non-patterned structures can be attached to the cover. Therefore, in this example, the surface of the circulation pool 10 is non-patterned, and the polymer hydrogel 28 is positioned in the swimming lane 26 of the non-patterned surface.

[0116] To introduce the polymer hydrogel 28 into the lane 26, a mixture of the polymer hydrogel 28 can be generated and then applied to the single-layer base support 14. In one example, any example of the polymer hydrogel 28 disclosed herein can be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). The mixture can then be applied to the corresponding substrate surface (including in the lane 26) using spin coating, or dipping or dip coating, or a material flow under positive or negative pressure, or another suitable technique. These types of techniques blanket deposit the polymer hydrogel 28 in the lane 26 and on the edge region 30. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 28 in the lane 26 rather than on the edge region 30.

[0117] In some examples, the surface of the single-layer base support 14 (including the lane 26) can be activated, and then the mixture (including the polymer hydrogel 28) can be applied thereto. In one example, silane or a silane derivative (e.g., norbornene silane) can be deposited on the surface of the single-layer base support 14 using vapor deposition, spin coating, or other deposition methods. In another example, the substrate surface can be exposed to plasma ashing to generate a surfactant (e.g., -OH group) that can attach to the polymer hydrogel 28.

[0118] The applied mixture may be exposed to a curing process depending on the chemistry of the polymer hydrogel 28. In one example, curing may be performed at a temperature ranging from room temperature (eg, about 25°C) to about 95°C for a time ranging from about 1 millisecond to about several days.

[0119] When a blanket deposition technique is used, polishing may then be performed to remove the polymer hydrogel 28 from the edge region 30 at the perimeter of the lane 26 while leaving the polymer hydrogel 28 on the surface at least substantially intact in the lane 26 .

[0120] Figure 1C and Figure 1D The architectures shown in the figure depict different examples of patterned structures. The base of each of these patterned structures is a multilayer structure 16 with recesses 20 or multi-depth recesses 20' defined in layer 18. Layer 18 can be selectively deposited, or deposited and patterned to form recesses 20 or multi-depth recesses 20'. Recesses 20, 20' provide designated areas for polymer hydrogel 28. Figure 1C In the example of FIG. 1 , the surface of the flow cell 10 is patterned with recessed portions 20 separated by gap regions 22, and a polymer hydrogel 28 is located within each recessed portion 20 of the patterned surface. Figure 1D In the example of FIG. 4 , the surface of the flow cell 10 is patterned with multi-depth recesses 20 ′ separated by gap regions 22 , and a polymer hydrogel 28 is located within each multi-depth recess 20 of the patterned surface.

[0121] Many different layouts of the recessed portions 20, 20' can be envisioned, including regular, repeated, and irregular patterns. In one example, the recessed portions 20, 20' are arranged in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be an xy format in rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of recessed portions 20, 20' and gap regions 22. In yet other examples, the layout or pattern may be a random arrangement of recessed portions 20, 20' and gap regions 22.

[0122] The layout or pattern can be characterized with respect to the density (number) of recesses 20, 20' in a defined area. For example, the recesses 20, 20' can be approximately 2 million / mm. 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 pieces / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 Or a greater or lesser density. It should also be understood that the density can be between a value selected from the lower limit value and a value selected from the upper limit value of the above range, or other densities (outside the given range) can be used. For example, a high-density array can be characterized as having recesses 20, 20' separated by less than about 100nm, a medium-density array can be characterized as having recesses 20 separated by about 400nm to about 1μm, and a low-density array can be characterized as having recesses 20, 20' separated by more than about 1μm.

[0123] The layout or pattern of the recessed portions 20, 20' may also be characterized according to or alternatively according to the average pitch or spacing (center-to-center spacing) from the center of one recessed portion 20, 20' to the center of the adjacent recessed portion 20, 20' or from the right edge of one recessed portion 20, 20' to the left edge of the adjacent recessed portion 20, 20' (edge-to-edge spacing). The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50nm, about 0.1μm, about 0.5μm, about 1μm, about 5μm, about 10μm, about 100μm, or more or less. The average pitch of a particular pattern may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. In one example, the recessed portions 20, 20' have a pitch (center-to-center spacing) of about 1.5μm. While example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0124] The size of each recess 20, 20' can be characterized by its volume, opening area and / or diameter or length and width. For example, the volume can be about 1×10 -3 μm 3 to about 100 μm 3 In the range of, for example, about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , or larger, or smaller. For another example, the opening area can be about 1×10 -3 μm 2 to about 100 μm 2 In the range of, for example, about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm2 , at least about 10 μm 2 For another example, each of the length and width or the diameter may be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more, or less.

[0125] The size of each recess 20, 20' may also or alternatively be characterized by its depth. The depth of the recess 20 may be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more, or less. Each multi-depth recess 20' includes a deep portion (e.g., a shallow portion) adjacent to a shallow portion. Figure 1D ). It should be understood that the depth of the deep portion and the depth of the shallow portion are both within the range provided for the recessed portion 20, but it should be noted that the depth of the deep portion is greater than the depth of the shallow portion. It should be understood that the height of the inner wall separating the deep portion and the shallow portion will vary according to the different depths of the deep portion and the shallow portion. In some examples, it is desired that the height of the inner wall is substantially equal to (e.g., + / - 5%) the depth of the shallow portion, so that the depth of the deep portion is approximately twice the depth of the shallow portion.

[0126] Any of the examples of polymer hydrogels 28 disclosed herein may be used Figure 1C and Figure 1D In the architecture shown in .

[0127] In order to introduce the polymer hydrogel 28 into the recessed portions 20, 20', a mixture of the polymer hydrogel 28 can be generated and then applied to the multilayer structure 16. In one example, the polymer hydrogel 28 may be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). The mixture can then be applied to the corresponding substrate surface (including in the recessed portions 20, 20') using spin coating, or dipping or dip coating, or a material flow under positive or negative pressure, or another suitable technique. These types of techniques blanket deposit the polymer hydrogel 28 in the recessed portions 20, 20' and on the gap regions 22. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 28 in the recessed portions 20, 20' rather than on the gap regions 22.

[0128] In some examples, the surface of layer 18 (including recessed portions 20, 20') may be activated, and then a mixture (including polymer hydrogel 28) may be applied thereto. In one example, a silane or silane derivative (e.g., norbornene silane) may be deposited on the surface of layer 18 using vapor deposition, spin coating, or other deposition methods. In another example, layer 18 may be exposed to plasma ashing to generate a surface active agent (e.g., -OH groups) that may attach to polymer hydrogel 28.

[0129] The applied mixture may be exposed to a curing process depending on the chemistry of the polymer hydrogel 28. In one example, curing may be performed at a temperature ranging from room temperature (eg, about 25°C) to about 95°C for a time ranging from about 1 millisecond to about several days.

[0130] When a blanket deposition method is used to apply the polymer hydrogel 28 , polishing may then be performed to remove the polymer hydrogel 28 from the interstitial regions 22 while leaving the polymer hydrogel 28 on the surfaces in the recesses 20 , 20 ′ at least substantially intact.

[0131] Figure 1B and Figure 1C The architecture shown in comprises a primer set comprising two different primers 32, 34. Primers 32, 34 constitute a primer set for sequential paired end sequencing. In sequential paired end sequencing, the corresponding forward strand generated is sequenced and removed, and then the corresponding reverse strand generated is sequenced and removed.

[0132] As an example, the primer set can include a P5 primer and a P7 primer, a P15 primer and a P7 primer, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. As an exemplary combination, the primer set can include any two PA, PB, PC, and PD primers, or any combination of a PA primer and a PB, PC, or PD primer, or any combination of a PB primer and a PC or PD primer, or any combination of a PC primer and a PD primer.

[0133] Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、ISEQ TM 、GENOME ANALYZER TM and other instrument platforms.

[0134] The P5 primers are:

[0135] P5:5'→3'

[0136] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1)

[0137] The P7 primer can be any of the following:

[0138] P7#1: 5' → 3'

[0139] CAAGCAGAAGACGGCATACGAnAT(SEQ.ID.NO.2)

[0140] P7#2: 5' → 3'

[0141] CAAGCAGAAGACGGCATACnAGAT(SEQ.ID.NO.3)

[0142] P7#3: 5' → 3'

[0143] CAAGCAGAAGACGGCATACnAnAT(SEQ.ID.NO.4)

[0144] wherein "n" is 8-oxoguanine in each of these sequences.

[0145] The P15 primers are:

[0146] P15:5'→3'

[0147] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.5)

[0148] wherein "n" is allyl-T (a thymine nucleotide analogue having an allyl functional group).

[0149] The above other primers (PA-PD) include:

[0150] PA 5'→3'

[0151] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.6)

[0152] cPA(PA')5'→3'

[0153] CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC(SEQ.ID.NO.7)

[0154] PB 5'→3'

[0155] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.8)

[0156] cPB(PB')5'→3'

[0157] AGTTCATATCCACCGAAGCGCCATGGCAGACGACG(SEQ.ID.NO.9)

[0158] PC 5'→3'

[0159] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.10)

[0160] cPC(PC')5'→3'

[0161] AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT(SEQ.ID.NO.11)

[0162] PD 5'→3'

[0163] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC(SEQ.ID.NO.12)

[0164] cPD(PD')5'→3'

[0165] GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC

[0166] (SEQ.ID.NO.13).

[0167] Although not shown in the exemplary sequence of PA-PD, it should be understood that any of these primers may include a cleavage site at any point in the chain, such as uracil, 8-oxoguanine, allyl-T, etc., as long as the cleavage sites of primers 32 and 34 are orthogonal (i.e., the cleavage chemistry of primer 32 is different from the cleavage chemistry of primer 34, and therefore the two primers 32, 34 are sensitive to different cleavage agents).

[0168] Each of the primers 32 and 34 disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes 2 T bases to 20 T bases. As a specific example, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases.

[0169] The 5' end of the primers 32, 34 will vary depending on the chemical nature of the polymer hydrogel 28. As two examples, the 5' terminal functional group can be a terminal alkyne (e.g., a hexynyl group) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). The terminal alkyne can be attached to an azide group on the polymer hydrogel 28. In another example, the primers 32, 34 can include an alkene at the 5' end that can react with a reactive thiol group on the polymer hydrogel 28. In yet other specific examples, a succinimide (NHS) ester-terminated primer can react with an amine group on the polymer hydrogel 28, an aldehyde-terminated primer can react with a hydrazine group on the polymer hydrogel 28, an azide-terminated primer can react with an alkyne or DBCO (dibenzocyclooctyne) on the polymer hydrogel 28, or an amino-terminated primer can react with an activated carboxylate group on the polymer hydrogel 28.

[0170] Primers 32, 34 may be grafted onto the polymer hydrogel 28 before or after it is introduced into the lane 26 or recess 20. Grafting may be accomplished by flow-through deposition (e.g., using a temporary or permanently bonded cap), bubble coating, spray coating, whipping dispensing, or by another suitable method. Each of these exemplary techniques may utilize a primer solution or mixture that may include primers 32, 34; water; buffer; and a catalyst. With either grafting method, primers 32, 34 are attached to reactive groups of the polymer hydrogel 28 and do not react with the void region 22.

[0171] Figure 1D The architecture shown in comprises a primer set comprising two different primer subsets 36, 38. Figure 1C It is not shown, but it should be understood that these primer subsets 36, 38 can also be used Figure 1C In the recessed portion 20 of the architecture shown in , one of the subgroups 36 is attached to one half of the recessed portion 20 and the other subgroup is attached to the other half of the recessed portion 20 .

[0172] Primer subgroups 36 and 38 (see Figure 2) allows simultaneous paired end read nucleic acid analysis, wherein the forward strand and the reverse strand are sequenced simultaneously. The primer subsets 36, 38 enable clusters of the forward strand to be generated in one region A of the polymer hydrogel 28, and clusters of the reverse strand to be generated in another region B of the polymer hydrogel 28. As described herein, the primer subsets 36, 38 are controlled so that the cleavage (linearization) chemicals are orthogonal at different polymer hydrogel regions 28A and 28B. More specifically, the primer subsets 36, 38 are related, wherein one subset 36 includes a non-cleavable first primer 40 and a cleavable second primer 42, and the other subset 38 includes a cleavable first primer 44 and a non-cleavable second primer 46.

[0173] The non-cleavable first primer 40 and the cleavable second primer 42 are an oligonucleotide pair, for example, wherein the non-cleavable first primer 40 is a forward amplification primer and the cleavable second primer 42 is a reverse amplification primer, or wherein the cleavable second primer 42 is a forward amplification primer and the non-cleavable first primer 40 is a reverse amplification primer. In the first primer subset 36, the cleavable second primer 42 includes a cleavage site 48, while the non-cleavable first primer 40 does not include a cleavage site 48.

[0174] The cleavable first primer 44 and the non-cleavable second primer 46 are also an oligonucleotide pair, for example, wherein the cleavable first primer 44 is a forward amplification primer and the non-cleavable second primer 46 is a reverse amplification primer, or wherein the non-cleavable second primer 46 is a forward amplification primer and the cleavable first primer 44 is a reverse amplification primer. In the second primer subset 38, the cleavable first primer 44 includes a cleavage site 48' or 50, while the non-cleavable second primer 46 does not include a cleavage site 48' or 50.

[0175] It should be understood that the non-cleavable first primer 40 of the first primer subset 36 and the cleavable first primer 44 of the second primer subset 38 have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 44 includes a cleavage site 48' or 50 that is integrated into the primer sequence or integrated into a linker molecule attached to the primer sequence. Similarly, the cleavable second primer 42 of the first primer subset 36 and the non-cleavable second primer 46 of the second primer subset 38 have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 42 includes a cleavage site 48 that is integrated into the primer sequence or integrated into a linker molecule attached to the primer sequence.

[0176] It should be understood that when the first primers 40 and 44 are forward amplification primers, the second primers 42 and 46 are reverse primers, and vice versa.

[0177] The non-cleavable primers 40, 46 can be any primer sequence having a universal sequence for capture and / or amplification purposes, such as P5 and P7 primers, P15 and P7 primers, or any combination of PA, PD, PC, PD primers (e.g., PA and PB or PA and PD, etc.), without a cleavage site 48, 48', 50 (e.g., "U" or "n" in some sequences described herein). In some examples, the P5 primer and the P7 primer are non-cleavable primers 40, 46 because they do not include a cleavage site 48, 48', 50. It should be understood that any suitable universal sequence can be used as the non-cleavable primers 40, 46.

[0178] Examples of cleavable primers 42, 44 include P5 and P7 primers, P15 and P7 primers or other universal sequence primers (e.g., PA, PB, PC, PD primers), wherein corresponding cleavage sites 48, 48', 50 (e.g., "U" or "n" in some sequences described herein) are incorporated into the primer sequence or into a linker molecule attached to the primer sequence. Examples of suitable cleavage sites 48, 48', 50 include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., linkers between nucleobases), as described herein, as long as 48 and 48' or 50 are orthogonal to each other.

[0179] As described herein, for example, with respect to primers 32, 34 and the uracil or cleavage site labeled "n" in the sequence, the cleavage site 48, 48', 50 for each of the cleavable primers 42, 44 is incorporated into the primer sequence.

[0180] In one example, the same type of cleavage site 48, 48' is used in the cleavable primers 42, 44 of the corresponding primer subsets 36, 38. As an example, the cleavage site 48, 48' is a uracil base, and the cleavable primers 42, 44 are P5U and P7U. Uracil bases or other cleavage sites can also be incorporated into any of the PA, PB, PC and PD primers to generate cleavable primers 42, 44. In this example, the non-cleavable primer 40 of the oligonucleotide pair 40, 42 can be P7, and the non-cleavable primer 46 of the oligonucleotide pair 44, 46 can be P5. Therefore, in this example, the first primer subset 36 includes P7, P5U, and the second primer subset 38 includes P5, P7U. Primers 40, 42 and 44, 46 of subsets 36, 38 have opposite linearization chemistries that, after amplification, cluster generation and linearization, allow for the formation of a forward template strand on one polymer hydrogel region 28A and a reverse strand on the other polymer hydrogel region 28B.

[0181] In another example, different types of cleavage sites 48, 50 are used in the cleavable primers 42, 44 of the corresponding primer subsets 36, 38. For example, two different enzymatic cleavage sites can be used, two different chemical cleavage sites can be used, or one enzymatic cleavage site and one chemical cleavage site can be used as the linearization cleavage sites 48, 50. Examples of different cleavage sites 48, 50 that can be used in the corresponding cleavable primers 42, 44 include any combination of the following: vicinal diols, uracil, allyl-T, allyl ethers, disulfides, and 8-oxoguanine.

[0182] like Figure 2 As shown in , each primer subset 36 and 38 is attached to a corresponding region A or B of the polymer hydrogel 28. Regions 28A and 28B are chemically identical, and primer subsets 36, 38 can be sequentially fixed to the desired regions 28A and 28B using suitable techniques. Alternatively, primer subsets 36, 38 can be pre-grafted onto different batches of polymer hydrogel 28 and deposited at different times to form the desired regions 28A and 28B.

[0183] One example of a suitable technique that can be used to attach primer subsets 36, 38 includes the use of photoresist. In this example, the photoresist is developed to mask one region A while the surface chemistry (e.g., primers 44, 46) is added to another region B. The photoresist is then removed and the surface chemistry is added to region A under conditions that do not have a detrimental effect on region B or its surface chemistry.

[0184] Another example of a suitable technique may include the use of a sacrificial layer, such as aluminum. In this example, a sacrificial layer is applied to a substrate (e.g., 14, 16) so that it masks a portion (e.g., half, the deep portion) of the recessed portion 20, 20'. The other portion (e.g., the other half, the shallow portion) of the recessed portion 20, 20' remains exposed. The exposed portion of the recessed portion 20, 20' can be activated, for example, by depositing a suitable silane (e.g., using CVD to deposit norbornene silane). In this example, a polymer hydrogel 28 is applied to the sacrificial layer and the exposed activated portion of the recessed portion 20, 20'. The sacrificial layer is then peeled off, so that the overlying polymer hydrogel 28 is removed and the previously covered portion of the recessed portion 20, 20' is exposed. The polymer hydrogel 28A on the other portion of the recessed portion 20, 20' remains intact. The primer subset 36 can then be grafted onto the polymer hydrogel 24A. Because the substrate (e.g., 14, 16) has no affinity for the primer subset 36, the exposed portions of the recesses 20, 20' are not affected. The substrate (e.g., 14, 16) can then be activated, for example, by exposure to a norbornene silane solution. The polymer hydrogel 28B can then be applied under conditions that do not have a deleterious effect on the region A or its surface chemistry (e.g., under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.)). The primer subset 38 can then be grafted onto the polymer hydrogel 28B.

[0185] Yet another example of a suitable technique may include pre-grafting primer subsets 36, 38, and sequentially and selectively applying the pre-grafted polymeric material to regions A, B.

[0186] It should be understood that while several exemplary methods have been provided, any other method may be used to affix the primer subsets 36, 38 to the respective regions A, B.

[0187] Flow cell treatment

[0188] Any flow cell 10 disclosed herein including any polymer hydrogel 28 disclosed herein can be exposed to methods for improving sequencing metrics. These methods can help loosen the structure of the polymer hydrogel 28, thereby expanding the polymer hydrogel 28 and enabling the clustering reagent to better access the primers 32, 34 or primer subsets 36, 38.

[0189] An exemplary method for improving sequencing metrics involves pretreating an example flow cell 10 including a primer set grafted onto a polymer hydrogel 28 by: introducing water, an alkaline buffer having a pH range of 8 to 11, a high salt buffer, formamide, or isopropanol into the flow cell 10; raising the temperature of the flow cell 10 to a range of about 25° C. to about 80° C.; maintaining the temperature for a time in a range of about 5 minutes to about 2 hours; and then amplifying a library template chain using the grafted primer set (e.g., primers 32, 34 or primer subsets 36, 38).

[0190] In this exemplary method, the flow cell 10 already has the polymer hydrogel 28 applied within the lane 26 or recess 20 , 20 ′ and has the primer set grafted onto the polymer hydrogel 28 .

[0191] In this exemplary method, the fluid introduced into the circulation cell 10 is water, an alkaline buffer having a pH range of 8 to 11, a high salt buffer, formamide, or isopropanol. Examples of alkaline buffers include borate buffer, N-cyclohexyl-3-aminopropanesulfonic acid (CAPS buffer), 2-amino-2-methyl-1-propanol buffer (AMP buffer), or N-cyclohexyl-2-aminoethanesulfonic acid (CHES buffer). Examples of high salt buffers include water-based solutions that contain non-acidic and non-alkaline salts in high concentrations (above 0.1 M and in the molar range) such as NaCl, MgSO4, KCl, MgCl2 in addition to their acid or base pairs.

[0192] After the fluid is introduced, the temperature of the flow cell 10 is increased and then maintained at the increased temperature for a given time frame. In one specific example, the temperature of the flow cell 10 is increased to at least 40° C.; and the temperature is maintained for at least 30 minutes. In another specific example, the temperature of the flow cell 10 is increased to about 60° C.; and the temperature is maintained for about 1 hour.

[0193] Maintaining the flow cell 10 at an elevated temperature in the presence of a fluid can help break the hydrogen bonds and hydrate / swell the polymer hydrogel 28. This effectively expands the polymer hydrogel 28.

[0194] Another exemplary method for improving sequencing metrics involves grafting any primer set (e.g., primers 32, 34 or primer subsets 36, 38) to the polymer hydrogel 28 on the surface of a flow cell in the presence of a carbonate buffer for a time ranging from greater than 30 minutes to about 120 minutes; and using the grafted primer set to amplify a library template chain.

[0195] The concentration of the carbonate buffer may be about 0.1M to about 1M. In one example, the carbonate buffer is an aqueous buffer comprising both sodium carbonate and sodium bicarbonate. Sodium carbonate may be in the range of about 0.01g / L to about 2.8g / L, and sodium bicarbonate may be in the range of about 0.09g / L to about 2.1g / L. In a specific example, the carbonate buffer may be prepared by preparing an aqueous buffer of sodium carbonate (e.g., 1M), preparing an aqueous buffer of sodium bicarbonate that is close to saturation (e.g., 1M), and then mixing the sodium carbonate buffer and the sodium bicarbonate buffer in a volume ratio of 6:1. The final pH may be adjusted to a range of about 9 to about 11. In one example, the final pH may be adjusted to a range of about 10 to about 10.5 (e.g., 10.3).

[0196] In this example, the desired primer set can be introduced into the circulation cell 10 (having the polymer hydrogel 28 already applied in the swimming lane 26 or the recess 20, 20') together with the carbonate buffer. The grafting time depends on the temperature of the circulation cell 10 and the pH of the buffer. The temperature of the circulation cell during grafting is in the range of about 30°C to about 80°C. In one example, the temperature is in the range of about 40°C to about 60°C. The higher the temperature and the higher the pH, the shorter the grafting time. When using primer subsets 36, 38, grafting in the carbonate buffer can occur simultaneously or sequentially, as long as the polymer hydrogel 28 includes regions A, B with different attachment groups for primer subsets 36, 38.

[0197] Maintaining the flow cell 10 at an elevated temperature in the presence of a carbonate buffer may help to loosen the structure of the polymer hydrogel 28. This effectively expands the polymer hydrogel 28.

[0198] Cluster generation and sequencing methods

[0199] Any example of flow cell 10 including polymer hydrogel 28 and grafted primer sets (eg, primers 32 and 34 or subsets 36, 38) may be used in a sequencing operation.

[0200] During sequencing, the primer set fixed on the polymer hydrogel 28 can be used to form the amplicon of the template strand / construct to be sequenced in the recess 20, 20'. At the beginning of template strand formation, the library fragment / template can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample). This process occurs outside the circulation pool 10. DNA nucleic acid samples can be fragmented into single-stranded DNA fragments of similar size (e.g., <1000bp). RNA nucleic acid samples can be used to synthesize complementary DNA (cDNA), and cDNA can be fragmented into single-stranded cDNA fragments of similar size (e.g., <1000bp). During preparation, a joint can be added to the end of any fragment. By reducing cyclic amplification, different motifs such as sequencing primer binding sites, indexes, and regions complementary to the primers in the primer set can be introduced into the adapter. In some examples, the fragments from a single nucleic acid sample have the same joint added thereto. The final library template includes a DNA or cDNA fragment and joints at both ends. The DNA or cDNA fragment represents the part to be sequenced of the final library template.

[0201] A plurality of library templates may be introduced into the flow cell 10. The plurality of library templates are hybridized with one primer immobilized on the polymer hydrogel 28, for example.

[0202] Cluster generation can then be performed. In an example of cluster generation, a high-fidelity DNA polymerase is used to replicate the library template from the hybridization primer by 3' extension. The initial library template is denatured, and the copy (i.e., amplicon) fixed on the polymer hydrogel 28 is retained. Isothermal bridge amplification or some other forms of amplification can be used to amplify fixed copies. For example, the copied template loops back to hybridize with adjacent complementary primers, and the polymerase replicates the copied template to form a double-stranded bridge, and these double-stranded bridges are denatured to form two single strands. These two chains loop back and hybridize with adjacent complementary primers, and extend again to form two new double-stranded loops. The process is repeated for each template copy by isothermal denaturation and amplification cycles to produce dense clonal clusters. Each cluster of double-stranded bridges is denatured. In an example using primers 32 and 34, the antisense strand is removed by specific base cleavage, leaving the forward template strand. Clustering leads to the formation of several amplicons fixed on the polymer hydrogel 28 (e.g., in recesses 20, 20' or in the region across lane 26). This example of clustering is called bridge amplification, and is one example of an amplification that may be performed. It should be understood that other amplification techniques may be used, such as the Exclusion Amplification (Examp) workflow (Illumina Inc.).

[0203] Sequencing primers that hybridize to complementary portions of the sequences of the amplicons, respectively, can then be introduced. The sequencing primers make the amplicons ready for sequencing using the spike-in mixture.

[0204] The incorporation mixture may include a variety of fully functional nucleotides, a polymerase, and a liquid carrier. The liquid carrier of the incorporation mixture may be water and / or an ionic salt buffer, such as millimolar to molar concentrations of citrate solution, sodium chloride, potassium chloride, phosphate buffered saline, and the like, and other buffers, such as tris (hydroxymethyl) aminomethane (TRIS) or (4- (2-hydroxyethyl) -1- piperazineethanesulfonic acid) (HEPES). The liquid carrier may also include a catalytic metal intended for the incorporation reaction, such as Mg. 2+ , Mn 2+ , Ca 2 + Etc. A single catalytic metal or a combination of catalytic metals may be used, and the total amount may be in the range of about 0.01 mM to about 100 mM.

[0205] A fully functional nucleotide (FFN) comprises a nucleotide, a 3'OH capping group attached to the sugar of the nucleotide, and a fluorophore attached to the base of the nucleotide. The nucleotide of the FFN may be any nucleotide described herein.

[0206] The nucleotides of FFN also include a 3'OH blocking group attached thereto. The 3'OH blocking group may be connected to the 3' oxygen atom of the sugar molecule in the nucleotide. The 3'OH blocking group may be a reversible terminator that allows only a single base to be incorporated in each sequencing cycle. The reversible terminator prevents the additional base from being incorporated into the nascent chain complementary to the amplicon. This enables detection and identification of a single incorporated base. The 3'OH blocking group may then be removed so that additional sequencing cycles can occur at each amplicon. Examples of different 3'OH blocking groups include 3'-ONH2 reversible terminators, 3'-O-allyl reversible terminators (i.e., -CH=CHCH2) and 3'-O-azidomethyl reversible terminators (i.e., -CH2N3). Other suitable reversible terminators include o-nitrobenzyl ether, alkyl o-nitrobenzyl carbonates, ester moieties, other allylic moieties, acetals (e.g., tert-butoxy-ethoxy), MOM (—CH2OCH3) moieties, 2,4-dinitrobenzenesulfenyl, tetrahydrofuran ether, 3'phosphoric acid, ethers, -F, -H2, -OCH3, -N3, -HCOCH3, and 2-nitrobenzene carbonate.

[0207] The nucleotides of FFN also include a fluorophore attached to the base of the nucleotide. The fluorophore can be any optically detectable moiety, including a luminescent moiety, a chemiluminescent moiety, a fluorescent moiety, a fluorescent substrate moiety, a chromophore moiety, and / or a chromophore moiety. Some examples of suitable optically detectable moieties include fluorescein labels, rhodamine labels, cyanine labels (e.g., Cy3, Cy5, etc.), and The fluorophore can be linked to the base of the nucleotide using any suitable linker molecule. In one example, the linker molecule is of the formula -((CH2)2O) n -a spacer group, wherein n is an integer between 2 and 50.

[0208] In one example, the doped mixture includes a mixture of different FFNs, which include different bases, such as A, T, G, C (and U or I). For different FFNs, it may also be necessary to use different types of fluorophores. For example, fluorophores can be selected so that each fluorophore absorbs excitation radiation and / or emits fluorescence at a wavelength that is distinguishable from other fluorophores. Such distinguishable analogs provide the ability to simultaneously monitor the presence of different fluorophores in the same reaction mixture. In some examples, one of the four FFNs doped in the mixture may not contain a fluorophore, while the other three labeled FFNs contain different fluorophores.

[0209] Any polymerase that can accept fully functional nucleotides and can successfully incorporate bases of fully functional nucleotides into nascent chains along the amplicon can be used. Exemplary polymerases include those from Family A, such as Bsu polymerase, Bst polymerase, Taq polymerase, T7 polymerase, and many others; polymerases from Families B and B2, such as Phi29 polymerase and other highly processive polymerases (Family B2), Pfu polymerase (Family B), KOD polymerase (Family B), 9oN (Family B), and many others; polymerases from Family C, such as E. coli DNA Pol III, and many others; polymerases from Family D, such as Pyrococcus furiosus DNA Pol II, and many others; polymerases from Family X, such as DNA Pol μ, DNA Pol β, DNA Pol σ, and many others.

[0210] In this exemplary method, any example of a spiked mixture is introduced into the flow cell 10, for example, via an inlet. When the spiked mixture is introduced into the flow cell 10, the mixture enters the flow channel 12 and contacts the surface chemistry where the amplicons are present.

[0211] The spiked mixture is incubated in the flow cell 10, and the FFN is spiked into the nascent chain generated along the amplicon by the polymerase. During the spiked period, one of the FFNs is spiked into a nascent chain by the corresponding polymerase, and the nascent chain extends a sequencing primer and is complementary to one of the amplicon in the amplicon. The spiked mixture is spiked in a template strand-dependent manner, and thus the detection of the order and type of FFN added to the nascent chain can be used to determine the sequence of the amplicon. During a single sequencing cycle, the spiked mixture occurs in at least some of the amplicon across the recess 20, 20' or the lane 26. Therefore, in at least some of the amplicon across the flow cell 10, the corresponding polymerase extends the hybridized sequencing primer by one of the FFNs in the spiked mixture.

[0212] The incorporated FFN includes reversible termination properties due to the presence of the 3' OH blocking group, terminating further sequencing primer extension on the nascent chain once the FFN has been added.

[0213] After the desired incubation and spiking time, the spiking mixture including at least some unspiked FFN can be removed from the flow cell 10 during a wash cycle. The wash cycle can involve a flow-through technique in which a wash solution (e.g., a buffer) is directed into, through, and then out of the flow channel 12 (e.g., by a pump or other suitable mechanism).

[0214] Without further incorporation, recently incorporated FFNs can be detected by an imaging event. During an imaging event, an illumination system (not shown) can provide excitation light to the surface of the flow cell containing the surface chemistry. The fluorophores of the incorporated FFNs emit light signals in response to the excitation light.

[0215] After imaging is performed, a cleavage mixture may then be introduced into the flow cell 10. In this example, the cleavage mixture is capable of i) removing the 3'OH capping group from the incorporated FFN, and ii) cleaving the fluorophore from the FFN. Examples of 3'OH blocking groups and suitable deblocking agents / components in the cleavage mixture may include: ester moieties that can be removed by alkaline hydrolysis; allyl moieties that can be removed by Nal, trimethylsilyl chloride and Na2S2O3 or by acetone / water solution of Hg(II); azidomethyl groups that can be cleaved by phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP); acetals that can be cleaved by acidic conditions, such as tert-butoxy-ethoxy; MOM (—CH2OCH3) moieties that can be cleaved by LiBF4 and CH3CN / H2O; 2,4-dinitrobenzenesulfenyl groups that can be cleaved by nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ethers that can be cleaved by Ag(I) or Hg(II); and 3' phosphates that can be cleaved by phosphatases (e.g., polynucleotide kinases). Examples of suitable fluorophore cleaving agents / components in the cleavage mixture may include: sodium periodate, which can cleave vicinal diols; phosphines (such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP)) that can cleave azidomethyl bonds; palladium and THP that can cleave allyl groups; bases that can cleave ester moieties; or any other suitable cleaving agent.

[0216] Washing can occur between the various fluid delivery steps. The sequencing cycle can then be repeated n times to extend the sequencing primer by n nucleotides, thereby detecting a sequence of length n. In these examples, paired-end sequencing can be used, in which the forward strand is sequenced and removed, and then the reverse strand is constructed and sequenced.

[0217] Simultaneous paired-end sequencing can be used with primer subsets 36, 38. In the case of simultaneous paired-end sequencing, during clustering, a forward strand is generated on one region A, B of the polymer hydrogel 28, and a reverse strand is generated on another region B, A of the polymer hydrogel 28. Incorporation occurs simultaneously at the corresponding nascent strands of the amplicons sequenced at the two regions A, B, and non-specifically bound FFNs may be present at the two regions A, B.

[0218] In order to further illustrate the present disclosure, examples are given herein. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure. Example

[0219] Example 1 - Terpolymer

[0220] Several examples of copolymers having three different monomers (i.e., terpolymers) were prepared and compared with one example of a copolymer of structure (I), specifically poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide, PAZAM). The PAZAM concentration in the coating solution was 0.25 wt % or 0.025 wt %. The monomers in the terpolymer were (azidoacetamidopentyl)acrylamide; dimethylacrylamide; and one of N-vinylimidazole (5%), glycosyloxyethyl methacrylate (20%), or linear vinyl pyrrolidone (20%).

[0221] To test the terpolymers in a flow cell format, a real-time i-cBot TM Clustering assay (Illumina Inc.). In this assay, EXAMP TM Preparation (from Illumina Inc.) An intercalating dye (from Biotium) images the isothermal amplification of DNA in the nanopore / well (comprising one of the polymers and the P5 / P7 primers grafted thereon). From this assay, the maximum intensity (amount of amplified DNA), the slope of the intensity curve (DNA amplification rate), the time to reach 50% of the maximum intensity (amplification lag time), and the intensity at a specific time (e.g., 30 minutes) can be determined. The intensity is extracted after 30 minutes of clustering. Figure 3 Clustering intensity after 30 minutes (Y-axis) versus primer concentration (X-axis, μM) is shown. Figure 3 As depicted, for PAZAM, a decrease in clustering kinetics confirms an increase in P5 / P7 primer density. This may be due to an increase in homodimer and / or heterodimer formation when a greater number of primers are present. In contrast to PAZAM, each of these terpolymers has higher clustering kinetics after 30 minutes of clustering at primer concentrations of 6 μM or higher. The terpolymers do not appear to be affected by primer dimer formation.

[0222] Example 2 - Carbonate Buffer

[0223] A 0.5 M aqueous carbonate buffer was prepared by mixing 1 M solutions of sodium bicarbonate and sodium carbonate in a volume ratio of about 1:6, and then further diluting the buffer with water to obtain the desired polarity. The pH of the carbonate buffer was about 10.

[0224] A patterned flow cell with PAZAM in the recess was used. P5 and P7 primers were introduced into each lane of the flow cell together with aqueous carbonate buffer. One flow cell was incubated for 30 minutes to graft the primers, and the other flow cell was incubated for 60 minutes to graft the primers. In each flow cell, the incubation was performed at about 60°C.

[0225] After primer grafting, quantitative determination is performed to compare the grafting process. In order to quantify the number of primers per nanopore / recess after grafting, a dye-labeled complementary primer (i.e., a fluorescent primer) is hybridized with the surface-bound primer, and excess primer is washed off. The hybridized fluorescent primer is dehybridized and collected and quantified using a plate reader. The total number of fluorescent primers captured in each lane is divided by the total number of nanopores / recesses in each lane to obtain the average number of primers per nanopore / recess.

[0226] Library fragments (from the PhiX genome) were then introduced and clustered using bridge amplification.

[0227] After clustering, quantitative determination is performed. In order to quantify the number of templates per nanopore / recess after clustering, a dye-labeled complementary sequence (i.e., a fluorescent sequence complementary to the library fragment sequence used to start clustering) is hybridized with the surface-bound template, and excess sequences are washed off. The hybridized fluorescent sequence is dehybridized and collected and then quantified using a plate reader. The total number of fluorescent sequences captured in each lane is divided by the total number of nanopores / recesses in each lane to obtain the average number of sequences per nanopore / recess.

[0228] The results of these quantitative measurements are shown in Figure 4 middle. Figure 4 The number of templates per recess (nanopore) (Y-axis) versus the number of primers per recess (nanopore) (X-axis) are depicted for a grafting period of 30 minutes and for a grafting period of 60 minutes. At an equal number of primers (e.g., 10,000), the number of templates grafted per recess in the 60-minute period is more than 1000 more than the number of templates grafted per recess in the 30-minute period.

[0229] The same type of carbonate buffer was then compared to a sodium sulfate buffer (1.5 M). Similarly, a patterned flow cell with PAZAM in the recess was used. In one flow cell, different concentrations of P5 and P7 primers were introduced into each lane with an aqueous carbonate buffer. In another flow cell, different concentrations of P15 and P7 primers were introduced into each lane with an aqueous carbonate buffer. The flow cell containing the carbonate buffer was incubated at about 60°C for 60 minutes, and the grafting process was a copper click reaction. In yet another flow cell, different concentrations of P15 and P7 primers were introduced into each lane with an aqueous sodium sulfate buffer. The flow cell was incubated at about 40°C for 4 hours, and the grafting process was a copper-free click reaction.

[0230] After primer grafting, the quantitative assays described herein were performed.

[0231] The library fragments (from the PhiX genome) were then introduced and clustered using bridge amplification. After clustering, the quantitative assays described herein were performed.

[0232] The results of these quantitative measurements are shown in Figure 5 middle. Figure 5 The amount of template for each primer is plotted (Y-axis) versus the primer concentration introduced into the corresponding lane of the corresponding flow cell. Clearly, carbonate buffer results in more efficient clustering than sodium sulfate buffer.

[0233] The same type of carbonate buffer was compared to an alkaline buffer solution (commercially available from Sigma-Aldrich, 1.5 M, pH 10.3).

[0234] Again, a patterned flow cell with PAZAM in the recess was used. In one flow cell, different concentrations of P5 and P7 primers were introduced into each lane with carbonate buffer. In another flow cell, different concentrations of P5 and P7 primers were introduced into each lane with alkaline buffer. The two flow cells were incubated at about 60°C for 1 hour.

[0235] After primer grafting, a Cal Fluor Red (CFR) assay was performed to determine whether primer grafting was successful. During the CFR assay, all lanes of the flow cell were exposed to fluorescently labeled (CAL Red) in a buffer solution. Red (CFR) dye) oligonucleotides. These oligonucleotides are complementary to the P5 / P7 primers. Fluorescently labeled complementary oligonucleotides bind to the surface-bound primers, and excess CFR-labeled complementary oligonucleotides are washed away. The surface is then scanned in a fluorescence detector to measure the CFR intensity on the surface. The results are shown in Figure 6 As shown in the figure, the intensity is higher for the flow cell grafted with carbonate buffer.

[0236] Example 3 - Elevated Temperature Soaking

[0237] Two patterned flow cells were used in this example. Each well of each flow cell included PAZAM and P5 and P7 primers grafted onto PAZAM.

[0238] One of the flow cells was exposed to the following pretreatment. Water was introduced into the flow cell before clustering. The temperature of the flow cell was raised to about 60°C for 1 hour. The other flow cell was not exposed to pretreatment before clustering. Library fragments (from the PhiX genome) were then introduced into the pretreated and non-pretreated flow cells and clustered using bridge amplification.

[0239] The collected sequencing data includes Pass Filter (PF%) (percentage) and Occupancy % (or % occupied). Pass Filter (PF) is a metric used to describe clusters that pass a purity threshold and are used for further processing and analysis of sequencing data. Higher Pass Filter % results indicate an increased yield of unique clusters for sequencing data. Occupancy % is a quantitative measure of the percentage of recesses occupied by clusters of amplicons (i.e., the percentage of recesses from which fluorescent signals are detected, and therefore, broadly, contain clusters). The average PF% results are shown as a function of clustering time in Figure 7 The average occupancy % results as a function of clustering time are shown in Figure 8 In. Figure 7 and Figure 8 In both depictions, the flow cell exposed to the elevated temperature pretreatment process exhibited higher sequencing metrics at similar clustering times.

[0240] Example 4—PEG

[0241] A patterned flow cell with PAZAM in the recesses was used. P5 and P7 primers were grafted in each lane of the flow cell using 1.5 μM carbonate buffer (similar to that described in Example 2) at about 60°C for 30 minutes.

[0242] In this example, dibenzocyclooctyne (DBCO)-activated polyethylene glycol (5,000 g / mol) was introduced into each of the other lanes (2 to 7) to attach PEG to some of the azide functional groups that remained unattached after primer grafting. Table 1 identifies the lane number, the concentration of DBCO-activated PEG in each lane, and the time when the copper-free click reaction occurred.

[0243] Table 1

[0244] Flow cell lane number 1* 2 3 4 5 6 7 8** DBCO activated PEG (mM) N / A 0.02 0.1 0.2 0.2 0.2 0.2 N / A Reaction time (min) N / A 120 120 120 60 30 5 N / A

[0245] *Standard comparison

[0246] **PEG-free

[0247] Therefore, different concentrations of DBCO-activated PEG and different reaction times were both tested in the same flow cell. The copper-free click reaction occurred in water at about 90°C for the stated times. In the two control lanes (1 and 8) of the flow cell, no PEG was introduced into PAZAM.

[0248] Library fragments (from human library (NA12878) and PhiX genome (1%)) were then introduced into the lanes of the flow cell. The library fragment introduced into lane 1 ("standard control") was introduced into a clustering mixture (comprising surfactant, solvent, polymerase, recombinase, nucleotides, nucleotide triphosphates, protein, enzyme, reducing agent, and magnesium source) that also contained PEG. In contrast, the library fragments introduced into lanes 2-7 containing PEG and into lane 8 ("no PEG") were introduced into a clustering mixture that did not contain PEG. Clustering was performed using bridge amplification.

[0249] Using HISEQX from Illumina Inc. TM The flow cell is sequenced. The main sequencing data collected from the flow cell include C1 intensity, Q30 (%) and error rate (%). C1 intensity is the fluorescence intensity of the red channel after one sequencing cycle (including read segment 1 data and read segment 2 data). Q30 (%) is the percentage of quality scores (Qscore) greater than Q30. A quality score (Q30) of 30 is equivalent to the probability of 1 incorrect base call in 1000 times. This means that the base call accuracy (i.e., the probability of correct base call) is 99.9%. A lower base call accuracy (Q20) of 99% will have a probability of 1 incorrect base call in 100 times, which means that every 100 base pair sequencing reads will likely contain one error. When the sequencing quality reaches Q30, almost all reads will be perfect with an accuracy of 99.9%. The error rate represents the percentage of incorrect base calls for the PhiX genome.

[0250] 9A to 9C The data in show the corresponding primary sequencing metrics for lanes 1-4 and 8 of the flow cell, and therefore show the data when different concentrations of PEG are introduced. FIG. 10A to FIG. 10C The data in show the corresponding primary sequencing metrics for lanes 1 and 4-8 of the flow cell, and therefore show data when the same concentration of PEG is introduced but reacted for different time periods. 9A to 9C and FIG. 10A to FIG. 10CThe data in show that PEG attached to PAZAM improves the main sequencing metrics compared to the negative control (i.e., no PEG in the clustering mixture and no PEG on the surface) of lane 8. In addition, the data for 0.2 mM PEG is comparable to the positive control (i.e., PEG in the clustering mixture but not on the surface) of lane 1.

[0251] During the sequencing process, single nucleotide polymorphisms (SNPs) change a single nucleotide in the DNA sequence, and indels incorporate or remove one or more nucleotides. These secondary metrics are also collected and shown in FIG. 11A to FIG. 11D and FIG. 12A to FIG. 12D In these figures, precision refers to accuracy and is calculated as the ratio:

[0252] [Number of true positive detections / (Number of true positive detections + Number of false positive detections)]

[0253] And recall refers to sensitivity and is calculated as the ratio of:

[0254] [Number of true positive detections / (Number of true positive detections + Number of false negative detections)]

[0255] FIG. 11A to FIG. 12D The results in show that PEG in the clustered mixture or attached to the polymer is desirable for restoring the secondary metric.

[0256] Terms

[0257] Clause 1. A copolymer comprising:

[0258] a plurality of first monomers comprising terminal functional groups to which at least two different primers are attached;

[0259] a plurality of second monomers, the second monomers comprising a second functional group different from the terminal functional group and selected from a phenyl group, a methoxypropyl group, a saccharide group, a vinyl pyrrolidone group, and an imidazole group; and

[0260] A plurality of third monomers, the third monomers being different from the first monomers and the second monomers.

[0261] Item 2. The copolymer according to Item 1, wherein the terminal functional group is selected from an azide group, an amino group, an alkyne group, an aldehyde group, a hydrazine group, a carboxyl group, a hydroxyl group, a tetrazole group, a tetrazine group, a nitrile oxide group, a nitrone group, a thiol group, and combinations thereof.

[0262] Clause 3. The copolymer according to clause 2, wherein:

[0263] The second monomer is an acrylamide monomer selected from N-phenylacrylamide and N-(3-methoxypropyl)acrylamide; or

[0264] The second monomer is an acrylate monomer selected from 2-hydroxy-1-methoxypropyl methacrylate, phenyl acrylate, benzyl methacrylate and glycosyloxyethyl methacrylate; or

[0265] The second monomer is a monomer containing the imidazole group, and the monomer containing the imidazole group is selected from 1-vinylimidazole, 2-vinylimidazole and 4-vinylimidazole.

[0266] Clause 4. The copolymer according to one of clauses 1 to 3, wherein:

[0267] The terminal functional group is an azide group; and

[0268] The third monomer is acrylamide.

[0269] Clause 5. The copolymer according to one of clauses 1 to 4, wherein:

[0270] The first monomer comprises from about 0.1% to about 20% of the copolymer;

[0271] The second monomer comprises from about 0.1% to about 20% of the copolymer; and

[0272] The third monomer comprises from about 60% to less than 100% of the copolymer.

[0273] Clause 6. A flow cell, comprising:

[0274] substrate;

[0275] a plurality of at least two different primers; and

[0276] A copolymer comprising:

[0277] a plurality of first monomers comprising terminal functional groups, wherein at least some of the plurality of at least two different primers are respectively attached to at least some of the terminal functional groups;

[0278] a plurality of second monomers, the second monomers comprising a second functional group different from the terminal functional group and selected from a phenyl group, a methoxypropyl group, a saccharide group, a vinyl pyrrolidone group, and an imidazole group; and

[0279] A plurality of third monomers, the third monomers being different from the first monomers and the second monomers.

[0280] Clause 7. A flow cell according to clause 6, wherein:

[0281] The terminal functional group is selected from an azide group, an amino group, an alkyne group, an aldehyde group, a hydrazine group, a carboxyl group, a hydroxyl group, a tetrazole group, a tetrazine group, a nitrile oxide group, a nitrone group, a thiol group, and a combination thereof; and

[0282] The second monomer is:

[0283] an acrylamide monomer selected from N-phenylacrylamide and N-(3-methoxypropyl)acrylamide; or

[0284] an acrylate monomer selected from the group consisting of 2-hydroxy-1-methoxypropyl methacrylate, phenyl acrylate, benzyl methacrylate and glycosyloxyethyl methacrylate; or

[0285] The monomer containing the imidazole group is selected from 1-vinylimidazole, 2-vinylimidazole and 4-vinylimidazole.

[0286] Clause 8. A flow cell according to one of clauses 6 or 7, wherein:

[0287] The substrate includes recessed portions separated by gap regions; and

[0288] The copolymer and the plurality of at least two different primers are located within at least some of the recesses.

[0289] Clause 9. A method for improving sequencing metrics, the method comprising:

[0290] grafting the primer set to the polymer hydrogel on the flow cell surface in the presence of a carbonate buffer for a time in a range of greater than 30 minutes to about 120 minutes; and

[0291] The grafted primer set is used to amplify the library template strand.

[0292] Clause 10. The method according to clause 9, wherein:

[0293] The carbonate buffer comprises sodium carbonate and sodium bicarbonate;

[0294] The sodium carbonate concentration is in the range of about 0.01 g / L to about 2.8 g / L; and

[0295] The concentration of sodium bicarbonate is in the range of about 0.09 g / L to about 2.1 g / L.

[0296] Clause 11. A method for improving sequencing metrics, the method comprising:

[0297] The flow cell including the primer set grafted onto the polymer hydrogel was pretreated by:

[0298] introducing water, an alkaline buffer having a pH range of 8 to 11, a high salt buffer, formamide, or isopropanol into the flow cell;

[0299] raising the flow cell to a temperature in the range of about 25°C to about 80°C;

[0300] maintaining the temperature for a period of time ranging from about 5 minutes to about 2 hours; and

[0301] The grafted primer set is then used to amplify the library template strand.

[0302] Clause 12. The method according to clause 11, wherein:

[0303] raising the temperature of the flow cell to about 60°C; and

[0304] maintaining the temperature for about 1 hour; or increasing the temperature of the flow cell to about 40° C.; and

[0305] The temperature was maintained for at least 30 minutes.

[0306] Item 13. A polymer hydrogel comprising:

[0307] an acrylamide copolymer comprising terminal azide groups in at least some of the side chains; and

[0308] Strained alkyne-activated polyethylene glycol (PEG) was attached to some of the terminal azide groups.

[0309] Item 14. The polymer hydrogel of Item 13, wherein the concentration of the strained alkyne-activated polyethylene glycol in the polymer hydrogel is in the range of about 0.5 mM to about 0.2 mM.

[0310] Item 15. A polymer hydrogel according to one of Item 13 or Item 14, wherein the weight average molecular weight of the PEG portion of the strained alkyne-activated polyethylene glycol is in the range of about 1,000 g / mol to about 20,000 g / mol; and optionally, the strained alkyne-activated polyethylene glycol is dibenzocyclooctyne (DBCO)-activated polyethylene glycol, monofluorinated cyclooctyne-activated polyethylene glycol, difluorinated cyclooctyne-activated polyethylene glycol, biarylazacyclooctyne-activated polyethylene glycol, and bicyclo[6.1.0]nonyne-activated polyethylene glycol.

[0311] Additional Notes

[0312] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0313] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0314] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A copolymer, comprising: a plurality of first monomers comprising terminal functional groups to which at least two different primers are attached; a plurality of second monomers, the second monomers comprising a second functional group different from the terminal functional group and selected from a phenyl group, a methoxypropyl group, a saccharide group, a vinyl pyrrolidone group, and an imidazole group; and A plurality of third monomers, the third monomers being different from the first monomers and the second monomers.

2. The copolymer according to claim 1, wherein the terminal functional group is selected from the group consisting of an azide group, an amino group, an alkyne group, an aldehyde group, a hydrazine group, a carboxyl group, a hydroxyl group, a tetrazole group, a tetrazine group, a nitrile oxide group, a nitrone group, a thiol group, and combinations thereof.

3. The copolymer according to claim 2, wherein: The second monomer is an acrylamide monomer selected from N-phenylacrylamide and N-(3-methoxypropyl)acrylamide; or The second monomer is an acrylate monomer selected from 2-hydroxy-1-methoxypropyl methacrylate, phenyl acrylate, benzyl methacrylate and glycosyloxyethyl methacrylate; or The second monomer is a monomer containing the imidazole group, and the monomer containing the imidazole group is selected from 1-vinylimidazole, 2-vinylimidazole and 4-vinylimidazole.

4. The copolymer according to claim 1, wherein: The terminal functional group is an azide group; and The third monomer is acrylamide.

5. The copolymer according to claim 1, wherein: The first monomer comprises from about 0.1% to about 20% of the copolymer; The second monomer comprises from about 0.1% to about 20% of the copolymer; and The third monomer comprises from about 60% to less than 100% of the copolymer.

6. A circulation cell, comprising: substrate; a plurality of at least two different primers; and A copolymer comprising: a plurality of first monomers comprising terminal functional groups, wherein at least some of the plurality of at least two different primers are respectively attached to at least some of the terminal functional groups; a plurality of second monomers, the second monomers comprising a second functional group different from the terminal functional group and selected from a phenyl group, a methoxypropyl group, a saccharide group, a vinyl pyrrolidone group, and an imidazole group; and A plurality of third monomers, the third monomers being different from the first monomers and the second monomers.

7. The flow cell according to claim 6, wherein: The terminal functional group is selected from an azide group, an amino group, an alkyne group, an aldehyde group, a hydrazine group, a carboxyl group, a hydroxyl group, a tetrazole group, a tetrazine group, a nitrile oxide group, a nitrone group, a thiol group, and a combination thereof; and The second monomer is: an acrylamide monomer selected from N-phenylacrylamide and N-(3-methoxypropyl)acrylamide; or an acrylate monomer selected from the group consisting of 2-hydroxy-1-methoxypropyl methacrylate, phenyl acrylate, benzyl methacrylate and glycosyloxyethyl methacrylate; or The monomer containing the imidazole group is selected from 1-vinylimidazole, 2-vinylimidazole and 4-vinylimidazole.

8. The flow cell according to claim 6, wherein: The substrate includes recessed portions separated by gap regions; and The copolymer and the plurality of at least two different primers are located within at least some of the recesses.

9. A method for improving sequencing metrics, the method comprising: grafting the primer set to the polymer hydrogel on the surface of the flow cell in the presence of a carbonate buffer for a time in a range of greater than 30 minutes to about 120 minutes; as well as The grafted primer set is used to amplify the library template strand.

10. The method according to claim 9, wherein: The carbonate buffer comprises sodium carbonate and sodium bicarbonate; The sodium carbonate concentration is in the range of about 0.01 g / L to about 2.8 g / L; and The concentration of sodium bicarbonate is in the range of about 0.09 g / L to about 2.1 g / L.

11. A method for improving sequencing metrics, the method comprising: The flow cell including the primer set grafted onto the polymer hydrogel was pretreated by: introducing water, an alkaline buffer having a pH range of 8 to 11, a high salt buffer, formamide, or isopropanol into the flow cell; raising the flow cell to a temperature in the range of about 25°C to about 80°C; maintaining the temperature for a period of time ranging from about 5 minutes to about 2 hours; and The grafted primer set is then used to amplify the library template strand.

12. The method according to claim 11, wherein: raising the temperature of the flow cell to about 60°C; and maintaining the temperature for about 1 hour; or increasing the temperature of the flow cell to about 40° C.; and The temperature was maintained for at least 30 minutes.

13. A polymer hydrogel, comprising: an acrylamide copolymer comprising terminal azide groups in at least some of the side chains; and Strained alkyne-activated polyethylene glycol (PEG) was attached to some of the terminal azide groups.

14. The polymer hydrogel of claim 13, wherein the concentration of the strained alkyne-activated polyethylene glycol in the polymer hydrogel is in the range of about 0.5 mM to about 0.2 mM.

15. The polymer hydrogel of claim 13, wherein the weight average molecular weight of the PEG portion of the strained alkyne-activated polyethylene glycol is in the range of about 1,000 g / mol to about 20,000 g / mol; and optionally, the strained alkyne-activated polyethylene glycol is dibenzocyclooctyne (DBCO)-activated polyethylene glycol, monofluorinated cyclooctyne-activated polyethylene glycol, difluorinated cyclooctyne-activated polyethylene glycol, biarylazacyclooctyne-activated polyethylene glycol, and bicyclo[6.1.0]nonyne-activated polyethylene glycol.

Images