Compositions comprising recombinant bacillus cells and other biological control agents

Abstract

The present invention relates to a composition comprising a) a Bacillus cell expressing a recombinant spore-producing outer wall of a fusion protein comprising (i) at least one plant growth stimulating protein or peptide and (ii) a targeting sequence localizing the fusion protein onto the spore outer wall of the Bacillus cell in a synergistically effective amount; and b) at least one other biological control agent selected from a mutant of a particular microorganism disclosed herein and / or a particular strain of a microorganism disclosed herein having all identifying characteristics of the respective strain, and / or at least one metabolite produced by the respective strain, and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or phytopathogens. Furthermore, the present invention relates to the use of this composition and methods for enhancing plant growth, promoting plant health and / or reducing overall damage of plants and plant parts.

Description

[0001] The present application is a divisional application, the application date of the original application is September 17, 2015, the application number is 201580062420.5 (International Application Number PCT / US2015 / 050592), and the name is “Compositions containing recombinant Bacillus cells and other biological control agents”.

[0002] Cross-reference to related applications

[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 051,911, filed on September 17, 2014, the contents of which are incorporated herein by reference in their entirety.

[0004] Reference to electronically submitted sequence listing

[0005] The official text of the sequence listing is submitted electronically via EFS-Web in the form of an ASCII format sequence listing with the file name "BCS149057WO_ST25.txt" created on September 14, 2015, with a size of 152 kilobytes, and submitted simultaneously with the specification. The sequence listing contained in this ASCII format document is part of the specification and is incorporated herein in its entirety by reference. Technical Field

[0006] The present invention relates to a composition comprising synergistically effective amounts of: (i) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (x) at least one plant growth stimulating protein or peptide, and (y) a targeting sequence that localizes the fusion protein to the exosporium of the Bacillus cell; and (ii) at least one other biological control agent selected from a specific microorganism disclosed herein and / or a specific strain of a microorganism disclosed herein, a mutant having all the identifying characteristics of the respective strain, and / or at least one metabolite produced by the respective strain, the metabolite exhibiting the ability to improve plant growth and / or health and / or activity against insects, mites, nematodes and / or plant pathogens. In addition, the present invention relates to the use of the composition and methods for enhancing plant growth, promoting plant health and / or reducing overall damage to plants and plant parts. Background Art

[0007] In crop protection, there is a continuous need for applications that improve plant health and / or growth. Healthier plants generally result in higher yields and / or better quality of the plant or its products.

[0008] In order to promote plant health, fertilizers based on inorganic and organic substances are used worldwide. Fertilizers can be single substances or combinations and are used to provide nutrients to plants. A major breakthrough in fertilizer application was the development of nitrogen-based fertilizers by Justus von Liebig around 1840. However, fertilizers can lead to soil acidification and instability of the nutrient balance in the soil, including the depletion of minerals and the enrichment of salts and heavy metals. In addition, excessive fertilizer use can lead to changes in soil fauna and can pollute surface water and groundwater. In addition, unhealthy substances such as nitrates may be enriched in plants and fruits.

[0009] In addition, pesticides and fungicides are used for pest control worldwide. Synthetic pesticides or fungicides are usually non-specific and therefore can act on organisms beyond the target organism, including other naturally occurring beneficial organisms. Due to their chemical properties, they may also be toxic and non-biodegradable. Consumers around the world are increasingly aware of the potential environmental and health issues associated with chemical residues, particularly in food. This makes the consumer pressure to reduce the use of chemical (that is, synthetic) pesticides or at least reduce its amount constantly increasing. Therefore, it is necessary to control the food chain demand while still allowing effective pest control.

[0010] Another problem that arises with the use of synthetic insecticides or fungicides is that repeated and individual application of insecticides or fungicides often leads to the selection of resistant animal pests or microorganisms. Often, these strains also have cross-resistance to other active ingredients with the same mode of action. Thus, it will no longer be possible to effectively control pathogens using the active compounds. However, the development of active ingredients with new mechanisms of action is difficult and expensive.

[0011] The use of biological control agents (BCAs) is an alternative to fertilizers and synthetic pesticides. In some cases, the efficacy of biological control agents has not yet reached the same level as fertilizers or with traditional insecticides and fungicides, especially under conditions of severe infection pressure. Therefore, in some cases, biological control agents, their mutants and metabolites produced therefrom, especially at low application rates, are not completely satisfactory. Therefore, there is a constant need to develop new, alternative plant health enhancers and / or plant protection agents, which in some areas at least help to meet the above needs. Summary of the invention

[0012] In view of this, the object of the present invention is in particular to provide a composition having an enhanced ability to improve plant growth and / or enhance plant health or showing enhanced activity against insects, mites, nematodes and / or plant pathogens.

[0013] It has therefore been found that these objects are achieved using the composition of the invention as defined below. By administering a) a recombinant exine-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from enzymes involved in the production or activation of plant growth stimulating compounds; enzymes that degrade or modify bacterial, fungal or plant nutrient sources; and proteins or peptides that protect plants against pathogens or pests; and (ii) a targeting sequence that localizes said fusion protein to the exine of the spore of the Bacillus cell; and b) in addition to said recombinant Bacillus cell of the invention, at least one specific strain disclosed herein, preferably in a superadditive manner, enhancing (i) the ability of plants to grow, plant yield and / or plant health and / or (ii) the activity against insects, mites, nematodes and / or plant pathogens.

[0014] References herein to targeting sequences, exosporium proteins, exosporium protein fragments, fusion proteins, and recombinant exosporium-producing Bacillus cells expressing such fusion proteins should not be considered independent embodiments. Rather, throughout this application, references to targeting sequences, exosporium proteins, exosporium protein fragments, fusion proteins, and recombinant exosporium-producing Bacillus cells expressing such fusion proteins should be considered as disclosed and claimed only in combination (and preferably in synergistic combination) with one or more of the specific biocontrol agents described herein. Furthermore, references to "specific microorganisms disclosed herein" or "specific biocontrol agents described or disclosed herein" are intended to include biocontrol agents and microorganisms, including strains, mutants, and metabolites thereof, as described in paragraphs [000183]-[000226] below.

[0015] The present invention relates to a composition comprising synergistically effective amounts of: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from an enzyme involved in the production or activation of a plant growth stimulating compound, an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source, or a protein or peptide that protects a plant against a pathogen; and (ii) a targeting sequence that localizes the fusion protein to the exosporium of a Bacillus cell; and b) at least one additional and different specific biological control agent disclosed herein and / or a mutant of a specific strain of a microorganism disclosed herein having all the identifying characteristics of the respective strain, and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0016] In some embodiments, the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; a targeting sequence comprising SEQ ID NO: 1; or an exosporium protein comprising an amino acid sequence having at least 85% identity to SEQ ID NO:2.

[0017] In other embodiments, the recombinant Bacillus cell is a cell of a member of the Bacillus cereus family, such as Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis, and combinations thereof. In another embodiment, the recombinant Bacillus cell is a cell of Bacillus thuringiensis BT013A.

[0018] In some aspects, the fusion protein comprises an enzyme involved in the production or activation of a plant growth stimulating compound selected from the group consisting of 3-hydroxybutanone reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase, tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side chain oxidase, nitrile hydrolase, hydrolase), nitrilase, peptidase, protease, adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5' ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyl transferase, β-glucosidase, cis hydroxylase, CK cis hydroxylase, CK N-glucosyl transferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellic 2B / 3B hydrolase hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitosanase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylate deaminase, and enzymes involved in the production of nod factor.

[0019] In other aspects, the fusion protein comprises an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source selected from the group consisting of cellulases, lipases, lignin oxidases, proteases, glycoside hydrolases, phosphatases, nitrogenases, nucleases, amidases, nitrate reductases, nitrite reductases, amylases, ammonia oxidases, ligninases, glucosidases, phospholipases, phytases, pectinases, glucanases, sulfatases, ureases, xylanases, and siderophores.

[0020] In some embodiments, the fusion protein is expressed under the control of a sporulation promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein. The fusion protein can be expressed under the control of a high-expression sporulation promoter. In certain aspects, the high-expression sporulation promoter comprises a sigma-K sporulation-specific polymerase promoter sequence. In other aspects, the sporulation promoter comprises a nucleic acid sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of the nucleic acid sequences in SEQ ID NOs: 85-103. In some embodiments, the sporulation promoter comprises a nucleic acid sequence that is 100% identical to any one of the nucleic acid sequences in SEQ ID NOs: 85-103.

[0021] In other embodiments, at least one biological control agent is a strain of Bacillus subtilis or a strain of Bacillus amyloliquefaciens that produces a fengycin or plipastatin-type compound, an iturin-type compound, and / or a surfactin-type compound. For background, see the following review article: Ongena, M. et al., "Bacillus Lipopeptides: Versatile Weapons for Plant Disease Biocontrol," Trends in Microbiology, Vol 16, No. 3, March 2008, pp. 115-125. Bacillus strains capable of producing lipopeptides include Bacillus subtilis QST713, Bacillus amyloliquefaciens strain D747 (which can be used as Available from Etec CropSolutions, NZ and also available as DOUBLE NICKEL TM obtained from Certis, US); Bacillus subtilis MBI600 (available as Obtained from Becker Underwood, US EPA Registration No. 71840-8); Bacillus subtilis Y1336 (available as WP was obtained from Bion-Tech, Taiwan, China, and is registered as a biofungicide in Taiwan, China, with registration numbers 4764, 5454, 5096, and 5277); Bacillus amyloliquefaciens, particularly strain FZB42 (can be used as Obtained from ABiTEP, DE); Bacillus subtilis variant Bacillus amyloliquefaciens FZB24 can be used as a fungicide or ECO (EPA Registration No. 70127-5) was obtained from Novozymes Biologicals Inc. (Salem, Virginia) or Syngenta Crop Protection, LLC (Greensboro, North Carolina).

[0022] In another embodiment, the at least one biological control agent is selected from Bacillus pumilus strain QST2808, Bacillus subtilis strain QST713, Bacillus subtilis strain QST30002, Bacillus subtilis strain QST30004, Streptomyces microflavus strain NRRL B-50550, Streptomyces microflavus strain M, Bacillus firmus strain 1-1582, mutants thereof having all the identifying characteristics of the respective strains, and at least one metabolite produced by the respective strains that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0023] In some embodiments, the compositions of the invention comprise synergistically effective amounts of: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from enzymes involved in the production or activation of plant growth stimulating compounds, and enzymes that degrade or modify bacterial, fungal, or plant nutrient sources; or proteins or peptides that protect plants against pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exosporium of the Bacillus cell; and b) Bacillus firmus strain I-1582.

[0024] In some embodiments, the compositions of the invention comprise synergistically effective amounts of: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from enzymes involved in the production or activation of plant growth stimulating compounds, and enzymes that degrade or modify bacterial, fungal, or plant nutrient sources, or at least one protein or peptide that protects plants against pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exosporium of the Bacillus cell; and b) Bacillus subtilis strain QST713.

[0025] In some embodiments, the compositions of the invention comprise synergistically effective amounts of: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from enzymes involved in the production or activation of plant growth stimulating compounds, and enzymes that degrade or modify bacterial, fungal, or plant nutrient sources, or at least one protein or peptide that protects plants against pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exosporium of the Bacillus cell; and b) Bacillus pumilus strain QST2808.

[0026] In another embodiment, the composition further comprises c) at least one fungicide and / or d) at least one insecticide. The at least one fungicide and / or at least one insecticide may be synthetic. In one aspect of this embodiment, the biological control agent and the additional insecticide of this composition comprise Bacillus firmus strain 1-1582 and clothianidin, respectively.

[0027] In specific aspects of the above embodiments, (i) the biological control agent is Bacillus subtilis QST713, or a mutant having all the identifying characteristics of Bacillus subtilis QST713, and /

[0028] or a mutant having at least 95% or at least 98% sequence identity with Bacillus subtilis QST713; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably having at least 95% sequence identity with SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0029] In specific aspects of the above embodiments, (i) the biological control agent is Bacillus firmus 1-1582, or a mutant having all the identifying characteristics of Bacillus firmus 1-1582, and / or a mutant having at least 95% or at least 98% sequence identity to Bacillus firmus 1-1582; ​​(ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably having at least 95% or at least 98% sequence identity to SEQ ID NOs: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A. In another aspect of this embodiment, the composition further comprises clothianidin.

[0030] In specific aspects of the above embodiments, (i) the biological control agent is Bacillus pumilus QST2808, or a mutant having all the identifying characteristics of Bacillus pumilus QST2808, and / or a mutant having at least 95% or at least 98% sequence identity to Bacillus pumilus QST2808; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably having at least 95% or at least 98% sequence identity to SEQ ID NOs: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0031] In some aspects, the composition further comprises at least one auxiliary agent selected from the group consisting of extenders, solvents, spontaneity promoters, carriers, emulsifiers, dispersants, frost protectants, thickeners and adjuvants.

[0032] In other aspects, the invention relates to seeds treated with any of the compositions disclosed herein.

[0033] In addition, the present invention relates to the use of the disclosed compositions as fungicides and / or insecticides. In certain aspects, the disclosed compositions are used to reduce overall damage to plants and plant parts and losses in harvested fruits or vegetables caused by insects, mites, nematodes and / or plant pathogens. In other aspects, the disclosed compositions are used to enhance plant growth and / or promote plant health.

[0034] In addition, the present invention relates to a method of treating plants, plant parts (e.g., seeds, roots, rhizomes, corms, bulbs or tubers) and / or the locus (e.g., soil) on or near which the plants or plant parts grow to enhance plant growth and / or promote plant health, comprising the step of simultaneously or sequentially applying to the plants, plant parts or plant locus a synergistically effective amount of: a) a recombinant sporulating exine-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from the group consisting of enzymes involved in the production or activation of plant growth stimulating compounds; enzymes that degrade or modify bacterial, fungal or plant nutrient sources; and proteins or peptides that protect plants against pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exine of the spore of the Bacillus cell; and b) at least one biological control agent disclosed herein and / or a mutant of a specific strain of a microorganism disclosed herein having all the identifying characteristics of the respective strain, and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0035] In another embodiment, the present invention is a method for reducing overall damage to plants and plant parts and losses in harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens, comprising the step of simultaneously or sequentially applying to the plant, plant part (e.g., seed, root, rhizome, corm, bulb or tuber) and / or the locus (e.g., soil) on or near which the plant or plant part is growing a synergistically effective amount of: a) a recombinant sporulating exine Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth inhibitor; a stimulatory protein or peptide selected from the group consisting of enzymes involved in the production or activation of plant growth stimulating compounds; enzymes that degrade or modify bacterial, fungal or plant nutrient sources; and proteins or peptides that protect plants against pathogens; and (ii) a targeting sequence that localizes the fusion protein to the spore exosome of a Bacillus cell; and b) at least one mutant of a biological control agent disclosed herein and / or a specific strain of a microorganism disclosed herein having all the identifying characteristics of the respective strains, and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0036] In the above paragraphs, the term "comprising" or any of its derivatives (eg, containing, including) may be replaced with "consisting of" or its appropriate corresponding derivatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Shown is an alignment of the amino acid sequence of the amino-terminal portion of Bacillus anthracis Sterne strain BclA with corresponding regions of various exosporium proteins from Bacillus cereus family members. DETAILED DESCRIPTION

[0038] In general, "pesticide" means the ability of a substance to increase the mortality or inhibit the growth rate of plant pests. The term is used herein to describe the property of a substance that exhibits activity against insects, mites, nematodes and / or plant pathogens. In the sense of the present invention, the term "pest" includes insects, mites, nematodes and / or plant pathogens.

[0039] As used herein, "biological control" is defined as the control of pathogens and / or insects and / or mites and / or nematodes by the use of another organism. Known mechanisms of biological control include bacteria that control root rot by outcompeting fungi for space or nutrients on the root surface. Bacterial toxins, such as antibiotics, have been used to control pathogens. The toxins can be isolated and applied directly to the plant, or the bacterial species can be given to produce the toxins in situ. Other methods of biological control include the application of certain fungi that produce ingredients that are effective against target plant pathogens, insects, mites or nematodes, or that attack target pests / pathogens. "Biological control" used in connection with the present invention may also include microorganisms that have a beneficial effect on plant health, growth, vitality, stress response or yield. Application routes include spray application, soil application and seed treatment.

[0040] The term "metabolite" refers to any compound, substance or by-product of the fermentation of the microorganism that has pesticide, fungicidal or nematicidal activity or the ability to enhance plant health or increase plant yield. The term "mutant" refers to a variant of a parent strain and a method for obtaining a mutant or variant having a higher pesticide activity than that exhibited by the parent strain. A "parent strain" is defined herein as the original strain or preserved strain before mutagenesis. To obtain the mutant, the parent strain can be treated with a chemical agent (e.g., N-methyl-N'-nitro-N-nitrosoguanidine, ethylmethanesulfone, or by irradiation using gamma rays, X-rays or ultraviolet radiation, or by other methods known to those skilled in the art.

[0041] A "variant" is a strain having all of the identifying characteristics of an NRRL or ATCC Accession Number as set forth herein, and can be identified as having a genome that hybridizes under high stringency conditions to the genome of the NRRL or ATCC Accession Number.

[0042] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonding between the bases of the nucleotide residues. Hydrogen bonding can occur through Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may include two chains forming a double-stranded structure, three or more chains forming a multi-stranded complex, a single chain that can self-hybridize, or any combination of these. Hybridization reactions can be carried out under different "stringent" conditions. Generally speaking, low stringency hybridization reactions are carried out at about 40°C in 10×SSC, or a solution of equivalent ionic strength / temperature. Medium stringency hybridization is usually carried out in 6×SSC at about 50°C, and high stringency hybridization reactions are usually carried out in 1×SSC at about 60°C.

[0043] Variants of the NRRL or ATCC accession number may also be defined as strains whose genomic sequence has greater than 85%, more preferably greater than 90%, or more preferably greater than 95% sequence identity with the sequence of the genome of the NRRL or ATCC accession number. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) having a certain "sequence identity" percentage (e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) with another sequence means that, when compared, the percentage of bases (or amino acids) is the same when comparing the two sequences. The comparison and homology percentage or sequence identity can be determined using software programs known in the art, such as those described in Appendix 30 of Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987), Section 7.7.18, Table 7.7.1.

[0044] NRRL is the abbreviation of Agricultural Research Service Culture Collection, and its address is: National Center for Applied Agricultural Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604, USA.

[0045] ATTC is the abbreviation of American Type Culture Collection, and its address is: ATCC Patent Collection Center, 10801 University Avenue, Manassas, Virginia, USA, Postal Code 10110.

[0046] CNCM is the abbreviation of the Collection Nationale de Cultures de Microorganismes of the Pasteur Institute of France, and its address is: France, 25 Rue du Docteur Roux, F-75724 Paris Cedex 15, Pasteur Institute.

[0047] All strains described herein and having accession numbers prefixed with NRRL, ATCC or CNCM have been deposited with the above respective depositaries under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0048] "Enzymes involved in the production or activation of plant growth stimulating compounds" include any enzyme that catalyzes any step in the biosynthetic pathway of a compound that stimulates plant growth or changes plant architecture, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or changes plant architecture to an active or more active form of the compound. Such compounds include, but are not limited to, for example, small molecule plant hormones (such as auxins and cytokinins), bioactive peptides, and small plant growth stimulating molecules synthesized by bacteria or fungi in the rhizosphere (e.g., 2,3-butanediol).

[0049] As used herein, "plant immune system enhancer protein or peptide" includes any protein or peptide that has a beneficial effect on the immune system of a plant.

[0050] As used herein, the term "plant growth stimulating protein or peptide" includes any protein or peptide that increases plant growth in plants exposed to the protein or peptide.

[0051] The terms "promoting plant growth" and "stimulating plant growth" are used interchangeably herein and refer to the ability to enhance or increase at least one of a plant's height, weight, leaf size, root size or stem size, increase a plant's protein yield or increase a plant's grain yield.

[0052] As used herein, a "protein or peptide that protects a plant against a pathogen" includes any protein or peptide that renders a plant exposed to the protein or peptide less susceptible to infection by the pathogen.

[0053] As used herein, a "protein or peptide that enhances stress resistance in a plant" includes any protein or peptide that makes a plant exposed to the protein or peptide more resistant to stress.

[0054] The term "plant binding protein or peptide" refers to any peptide or protein that is capable of binding specifically or non-specifically to any part of a plant (e.g., roots or aerial portions of a plant, such as leaves, stems, flowers or fruits) or to plant matter.

[0055] As used herein, the term "targeting sequence" refers to a polypeptide sequence that results in the localization of a longer polypeptide or protein on the exospore wall of a Bacillus cereus family member.

[0056] Recombinant exosporium-producing Bacillus cells expressing fusion proteins

[0057] The fusion protein contains a targeting sequence that targets the fusion protein to the spore exosome of a member of the Bacillus cereus family, an exosome protein or exosome protein fragment, and: (a) a plant growth stimulating protein or peptide; (b) a protein or peptide that protects plants from pathogens; (c) a protein or peptide that enhances plant stress resistance; (d) a plant binding protein or peptide; or (e) a plant immune system enhancer protein or peptide. When expressed in a member of the Bacillus cereus family bacterium, these fusion proteins are targeted to the exosome layer of the spore and are physically oriented so that the protein or peptide is displayed on the outside of the spore.

[0058] This Bacillus spore exine display (BEMD) system can be used to deliver peptides, enzymes and other proteins to plants (e.g., to plant leaves, fruits, flowers, stems or roots) or to plant growth media (e.g., soil). Peptides, enzymes and proteins delivered to soil or another plant growth medium in this way remain and show activity in the soil for a long time. The recombinant spore exine-producing Bacillus cells expressing the fusion proteins described herein are introduced into the soil or the rhizosphere of plants to achieve beneficial enhancement of plant growth under many different soil conditions. The use of BEMD to produce these enzymes allows them to continue to exert their beneficial results on plants and rhizosphere in the first few months of plant life.

[0059] Targeting sequences, exosporium proteins, and exosporium protein fragments

[0060] For ease of reference, the SEQ ID numbers of the peptide and protein sequences referred to herein are listed in Table 1 below.

[0061] Table 1. Peptide sequences and protein sequences

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069] AA = amino acid

[0070] * Bacillus anthracis Stern strain BclA has 100% sequence identity with Bacillus thuringiensis BclA. Thus, SEQ ID NOs: 1, 2, and 59 also represent amino acids 1-41 of Bacillus thuringiensis BclA, full-length Bacillus thuringiensis BclA, and amino acids 1-196 of Bacillus thuringiensis BclA, respectively. Similarly, SEQ ID NO: 60 also represents a methionine residue plus amino acids 20-35 of Bacillus thuringiensis BclA.

[0071] **Bacillus mycoides hypothetical protein TIGR03720 and Bacillus mycoides hypothetical protein

[0072] WP003189234 has 100% sequence identity. Therefore, SEQ ID NOs: 57 and 58 also represent amino acids 1-136 of Bacillus mycoides hypothetical protein WP003189234 and the full-length Bacillus mycoides hypothetical protein WP003189234, respectively.

[0073] Bacillus is a rod-shaped bacteria genus. The cereus family of bacteria includes the following species: Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus toyota and Bacillus weiheni. Under stress conditions, the cereus family bacteria undergo sporulation and form oval endospores that can remain dormant for a long time. The outermost layer of the endospore is called the exospore wall, and includes a basal layer surrounded by external fine hairs (nap) of hair-like protrusions. The silk on the hair-like fine hairs is mainly formed by collagen-like glycoprotein BclA, and the basal layer is composed of many different proteins. Another collagen-related protein BclB is also present in the exospore wall and exposed on the endospores of the cereus family members.

[0074] BclA, the major component of surface hairs, has been shown to be attached to the exospore wall with its amino terminus (N-terminus) located on the basal layer and its carboxyl terminus (C-terminus) extending outward from the spore.

[0075] It has been previously discovered that certain sequences from the N-terminal regions of BclA and BclB can be used to target peptides or proteins to the exosporium of Bacillus cereus endospores (see U.S. Patent Publications 2010 / 0233124 and 2011 / 0281316, and Thompson et al., “Targeting of the BclA and BclB Proteins to the Bacillus anthracis Spore Surface,”

[0076] Molecular Microbiology, 70(2):421-34 (2008), each of which is incorporated herein by reference in its entirety). The BetA / BAS3290 protein of Bacillus anthracis was also found to be localized to the exospore wall.

[0077] In particular, amino acids 20-35 of BclA from Bacillus anthracis Stern strain have been found to be sufficient for targeting to the exosporium. A sequence alignment of amino acids 1-41 of BclA (SEQ ID NO: 1) with several other Bacillus cereus family exosporium proteins with related sequences and the corresponding N-terminal region of Bacillus cereus family proteins is shown in Figure 1 In. By Figure 1 As can be seen, there is a region of high homology in all proteins in the region corresponding to amino acids 20-41 of BclA. However, in these sequences, the amino acids corresponding to amino acids 36-41 of BclA contain secondary structure and are not essential for the localization of the fusion protein to the exospore wall. The conserved targeting sequence region of BclA (amino acids 20-35 of SEQ ID NO: 1) is Figure 1 The more highly conserved region of BclA spanning amino acids 25-35 within the targeting sequence is shown in bold in Figure 1 The sequence is underlined in and is the recognition sequence for ExsFA / BxpB / ExsFB and homologues that direct and assemble the proteins on the exospore exine surface. Figure 1The amino acid sequences of SEQ ID NOs: 3, 5 and 7 in are amino acids 1-33 of Bacillus anthracis Stern strain BetA / BAS3290, methionine, followed by amino acids 2-43 of Bacillus anthracis Stern strain BAS4623 and amino acids 1-34 of Bacillus anthracis Stern strain BclB, respectively. (For BAS4623, it was found that replacing the valine present at position 1 in the native protein with methionine resulted in better expression.) Figure 1 As can be seen, each of these sequences contains a conserved region corresponding to amino acids 20-35 of BclA (SEQ ID NO: 1; shown in bold) and a more highly conserved region corresponding to amino acids 20-35 of BclA (underlined).

[0078] The remaining proteins from Bacillus cereus family members also contain conserved targeting regions. Figure 1, SEQ ID NO:9 is amino acids 1-30 of Bacillus anthracis Stern strain BAS1882, SEQ ID NO:11 is amino acids 1-39 of the gene product of Bacillus weihenstephensis KBAB4 2280, SEQ ID NO:13 is amino acids 1-39 of the gene product of Bacillus weihenstephensis KBAB4 3572, SEQ ID NO:15 is amino acids 1-49 of the exosporium leader peptide of Bacillus cereus VD200, SEQ ID NO:17 is amino acids 1-33 of the exosporium leader peptide of Bacillus cereus VD166, SEQ ID NO:19 is amino acids 1-39 of Bacillus cereus VD200 hypothetical protein IKG_04663, SEQ ID NO:21 is amino acids 1-39 of the β-propeller protein of Bacillus weihenstephensis KBAB4 YVTN, SEQ ID NO:23 is amino acids 1-39 of the β-propeller protein of Bacillus weihenstephensis KBAB4 YVTN, SEQ ID NO:24 is amino acids 1-39 of the β-propeller protein of Bacillus weihenstephensis KBAB4 YVTN, SEQ ID NO:25 is amino acids 1-49 of the β-propeller protein of Bacillus cereus VD200, SEQ ID NO:26 is amino acids 1-39 of the β-propeller protein of Bacillus weihenstephensis KBAB4 YVTN, SEQ ID NO:27 is amino acids 1-39 of the β-propeller protein of Bacillus weihenstephensis KBAB4 YVTN SEQ ID NO:23 is amino acids 1-30 of Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, SEQ ID NO:25 is amino acids 1-30 of Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, SEQ ID NO:27 is amino acids 1-36 of Bacillus weihenstephensis KBAB4 collagen containing triple helical repeats, SEQ ID NO:29 is amino acids 1-39 of Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, SEQ ID NO:31 is amino acids 1-30 of Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, SEQ ID NO:33 is amino acids 1-21 of Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, SEQ ID SEQ ID NO:35 is amino acids 1-22 of Bacillus thuringiensis 35646 collagen triple helical repeat protein, SEQ ID NO:43 is amino acids 1-35 of Bacillus cereus hypothetical protein WP_69652, SEQ ID NO:45 is amino acids 1-41 of Bacillus cereus spore wall leader WP016117717, SEQ ID NO:47 is amino acids 1-49 of Bacillus cereus spore wall peptide WP002105192, SEQ ID NO:49 is amino acids 1-38 of Bacillus cereus hypothetical protein WP87353, SEQ ID NO:51 is amino acids 1-39 of Bacillus cereus spore wall peptide 02112369, SEQ ID NO:53 is amino acids 1-39 of Bacillus cereus spore wall protein WP016099770, SEQ ID SEQ ID NO:55 is amino acids 1-36 of the Bacillus thuringiensis hypothetical protein YP006612525, and SEQ ID NO:57 is amino acids 1-136 of the Bacillus mycoides hypothetical protein TIGR03720. Figure 1As shown, each of the N-terminal regions of these proteins contains a region conserved with amino acids 20-35 of BclA (SEQ ID NO: 1), as well as a more highly conserved region corresponding to amino acids 25-35 of BclA.

[0079] Any portion of BclA including amino acids 20-35 can be used as a targeting sequence. In addition, full-length exosporium proteins or exosporium protein fragments can be used to target fusion proteins to the exosporium. Thus, full-length BclA or fragments of BclA including amino acids 20-35 can be used to target to the exosporium. For example, full-length BclA (SEQ ID NO: 2) or a medium fragment of BclA lacking the carboxyl terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA), can be used to target the fusion protein to the exosporium. Medium fragments (e.g., fragments of SEQ ID NO: 59) have less secondary structure than full-length BclA and have been found to be suitable for use as targeting sequences. The targeting sequence may also comprise a shorter portion of BclA including amino acids 20-35, such as SEQ ID NO: 1 (amino acids 1-41 of BclA), amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, or SEQ ID NO: 60 (a methionine residue linked to amino acids 20-35 of BclA). Even shorter fragments of BclA that comprise only some of amino acids 20-35 exhibit the ability to target the fusion protein to the exospore wall. For example, the targeting sequence may comprise amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.

[0080] Alternatively, BetA / BAS3290, BAS4623, BclB, BAS1882, KBAB4 2280 gene product, KBAB4 3572 gene product, Bacillus cereus VD200 spore wall leader peptide, Bacillus cereus VD166 spore wall leader peptide, Bacillus cereus VD200 hypothetical protein IKG_04663, Bacillus weihenstephensis KBAB4 YVTN β-propeller protein, Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, Bacillus weihenstephensis KBAB4 collagen containing triple helical repeats, Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, Bacillus thuringiensis 3564 6 Collagen triple helical repeat protein, Bacillus cereus hypothetical protein WP_69652, Bacillus cereus spore wall leader WP016117717, Bacillus cereus spore wall peptide WP002105192, Bacillus cereus hypothetical protein WP87353, Bacillus cereus spore wall peptide 02112369, Bacillus cereus spore wall protein WP016099770, Bacillus thuringiensis hypothetical protein YP006612525 or Bacillus mycoides hypothetical protein TIGR03720 can be used as a targeting sequence. Figure 1As can be seen, amino acids 12-27 of BetA / BAS3290, amino acids 23-38 of BAS4623, amino acids 13-28 of BclB, amino acids 9-24 of BAS1882, amino acids 18-33 of the KBAB42280 gene product, amino acids 18-33 of the KBAB4 3572 gene product, amino acids 28-43 of the exosporium leader peptide of Bacillus cereus VD200, amino acids 12-27 of the exosporium leader peptide of Bacillus cereus VD166, amino acids 18-33 of the hypothetical protein IKG_04663 of Bacillus cereus VD200, and amino acids 14-27 of the KBAB42280 gene product of Bacillus cereus VD166. amino acids 18-33 of YVTN β-propeller protein, amino acids 9-24 of Bacillus weihenstephensis hypothetical protein bcerkbab4_2363, amino acids 9-24 of Bacillus weihenstephensis hypothetical protein bcerkbab4_2131, amino acids 15-30 of Bacillus weihenstephensis KBAB4 collagen containing triple helical repeats, amino acids 18-33 of Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, amino acids 9-24 of Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, amino acids 1-15 of Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, amino acids 1-16 of Bacillus thuringiensis 35646 collagen triple helical repeat protein, Amino acids 14-29 of Bacillus cereus hypothetical protein WP_69652, amino acids 20-35 of Bacillus cereus spore wall leader WP016117717, amino acids 28-43 of Bacillus cereus spore wall peptide WP002105192, amino acids 17-32 of Bacillus cereus hypothetical protein WP87353, amino acids 18-33 of Bacillus cereus spore wall peptide 02112369, amino acids 18-33 of Bacillus cereus spore wall protein WP016099770, amino acids 15-30 of Bacillus thuringiensis hypothetical protein YP006612525, and amino acids 115-130 of Bacillus mycoides hypothetical protein TIGR03720 all correspond to amino acids 20-35 of BclA. Therefore, any portion of these proteins including the corresponding amino acids listed above can be used as a targeting sequence.

[0081] In addition, any amino acid sequence comprising amino acids 20-35 of BclA, or any of the corresponding amino acids above, can be used as a targeting sequence.

[0082] Thus, the targeting sequence may comprise amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: 60, amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the targeting sequence consists of amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60. Alternatively, the targeting sequence may consist of amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the exosporium protein may comprise full-length BclA (SEQ ID NO: 2), or the exosporium protein fragment may comprise a medium fragment of BclA lacking the carboxyl terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA). Alternatively, the exosporium protein fragment may consist of SEQ ID NO:59.

[0083] The targeting sequence may also comprise amino acids 1-27 of SEQ ID NO:3, amino acids 12-27 of SEQ ID NO:3, or SEQ ID NO:3, or the exosporium protein may comprise the full length

[0084] BetA / BAS3290 (SEQ ID NO:4). It has also been discovered that a methionine residue attached to amino acids 12-27 of BetA / BAS3290 can be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO:61. The targeting sequence may also comprise amino acids 14-23 of SEQ ID NO:3, amino acids 14-25 of SEQ ID NO:3, or amino acids 12-23 of SEQ ID NO:3.

[0085] The targeting sequence may also comprise amino acids 1-38 of SEQ ID NO:5, amino acids 23-38 of SEQ ID NO:5, or SEQ ID NO:5, or the exosporium protein may comprise full-length BAS4623 (SEQ ID NO:6).

[0086] Alternatively, the targeting sequence can comprise amino acids 1-28 of SEQ ID NO:7, amino acids 13-28 of SEQ ID NO:7, or SEQ ID NO:7, or the exosporium protein can comprise full-length BclB (SEQ ID NO:8).

[0087] The targeting sequence may also comprise amino acids 1-24 of SEQ ID NO:9, amino acids 9-24 of SEQ ID NO:9, or SEQ ID NO:9, or the exosporium protein may comprise full-length BAS1882 (SEQ ID NO:10). A methionine residue linked to amino acids 9-24 of BAS1882 may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO:69.

[0088] The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 11, amino acids 18-33 of SEQ ID NO: 11, or SEQ ID NO: 11, or the exosporium protein may comprise the full-length Bacillus weihenstephensis KBAB4 2280 gene product (SEQ ID NO: 12). A methionine residue linked to amino acids 18-33 of the Bacillus weihenstephensis KBAB4 2280 gene product may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO: 62.

[0089] The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 13, amino acids 18-33 of SEQ ID NO: 13, or SEQ ID NO: 13, or the exosporium protein may comprise the full-length Bacillus weihenstephensis KBAB4 3572 gene product (SEQ ID NO: 14). A methionine residue linked to amino acids 18-33 of the Bacillus weihenstephensis KBAB4 3572 gene product may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO: 63.

[0090] Alternatively, the targeting sequence can comprise amino acids 1-43 of SEQ ID NO: 15, amino acids 28-43 of SEQ ID NO: 15, or SEQ ID NO: 15, or the exosporium protein can comprise the full-length Bacillus cereus VD200 exosporium leader peptide (SEQ ID NO: 16).

[0091] The targeting sequence may also comprise amino acids 1-27 of SEQ ID NO: 17, amino acids 12-27 of SEQ ID NO: 17, or SEQ ID NO: 17, or the exosporium protein may comprise the full-length Bacillus cereus VD166 exosporium leader peptide (SEQ ID NO: 18). The methionine residue linked to amino acids 12-27 of the exosporium leader peptide of Bacillus cereus VD166 may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO: 64.

[0092] The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 19, amino acids 18-33 of SEQ ID NO: 19, or SEQ ID NO: 19, or the exosporium protein may comprise full-length Bacillus cereus VD200 hypothetical protein IKG_04663 (SEQ ID NO: 20).

[0093] Alternatively, the targeting sequence comprises amino acids 1-33 of SEQ ID NO:21, amino acids 18-33 of SEQ ID NO:21, or SEQ ID NO:21, or the exosporium protein may comprise the full-length Bacillus weihenstephensis KBAB4 YVTN β-propeller protein (SEQ ID NO:22). A methionine residue linked to amino acids 18-33 of the Bacillus weihenstephensis KBAB4 YVTN β-propeller protein may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO:65.

[0094] The targeting sequence may also comprise amino acids 1-24 of SEQ ID NO: 23, amino acids 9-24 of SEQ ID NO: 23, or SEQ ID NO: 23, or the exosporium protein may comprise the full-length Bacillus weihensteinii KBAB4 hypothetical protein bcerkbab4_2363 (SEQ ID NO: 24). A methionine residue linked to amino acids 9-24 of the Bacillus weihensteinii KBAB4 hypothetical protein bcerkbab4-2363 may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO: 66.

[0095] The targeting sequence comprises amino acids 1-24 of SEQ ID NO: 25, amino acids 9-24 of SEQ ID NO: 25, or SEQ ID NO: 25, or the exosporium protein may comprise the full-length Bacillus weihensteinii KBAB4 hypothetical protein bcerkbab4_2131 (SEQ ID NO: 26). A methionine residue linked to amino acids 9-24 of the Bacillus weihensteinii KBAB4 hypothetical protein bcerkbab4_2131 may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO: 67.

[0096] Alternatively, the targeting sequence comprises amino acids 1-30 of SEQ ID NO:27, amino acids 15-30 of SEQ ID NO:27, or SEQ ID NO:27, or the exosporium protein may comprise full-length Bacillus weihenstephensis KBAB4 triple-helix repeat-containing collagen (SEQ ID NO:28).

[0097] The targeting sequence can also comprise amino acids 1-33 of SEQ ID NO:29, amino acids 18-33 of SEQ ID NO:29, or SEQ ID NO:29, or the exosporium protein can comprise full-length Bacillus mycoides 2048 hypothetical protein bmyco0001_21660 (SEQ ID NO:30).

[0098] The targeting sequence may also comprise amino acids 1-24 of SEQ ID NO:31, amino acids 9-24 of SEQ ID NO:31, or SEQ ID NO:31, or the exosporium protein may comprise the full-length Bacillus mycoides 2048 hypothetical protein bmyc0001_22540 (SEQ ID NO:32). A methionine residue linked to amino acids 9-24 of the Bacillus mycoides 2048 hypothetical protein bmyc0001_22540 may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO:68.

[0099] Alternatively, the targeting sequence comprises amino acids 1-15 of SEQ ID NO:33, SEQ ID NO:33, or the exosporium protein comprises the full-length Bacillus mycoides 2048 hypothetical protein

[0100] bmyc0001_21510 (SEQ ID NO:34).

[0101] The targeting sequence may also comprise amino acids 1-16 of SEQ ID NO:35, SEQ ID NO:35, or the exosporium protein may comprise full-length Bacillus thuringiensis 35646 collagen triple helical repeat protein (SEQ ID NO:36).

[0102] The targeting sequence can comprise amino acids 1-29 of SEQ ID NO: 43, amino acids 14-29 of SEQ ID NO: 43, or SEQ ID NO: 43, or the exosporium protein can comprise full-length Bacillus cereus hypothetical protein WP_69652 (SEQ ID NO: 44).

[0103] Alternatively, the targeting sequence may comprise amino acids 1-35 of SEQ ID NO: 45, amino acids 20-35 of SEQ ID NO: 45, or SEQ ID NO: 45, or the exosporium protein may comprise the full-length Bacillus cereus exosporium leader WP016117717 (SEQ ID NO: 46). A methionine residue linked to amino acids 20-35 of the Bacillus cereus exosporium leader WP016117717 may also be used as a targeting sequence. Thus, the targeting sequence may comprise SEQ ID NO: 70.

[0104] The targeting sequence can comprise amino acids 1-43 of SEQ ID NO: 47, amino acids 28-43 of SEQ ID NO: 47, or SEQ ID NO: 47, or the exosporium protein can comprise full-length Bacillus cereus exosporium peptide WP002105192 (SEQ ID NO: 48).

[0105] The targeting sequence can comprise amino acids 1-32 of SEQ ID NO: 49, amino acids 17-32 of SEQ ID NO: 49, or SEQ ID NO: 49, or the exosporium protein can comprise full-length Bacillus cereus hypothetical protein WP87353 (SEQ ID NO: 50).

[0106] Alternatively, the targeting sequence can comprise amino acids 1-33 of SEQ ID NO:51, amino acids 18-33 of SEQ ID NO:51, or SEQ ID NO:51, or the exosporium protein can comprise full-length Bacillus cereus exosporium peptide 02112369 (SEQ ID NO:52).

[0107] The targeting sequence can comprise amino acids 1-33 of SEQ ID NO:53, amino acids 18-33 of SEQ ID NO:53, or SEQ ID NO:53, or the exosporium protein can comprise full-length Bacillus cereus exosporium protein WP016099770 (SEQ ID NO:54).

[0108] Alternatively, the targeting sequence can comprise amino acids 1-30 of SEQ ID NO:55, amino acids 15-30 of SEQ ID NO:55, or SEQ ID NO:55, or the exosporium protein can comprise full-length Bacillus thuringiensis hypothetical protein YP006612525 (SEQ ID NO:56).

[0109] The targeting sequence can also comprise amino acids 1-130 of SEQ ID NO:57, amino acids 115-130 of SEQ ID NO:57, or SEQ ID NO:57, or the exosporium protein can comprise full-length Bacillus mycoides hypothetical protein TIGR03720 (SEQ ID NO:58).

[0110] In addition, from Figure 1 It can be readily seen from the sequence alignment in that although amino acids 20-35 of BclA are conserved, and amino acids 25-35 are even more conserved, a certain degree of variation can occur in this region without affecting the ability of the targeting sequence to target the protein to the exospore wall. Figure 1The percent identity of each corresponding amino acid of each sequence to amino acids 20-35 of BclA ("20-35% identity") and the percent identity of amino acids 25-35 of BclA ("25-35% identity"). Thus, for example, compared to amino acids 20-35 of BclA, the corresponding amino acids of BetA / BAS3290 are about 81.3% identical, the corresponding amino acids of BAS4623 are about 50.0% identical, the corresponding amino acids of BclB are about 43.8% identical, the corresponding amino acids of BAS1882 are about 62.5% identical, the corresponding amino acids of the KBAB4 2280 gene product are about 81.3% identical, and the corresponding amino acids of the KBAB4 3572 gene product are about 81.3% identical. The sequence identities of the remaining sequences over this region are listed at Figure 1 middle.

[0111] With respect to amino acids 25-35 of BclA, the corresponding amino acids of BetA / BAS3290 are about 90.9% identical, the corresponding amino acids of BAS4623 are about 72.7% identical, the corresponding amino acids of BclB are about 54.5% identical, the corresponding amino acids of BAS1882 are about 72.7% identical, the corresponding amino acids of the KBAB4 2280 gene product are about 90.9% identical, and the corresponding amino acids of the KBAB4 3572 gene product are about 81.8% identical. The sequence identities of the remaining sequences in this region are listed in Figure 1 middle.

[0112] Thus, the targeting sequence may comprise an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%.

[0113] The targeting sequence may also comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0114] The targeting sequence may also comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[0115] The targeting sequence may also comprise an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0116] Alternatively, the targeting sequence may comprise an amino acid sequence having at least about 62% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 72%. The targeting sequence may also consist of an amino acid sequence (consisting of 16 amino acids) having at least about 62% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0117] The targeting sequence may comprise an amino acid sequence having at least 68% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least 68% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 81%.

[0118] The targeting sequence may also comprise an amino acid sequence having at least about 75% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 75% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0119] The targeting sequence may also comprise an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 81%.

[0120] The targeting sequence may also comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0121] The targeting sequence may comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%. Alternatively, the targeting sequence consists of an amino acid sequence (consisting of 16 amino acids) having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[0122] The skilled artisan will recognize that variants of the above sequences can also be used as targeting sequences, so long as the targeting sequence comprises amino acids 20-35 of BclA, the corresponding amino acids of BetA / BAS3290, BAS4263, BclB, BAS1882, KBAB4 2280 gene product, or KBAB3572 gene product, or there is a sequence comprising any of the above sequence identities to amino acids 20-35 and 25-35 of BclA.

[0123] It has further been discovered that certain Bacillus cereus family exosporium proteins lacking the region having homology to amino acids 25-35 of BclA can also be used to target peptides or proteins to the exosporium of Bacillus cereus family members. In particular, the fusion protein may include the following exosporium proteins: an exosporium protein comprising SEQ ID NO:71 (Bacillus mycoides InhA), an exosporium protein comprising SEQ ID NO:72 (Bacillus anthracis Stern BAS1141 (ExsY)), an exosporium protein comprising SEQ ID NO:73 (Bacillus anthracis Stern BAS1144 (BxpB / ExsFA)), an exosporium protein comprising SEQ ID NO:74 (Bacillus anthracis Stern BAS1145 (CotY)), an exosporium protein comprising SEQ ID NO:75 (Bacillus anthracis Stern BAS1140 (), an exosporium protein comprising SEQ ID NO:76 (Bacillus anthracis H9401 ExsFB), an exosporium protein comprising SEQ ID NO:77 (Bacillus thuringiensis HD74 InhA1), an exosporium protein comprising SEQ ID NO:78 (Bacillus cereus ATCC 10876ExsJ), a spore wall protein comprising SEQ ID NO:79 (Bacillus cereus ExsH), a spore wall protein comprising SEQ ID NO:80 (Bacillus anthracis Ames YjcA), a spore wall protein comprising SEQ ID NO:81 (Bacillus anthracis YjcB), a spore wall protein comprising SEQ ID NO:82 (Bacillus anthracis Stern BclC), a spore wall protein comprising SEQ ID NO:83 (Bacillus thuringiensis serovar konkukian strain 97-27 acid phosphatase), or a spore wall protein comprising SEQ ID NO:84 (Bacillus thuringiensis HD74 InhA2). Including an exosporium protein comprising SEQ ID NO: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 or 84 in a fusion protein described herein will result in targeting to the exosporium of members of the Bacillus cereus family.

[0124] In addition, exosporium proteins having a high degree of sequence identity to any of the above-mentioned full-length exosporium proteins or exosporium protein fragments can also be used to target peptides or proteins to the exosporium of members of the Bacillus cereus family. Thus, the fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 85% identity to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84. Alternatively, the fusion protein can comprise an exosporium protein that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84.

[0125] Alternatively, the fusion protein may comprise an exosporium protein fragment consisting of an amino acid sequence having at least 85% identity to SEQ ID NO: 59. Alternatively, the fusion protein may comprise an exosporium protein fragment consisting of an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99% or 100% identity to SEQ ID NO: 59.

[0126] In any of the targeting sequences, exosporium proteins, or exosporium protein fragments described herein, the targeting sequence, exosporium protein, or exosporium protein fragment may comprise at its carboxyl terminus the amino acid sequence GXT, wherein X is any amino acid.

[0127] In any of the targeting sequences, exosporium proteins, and exosporium protein fragments described herein, the targeting sequence, exosporium protein, or exosporium protein fragment may comprise an alanine residue at the position of the targeting sequence corresponding to amino acid 20 of SEQ ID NO: 1.

[0128] Fusion Protein

[0129] The fusion protein may comprise a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one plant growth stimulating protein or peptide. The plant growth stimulating protein or peptide may comprise a peptide hormone, a non-hormone peptide, an enzyme involved in the production or activation of a plant growth stimulating compound, or an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source. The targeting sequence, exosporium protein or exosporium protein fragment may be any of the above-mentioned targeting sequences, exosporium proteins or exosporium protein fragments.

[0130] The fusion protein may comprise a targeting sequence, an exosporium protein or an exosporium protein fragment, and at least one protein or peptide that protects plants from pathogens. The targeting sequence, the exosporium protein or the exosporium protein fragment may be any of the above-mentioned targeting sequences, exosporium proteins or exosporium protein fragments.

[0131] Fusion proteins can be prepared using standard cloning and molecular biological methods known in the art. For example, a gene encoding a protein or peptide (e.g., a gene encoding a plant growth stimulating protein or peptide) can be amplified by polymerase chain reaction (PCR) and connected to a DNA encoding any of the above-mentioned targeting sequences to form a DNA molecule encoding a fusion protein. The DNA molecule encoding the fusion protein can be cloned into any suitable vector, such as a plasmid vector. The vector suitably comprises a multiple cloning site into which the DNA molecule encoding the fusion protein can be easily inserted. The vector also suitably contains a selective marker, such as an antibiotic resistance gene, so that bacteria transformed, transfected or mated with the vector can be easily identified and separated. When the vector is a plasmid, the plasmid also suitably comprises an origin of replication. The DNA encoding the fusion protein is suitably under the control of a spore-forming promoter, which will cause the fusion protein to be expressed on the exospore wall of the endospore of the Bacillus cereus family member (e.g., a natural bclA promoter from a Bacillus cereus family member). Alternatively, the DNA encoding the fusion protein may be integrated into the chromosomal DNA of the Bacillus cereus family member host.

[0132] The fusion protein may also comprise additional polypeptide sequences that are not part of the targeting sequence, the exosporium protein, the exosporium protein fragment, or the plant growth stimulating protein or peptide, the protein or peptide that protects plants against pathogens, the protein or peptide that enhances plant stress resistance, or the plant binding protein or peptide. For example, the fusion protein may include a tag or marker to facilitate purification or visualization of the fusion protein (e.g., a polyhistidine tag or a fluorescent protein such as GFP or YFP), or visualization of spores of recombinant exosporium-producing Bacillus cells expressing the fusion protein.

[0133] The use of the targeting sequences, exosporium proteins and exosporium protein fragments described herein enhances the expression of fusion proteins on the exosporium due to the lack of secondary structure in the amino termini of these sequences, which allows for native folding and retention of activity of the fusion protein. Correct folding can be further enhanced by including a short amino acid linker between the targeting sequence, exosporium protein, exosporium protein fragment and fusion partner protein.

[0134] Thus, any fusion protein described herein may comprise an amino acid linker between the targeting sequence, the exosporium protein or exosporium protein fragment and the plant growth stimulating protein or peptide, the protein or peptide that protects plants against pathogens, the protein or peptide that enhances plant stress resistance, or the plant binding protein or peptide.

[0135] The linker may include a polyalanine linker or a polyglycine linker. A linker comprising a mixture of alanine residues and glycine residues may also be used. For example, when the targeting sequence comprises SEQ ID NO: 1, the fusion protein may have one of the following structures:

[0136] No linker: SEQ ID NO: 1 - fusion partner protein

[0137] Alanine linker: SEQ ID NO: 1-An-fusion partner protein

[0138] Glycine linker: SEQ ID NO: 1-Gn-fusion partner protein

[0139] Mixed alanine and glycine linker: SEQ ID NO: 1 - (A / G)n - Fusion partner protein

[0140] Wherein An, Gn and (A / G)n are any number of alanine, any number of glycine or any number of mixtures of alanine and glycine, respectively. For example, n can be from 1 to 25, and preferably from 6 to 10. When the linker comprises a mixture of alanine residues and glycine residues, any combination of glycine residues and alanine residues can be used. In the above structure, "fusion partner protein" represents a plant growth stimulating protein or peptide, a protein or peptide that protects plants from pathogens, a protein or peptide that enhances plant stress resistance, or a plant binding protein or peptide.

[0141] Alternatively or additionally, the linker may comprise a protease recognition site. The inclusion of a protease recognition site allows for the targeted removal of a plant growth stimulating protein or peptide, a protein or peptide that protects plants from pathogens, a protein or peptide that enhances plant stress resistance, or a plant binding protein or peptide when exposed to a protease that recognizes the protease recognition site.

[0142] Plant Growth Stimulating Proteins and Peptides

[0143] As described above, the fusion protein may comprise a targeting sequence, an exosporium protein or exosporium protein fragment and at least one plant growth stimulating protein or peptide. For example, the plant growth stimulating protein or peptide may comprise a peptide hormone, a non-hormone peptide, an enzyme involved in the production or activation of a plant growth stimulating compound, or an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source.

[0144] For example, when the plant growth stimulating protein or peptide comprises a peptide hormone, the peptide hormone may comprise phytosulfokine (eg, phytosulfokine-α), clavata 3 (CLV3), systemin, ZmlGF, or SCR / SP11.

[0145] When the plant growth stimulating protein or peptide comprises a non-hormone peptide, the non-hormone peptide may comprise RKN 16D10, Hg-Syv46, eNOD40 peptide, melittin, mastoparan, Mas7, RHPP, POLARIS or kunitz trypsin inhibitor (KTI).

[0146] The plant growth stimulating protein or peptide may comprise an enzyme involved in the production or activation of a plant growth stimulating compound. The enzyme involved in the production or activation of a plant growth stimulating compound may be any enzyme that catalyzes any step in the biosynthetic pathway of a compound that stimulates plant growth or changes plant structure, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or changes plant structure into an active or more active form of the compound.

[0147] Plant growth stimulating compounds may include compounds produced by bacteria or fungi in the rhizosphere, such as 2,3-butanediol.

[0148] Alternatively, the plant growth stimulating compound may comprise a plant growth hormone, such as cytokinin or cytokinin derivatives, ethylene, auxin or auxin derivatives, gibberellic acid or gibberellic acid derivatives, abscisic acid or abscisic acid derivatives, or jasmonic acid or a jasmonic acid derivative.

[0149] When the plant growth stimulating compound comprises a cytokinin or a cytokinin derivative, the cytokinin or cytokinin derivative may comprise kinetin, cis-zeatin, trans-zeatin, 6-benzylaminopurine, dihydroxyzeatin, N6-(D2-isopentenyl)adenine, ribosylzeatin, N6-(D2-isopentenyl)adenosine, 2-methylthio-cis-ribosylzeatin, cis-ribosylzeatin, trans-ribosylzeatin, 2-methylthio-trans-ribosylzeatin, ribosylzeatin-5-monophosphate, N6-methylaminopurine, N6-dimethylaminopurine, 2'-deoxyzeatin riboside, 4-hydroxy-3-methyl-trans-2-butenylaminopurine, o-topolin, m-topolin, benzyl adenine, o-methyltopolin, m-methyltopolin, or a combination thereof.

[0150] When the plant growth stimulating compound comprises an auxin or an auxin derivative, the auxin or auxin derivative may comprise an active auxin, an inactive auxin, a conjugated auxin, a naturally occurring auxin, or a synthetic auxin, or a combination thereof. For example, the auxin or auxin derivative may comprise indole-3-acetic acid, indole-3-pyruvic acid, indole-3-acetaldehyde oxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole-3-pyruvate, indole-3-acetaldehyde oxime, indole-3-butyric acid, phenylacetic acid, 4-chloroindole-3-acetic acid, a glucose-conjugated auxin, or a combination thereof.

[0151] The enzymes involved in the production or activation of plant growth stimulating compounds may include 3-hydroxybutanone reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase (e.g., tryptophan aminotransferase), tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side chain oxidase, nitrile hydrolase, nitrilase, peptidase, protease, adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5' ribonucleotide phosphohydrolase, Adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyltransferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitosinase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylic acid deaminase, and enzymes involved in the production of nodulation factors (e.g., nodA, nodB or nodI).

[0152] When the enzyme comprises a protease or a peptidase, the protease or peptidase may be a protease or peptidase that cleaves a protein, peptide, preprotein or preproprotein to produce a biologically active peptide. The biologically active peptide may be any peptide that exerts a biological activity.

[0153] Examples of bioactive peptides include RKN 16D10 and RHPP.

[0154] The protease or peptidase that cleaves a protein, peptide, preprotein or preproprotein to produce a biologically active peptide may include a subtilisin, an acid protease, an alkaline protease, a proteolytic enzyme, an endopeptidase, an exopeptidase, a thermolysin, a papain, a pepsin, a trypsin, a pronase, a carboxylase, a serine protease, a glutamic acid protease, an aspartic acid protease, a cysteine ​​protease, a threonine protease or a metalloprotease.

[0155] Proteases or peptidases can cleave proteins in protein-rich diets (eg, soy flour or yeast extract).

[0156] Plant growth stimulating proteins can also comprise enzymes that degrade or modify bacteria, fungi or plant nutrition sources. These enzymes include cellulase, lipase, lignin oxidase, protease, glycoside hydrolase, phosphatase, nitrogenase, nuclease, amidase, nitrate reductase, nitrite reductase, amylase, ammonia oxidase, ligninase, glucosidase, phospholipase, phytase, pectinase, glucanase, sulfatase, urease, xylanase and siderophore. When introduced into plant growth medium or applied to the zone around plant, seed or plant or plant seed, the fusion protein that comprises enzymes that degrade or modify bacteria, fungi or plant nutrition sources can help to process the nutrients near the plant and cause the nutrients absorption of the beneficial bacteria or fungi near the plant to increase.

[0157] Suitable cellulases include endocellulases (e.g., endoglucanases, such as Bacillus subtilis endoglucanase, Bacillus thuringiensis endoglucanase, Bacillus cereus endoglucanase, or Bacillus clausii endoglucanase), exocellulases (e.g., Trichoderma reesei exocellulase), and β-glucosidases (e.g., Bacillus subtilis β-glucosidase, Bacillus thuringiensis β-glucosidase, Bacillus cereus β-glucosidase, or Bacillus clausii β-glucosidase).

[0158] The lipase may include Bacillus subtilis lipase, Bacillus thuringiensis lipase, Bacillus cereus lipase, or Bacillus clausii lipase.

[0159] In one embodiment, the lipase comprises a Bacillus subtilis lipase. The Bacillus subtilis lipase can be PCR amplified using the following primers: ggatccatggctgaacacaatcc (forward, SEQ ID NO: 37) and ggatccttaattcgtattctggcc (reverse, SEQ ID NO: 38).

[0160] In another embodiment, the cellulase is a Bacillus subtilis endoglucanase.The Bacillus subtilis endoglucanase can be PCR amplified using the following primers: ggatccatgaaacggtcaatc (forward, SEQ ID NO: 39) and ggatccttactaatttggttctgt (reverse, SEQ ID NO: 40).

[0161] In another embodiment, the fusion protein comprises the E. coli protease PtrB. The E. coli protease PtrB can be PCR amplified using the following primers: ggatccatgctaccaaaagcc (forward, SEQ ID NO: 41) and

[0162] ggatccttagtccgcaggcgtagc (reverse, SEQ ID NO: 42).

[0163] In certain embodiments, the fusion protein contains an endoglucanase derived from the nucleotide sequence in SEQ ID NO:104.

[0164] An exemplary endoglucanase amino acid sequence that can be fused to a targeting sequence, an exosporium protein or an exosporium protein fragment, and an optional linker sequence (eg, a polyadenylic acid linker) is a fusion protein provided as SEQ ID NO: 107.

[0165] In other embodiments, the fusion protein contains a phospholipase derived from the nucleotide sequence shown in SEQ ID NO:105.

[0166] An exemplary amino acid sequence of a phospholipase that can be fused to a targeting sequence, an exosporium protein or an exosporium protein fragment, and an optional linker sequence (e.g., a polyadenylic acid linker) is a fusion protein provided as SEQ ID NO: 108.

[0167] In other embodiments, the fusion protein contains a chitosanase derived from the nucleotide sequence set forth in SEQ ID NO: 106. An exemplary amino acid sequence of a chitosanase that can be fused to a targeting sequence, an exosporium protein or exosporium protein fragment, and an optional linker sequence (e.g., a polyadenylic acid linker) in a fusion protein is provided as SEQ ID NO: 109.

[0168] To produce a fusion construct, the gene can be fused to the natural bclA promoter of the Bacillus thuringiensis DNA encoding the first 35 amino acids of BclA (amino acids 1-35 of SEQ ID NO: 1) using splicing by overlap extension (SOE) technology. The correct amplicon is cloned into the E. coli / Bacillus shuttle vector pHP13, and the correct clone is screened by DNA sequencing. The correct clone is electroporated into Bacillus thuringiensis (Cry-, plasmid-) and screened for chloramphenicol resistance. The correct transformant is grown overnight in brain heart infusion broth at 30°C, plated on nutrient agar plates, and incubated at 30°C for 3 days. Spores expressing the fusion construct (BEMD spores) can be collected from the plate by washing in phosphate buffered saline (PBS), and purified by centrifugation and additional washing in PBS.

[0169] In these fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise a nucleotide sequence encoding an amino acid sequence having at least 85% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0170] In these fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 90% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0171] In these fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 95% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0172] In these fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 98% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0173] In these fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence that is at least 99% identical to SEQ ID NO: 107, 108 or 109, respectively.

[0174] Suitable lignin oxidases include lignin peroxidase, laccase, glyoxal oxidase, ligninase and manganese peroxidase.

[0175] The protease may include a subtilisin, an acid protease, an alkaline protease, a proteinase, a peptidase, an endopeptidase, an exopeptidase, a thermolysin, a papain, a pepsin, a trypsin, a pronase, a carboxylase, a serine protease, a glutamic acid protease, an aspartic acid protease, a cysteine ​​protease, a threonine protease, or a metalloprotease.

[0176] The phosphatase can include a phosphomonoester hydrolase, a phosphomonoesterase (e.g., PhoA4), a phosphodiester hydrolase, a phosphodiesterase, a triphosphate monoester hydrolase, a phosphoanhydrase, a pyrophosphatase, a phytase (e.g., Bacillus subtilis EE148 phytase or Bacillus thuringiensis BT013A phytase), a trimetaphosphatase, or a triphosphatase.

[0177] The nitrogenase may comprise a Nif family nitrogenase, such as Paenibacillus massiliensis NifBDEHKNXV.

[0178] Proteins and peptides that protect plants against pathogens

[0179] The fusion protein may comprise a targeting sequence, an exosporium protein or an exosporium protein fragment, and at least one protein or peptide that protects a plant against pathogens.

[0180] The protein or peptide may comprise a protein or peptide that stimulates a plant immune response. For example, a protein or peptide that stimulates a plant immune response may comprise a plant immune system enhancer protein or peptide. A plant immune system enhancer protein or peptide may be any protein or peptide that has a beneficial effect on the immune system of a plant. Suitable plant immune system enhancer proteins and peptides include harpin, α-elastin, β-elastin, systemin, phenylalanine ammonia lyase, inducin, defensin, cryptogein, flagellin, and flagellin peptides (e.g., flg22).

[0181] Alternatively, the protein or peptide that protects plants from pathogens may be a protein or peptide having antibacterial activity, antifungal activity, or both. Examples of such proteins and peptides include bacteriocins, lysozymes, lysozyme peptides (e.g., LysM), siderophores, non-ribosomal active peptides, conalbumin, albumin, lactoferrin, lactoferrin peptides (e.g., LfcinB), streptavidin, and TasA.

[0182] The protein or peptide that protects plants from pathogens can also be a protein or peptide that has insecticidal activity, helminthicidal activity, inhibition of insect or worm predation, or a combination thereof. For example, the protein or peptide that protects plants from pathogens can include insecticidal bacterial toxins (e.g., VIP insecticidal proteins), endotoxins, Cry toxins (e.g., Cry toxins from Bacillus thuringiensis), protease inhibitor proteins or peptides (e.g., trypsin inhibitors or arrowhead proteinase inhibitors), cysteine ​​proteases, or chitinases. When the Cry toxin is a Cry toxin from Bacillus thuringiensis, the Cry toxin can be a Cry5B protein or a Cry21A protein. Cry5B and Cry21A have both insecticidal and nematicidal activities.

[0183] The protein that protects plants from pathogens may include enzymes. Suitable enzymes include proteases and lactonases. Proteases and lactonases may be specific for bacterial signal transduction molecules (e.g., bacterial lactone homoserine signal transduction molecules).

[0184] When the enzyme is a lactonase, the lactonase may include 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol-lactonase, actinomycin lactonase, deoxycitrate A-ring-lactonase, gluconolactonase, L-rhamnose (rhamnono)-1,4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase or xylonate-1,4-lactonase.

[0185] The enzyme can also be an enzyme specific for a cellular component of a bacterium or fungus. For example, the enzyme can include β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, chitosinase, chitinase, chitosinase-like enzyme, lytic enzyme, peptidase, proteolytic enzyme, protease (e.g., alkaline protease, acid protease or neutral protease), mutanolysin, stapholysin or lysozyme.

[0186] Proteins and peptides that enhance plant stress resistance

[0187] The fusion protein may comprise a targeting sequence, an exosporium protein or an exosporium protein fragment and at least one protein or peptide that enhances plant stress resistance.

[0188] For example, the protein or peptide that enhances plant stress resistance includes an enzyme that degrades stress-related compounds. Stress-related compounds include but are not limited to aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, nitric oxide, oxylipins, and phenols. Concrete reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen, and superoxide. The enzyme that degrades stress-related compounds may include superoxide dismutase, oxidase, catalase, aminocyclopropane-1-carboxylic acid deaminase, peroxidase, antioxidant enzyme, or antioxidant peptide.

[0189] Protein or peptide that strengthen plant stress resistance also can comprise the protein or peptide that protection plant resists environmental stress.Environmental stress can comprise for example drought, flood, heat, freezing, salt, heavy metal, low pH, high pH or their combination.For example, the protein or peptide that protection plant resists environmental stress can comprise ice nucleation protein, proline peptidase, phenylalanine ammonia lyase, isochorismate synthase, isochorismate pyruvate lyase or choline dehydrogenase.

[0190] Plant Binding Proteins and Peptides

[0191] The fusion protein may comprise a targeting sequence, an exosporium protein or exosporium protein fragment and at least a plant binding protein or peptide. The plant binding protein or peptide may be any protein or peptide that is capable of binding specifically or non-specifically to any part of a plant (e.g., a plant root or an aerial part of a plant, such as a leaf, stem, flower or fruit) or to plant matter. Thus, for example, the plant binding protein or peptide may be a root binding protein or peptide, or a leaf binding protein or peptide.

[0192] Suitable plant binding proteins and peptides include adhesins (e.g., rhicadhesin), flagellins, omptins, lectins, expansins, biofilm structural proteins (e.g., TasA or YuaB), fimbriae, curlus proteins, intimins, invasins, lectins, and non-afimbrial proteins.

[0193] Recombinant Bacillus expressing fusion proteins

[0194] The fusion proteins described herein can be expressed by recombinant exine-producing Bacillus cells. The fusion protein can be any of the fusion proteins described above.

[0195] The recombinant exine-producing Bacillus cell can co-express two or more of any of the above fusion proteins. For example, the recombinant exine-producing Bacillus cell can co-express at least one fusion protein comprising a plant binding protein or peptide, and at least one fusion protein comprising a plant growth stimulating protein or peptide, at least one fusion protein comprising a protein or peptide that protects plants from pathogens, or at least one protein or peptide that enhances plant stress resistance.

[0196] The recombinant Bacillus cell that produces a spore exine may include Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyosporum, or a combination thereof. For example, the recombinant Bacillus cell that produces a spore exine may include Bacillus cereus, Bacillus thuringiensis, Bacillus pseudomycoides, or Bacillus mycoides. In particular, the recombinant Bacillus cell that produces a spore exine may include Bacillus thuringiensis or Bacillus mycoides.

[0197] In order to produce the recombinant sporulation exine of expressing fusion protein, any Bacillus cereus family member can be conjugated, transduced or transformed with a vector encoding the fusion protein using standard methods known in the art (e.g., by electroporation). The bacteria can then be screened by any method known in the art to identify transformants. For example, when the vector includes an antibiotic resistance gene, the antibiotic resistance of the bacteria can be screened. Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of the host of the Bacillus cereus family member. The Bacillus cell of the recombinant sporulation exine can then be exposed to conditions that will induce spore formation. Suitable conditions for inducing spore formation are known in the art. For example, the Bacillus cell of the recombinant sporulation exine can be spread on an agar plate and incubated for several days (e.g., 3 days) at a temperature of about 30°C.

[0198] Inactivated strains, avirulent strains or genetically manipulated strains of any of the above species may also be used appropriately. For example, Bacillus thuringiensis lacking Cry toxins may be used. Alternatively or additionally, once recombinant Bacillus cereus family spores expressing fusion proteins are produced, they may be inactivated to prevent further germination once used. Any method of inactivating bacterial spores known in the art may be used. Suitable methods include, but are not limited to, heat treatment, gamma radiation, x-ray radiation, UV-A radiation, UV-B radiation, chemical treatment (e.g., treatment with glutaraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach or any combination thereof), or a combination thereof. Alternatively, spores derived from non-toxigenic strains or genetically or physically inactivated strains may be used.

[0199] Recombinant exosporating Bacillus cells having plant growth promoting effects and / or other beneficial attributes

[0200] Many Bacillus cereus family member strains have inherent beneficial properties. For example, some strains have plant growth promoting effects. Any fusion protein described herein can be expressed in such strains.

[0201] For example, the recombinant exosporium-producing Bacillus cell can comprise a plant growth promoting strain of bacteria.

[0202] Plant growth promoting strains of bacteria may include bacterial strains that produce insecticidal toxins (e.g., Cry toxins), produce fungicidal compounds (e.g., β-1,3-glucanase, chitosinase, lytic enzymes, or combinations thereof), produce nematicidal compounds (e.g., Cry toxins), produce bactericidal compounds, are resistant to one or more antibiotics, contain one or more freely replicating plasmids, bind to plant roots, aggregate at plant roots, form biofilms, solubilize nutrients, secrete organic acids, or any combination thereof.

[0203] For example, when the recombinant spore-producing exine Bacillus cell comprises a plant growth promoting strain of bacteria, the plant growth promoting strain of bacteria may comprise Bacillus mycoides BT155 (NRRL No. B-50921), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus mycoides EE141 (NRRL No. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), Bacillus cereus family member EE128 (NRRL No. B-50917), Bacillus thuringiensis BT013A (NRRL No. B-50924), or Bacillus cereus family member EE349 (NRRL No. B-50928). Bacillus thuringiensis BT013A is also known as Bacillus thuringiensis 4Q7. Each of these strains was deposited with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS), 1815 North University Street, Peoria, IL 61604, USA on March 10, 2014, and is identified by the NRRL deposit number provided in parentheses.

[0204] These plant growth promoting strains were isolated from the rhizosphere of different vigorous plants and identified by their 16S rRNA sequences as well as by biochemical assays. The strains were identified at least to their genus name by conventional biochemical and morphological indices. The biochemical assays for confirmed Gram-positive strains (e.g., Bacillus) included growth on PEA medium and nutrient agar, microscopy, growth on 5% and 7.5% NaCl medium, growth at pH 5 and pH 9, growth at 42°C and 50°C, the ability to produce acid when fermented with cellobiose, lactose, glycerol, glucose, sucrose, d-mannitol and starch; fluorescent pigment production; gelatin hydrolysis; nitrate reduction; catalase production, starch hydrolysis; oxidase reaction, urease production and mobility.

[0205] For example, a recombinant sporulating exine Bacillus cell comprising a plant growth promoting strain of bacteria can include Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A. The recombinant sporulating exine Bacillus cell can express any fusion protein described herein, such as a fusion protein comprising a targeting sequence of SEQ ID NO: 60 and a non-hormone peptide (e.g., kunitz trypsin inhibitor (KTI)), an enzyme involved in the production and activation of plant growth stimulating compounds (e.g., chitosinase), a plant binding protein or peptide (e.g., TasA); a protein or peptide that protects plants against pathogens (e.g., TasA), or an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source (e.g., a phosphatase (e.g., PhoA or phytase) or an endoglucanase).

[0206] Promoter

[0207] In any of the recombinant exosporium-producing Bacillus cells described herein, the fusion protein can be expressed under the control of the native promoter of the exosporium protein or exosporium protein fragment, the targeting sequence of the fusion protein. For example, when the fusion protein comprises a promoter derived from Bacillus anthracis Stern

[0208] When the fusion protein comprises a targeting sequence for BclA (e.g., amino acids 20-35 of SEQ ID NO: 1, amino acids 1-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60), or when the fusion protein comprises full-length BclA (SEQ ID NO: 2) or a fragment of full-length BclA (e.g., SEQ ID NO: 59), the fusion protein can be expressed under the control of a promoter normally associated with the BclA gene in the genome of Bacillus anthracis Stern (e.g., the promoter of SEQ ID NO: 85).

[0209] Alternatively, the fusion protein can be expressed under the control of a highly expressed sporulation promoter. In some cases, the native promoter of the targeting sequence, the exosporium protein, or the exosporium protein fragment will be a highly expressed sporulation promoter. In other cases, the native promoter of the targeting sequence, the exosporium protein, or the exosporium protein fragment will not be a highly expressed sporulation promoter. In the latter case, it may be advantageous to replace the native promoter with a highly expressed sporulation promoter. Expression of the fusion protein under the control of a highly expressed sporulation promoter increases the expression of the fusion protein on the exosporium of members of the Bacillus cereus family.

[0210] The high expression sporulation promoter may comprise one or more sigma-K sporulation-specific polymerase promoter sequences.

[0211] Suitable high-expressing sporulation promoters for expressing fusion proteins in Bacillus cereus family members include those listed in Table 2 below:

[0212] Table 2. Promoter sequences

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] In the promoter sequences listed in Table 2 above, the location of the σ-K sporulation-specific polymerase promoter sequence is indicated by bold and underlined text. The Cry1A promoter (Bacillus thuringiensis HD-73; SEQ ID NO: 90) has a total of four σ-K sequences, two of which overlap with each other, as indicated by the double underlines in Table 2.

[0219] Preferred high-expressing sporulation promoters for expressing fusion proteins in Bacillus cereus family members include the BetA promoter (Bacillus anthracis Stern; SEQ ID NO:86), the BclA promoter (Bacillus anthracis Stern; SEQ ID NO:85), the BclA cluster glycosyltransferase operon 1 and 2 promoters (Bacillus anthracis Stern; SEQ ID NOs:101 and 102), and the YVTN β-propeller protein promoter (Bacillus weihenstephen KBAB 4; SEQ ID NO:89).

[0220] In any of the recombinant exosporating Bacillus cells described herein, the fusion protein can be expressed under the control of a sporulation promoter comprising a nucleic acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 85-103.

[0221] When the sporulation promoter comprises a nucleic acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 85-103, the sigma-K sporulation-specific polymerase promoter sequence preferably has 100% identity to the corresponding nucleotides of SEQ ID NOs: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, or 103. For example, as shown in Table 2 above, the BclA promoter of Bacillus anthracis Stern (SEQ ID NO: 85) has sigma-K sporulation-specific polymerase promoter sequences at nucleotides 24-32, 35-43, and 129-137. Thus, if the sporulation promoter comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:85, then preferably the nucleotides of the sporulation promoter corresponding to nucleotides 24-32, 35-43 and 129 of SEQ ID NO:85 are 100% identical to nucleotides 24-32, 35-43 and 129-137 of SEQ ID NO:85.

[0222] In any of the methods for stimulating plant growth described herein, plants grown in a plant growth medium comprising recombinant spore-forming Bacillus cells and at least one additional biological control agent selected from the specific microorganisms disclosed herein exhibit increased growth compared to plants grown in the same plant growth medium without the recombinant spore-forming Bacillus cells.

[0223] In any of the compositions and methods described herein for stimulating plant growth, the recombinant exine-producing Bacillus cell can comprise a recombinant plant growth promoting strain of any of the above-described bacteria.

[0224] In any of the compositions or methods disclosed herein for stimulating plant growth, the fusion protein can be expressed under the control of any of the above-described promoters.

[0225] Synthetic nodulation factor and plant growth stimulant

[0226] In some embodiments, the composition comprising a recombinant sporulating exine Bacillus cell expressing a fusion protein and at least one biological control agent described herein further comprises a synthetic nodulation factor and / or plant growth stimulator. Non-limiting examples of such synthetic compounds are compounds of formula (I),

[0227]

[0228] in:

[0229] n is 2 or 3;

[0230] A is -C(O)-;

[0231] B is phenylene;

[0232] C is -O-;

[0233] D is a straight hydrocarbon chain containing 11 carbons, which is saturated or unsaturated between carbons 4 and 5;

[0234] E and G are independently selected from the substituent NHR20;

[0235] R1, R2, R3, R4, R5, R6, R7 and R9 are H;

[0236] R8 is selected from H, fucosyl, methylfucosyl, SO3H, SO3Li, SO3Na, SO3K and SO3N(C 1-8 -alkyl)4;

[0237] R20 is C(O)C 1-6 -alkyl; and

[0238] Any agriculturally acceptable geometric and / or optical isomer, enantiomer and / or diastereomer, tautomer, salt, N-oxide, sulfoxide or sulfone thereof.

[0239] The salt may be selected from lithium salts, sodium salts, potassium salts and tetraalkylammonium salts.

[0240] In certain embodiments, E and G are NHC(O)CH3.

[0241] In other embodiments, R8 is selected from H, SO3H, SO3Li, SO3Na, SO3K, SO3N(C 1-8 alkyl)4 and a substituent of the formula:

[0242]

[0243] in:

[0244] R26 is selected from H and CH3; and

[0245] R27 and R28 are independently selected from H, C(O)CH3, SO3H, SO3Li, SO3Na, SO3K and SO3N(C 1-8 Alkyl)4.

[0246] In some aspects, R26, R27, and R28 are all hydrogen.

[0247] Other non-limiting examples of synthetic nodulation factors and / or plant growth stimulants that can be used in the present invention include compounds having the following structural formula:

[0248]

[0249]

[0250]

[0251]

[0252]

[0253] wherein, when present, M is selected from H + , Li + 、Na + , K + and (C 1-8 Alkyl)4N + .

[0254] In certain aspects, the synthetic nodulation factor and / or plant growth stimulator is a compound selected from the group consisting of:

[0255]

[0256]

[0257] Other biological control agents

[0258] The biological control agent may in particular comprise bacteria, fungi or yeasts, protozoa, viruses, insect pathogenic nematodes, inoculants and plants having all the identification characteristics of the respective strains, and / or mutants thereof, and / or at least one metabolite produced by the respective strains that exhibits activity against insects, mites, nematodes and / or plant pathogens. The present invention relates to a combination of the above-mentioned recombinant Bacillus cells with a specific biological control agent as described herein, and / or to mutants of a specific strain of a microorganism as described herein, wherein the mutant has all the identification characteristics of the respective strains, and / or at least one metabolite produced by the respective strains that exhibits activity against insects, mites, nematodes and / or plant pathogens or promotes plant growth and / or enhances plant health.

[0259] Bacterial cells, spores and metabolites in the culture broth ("whole broth" or "fermentation broth") obtained from the fermentation of the specific microorganisms described herein can be used directly or concentrated by conventional industrial methods (e.g., centrifugation, filtration and evaporation), or processed into dry powders and granules by, for example, spray drying, drum drying and freeze drying.

[0260] As used herein, the terms "whole broth" and "fermentation broth" refer to the culture broth obtained by fermentation before any downstream processing. The whole broth contains microorganisms and their components, unused raw material substrates, and metabolites produced by the microorganisms during fermentation. As used herein, the term "broth concentrate" refers to a whole broth (fermentation broth) that has been concentrated by conventional industrial methods as described above but remains in liquid form. As used herein, the term "fermentation solids" refers to dried fermentation broth. As used herein, the term "fermentation product" refers to whole broth, broth concentrate and / or fermentation solids. The compositions of the present invention include fermentation products. In some embodiments, the concentrated fermentation broth is washed, for example, by a diafiltration process to remove residual fermentation broth and metabolites.

[0261] In another embodiment, the fermentation broth or broth concentrate can be dried using conventional drying processes or methods such as spray drying, freeze drying, tray drying, fluidized bed drying, drum drying or evaporation, with or without the addition of carriers, inert substances or additives.

[0262] According to the present invention, the biological control agents summarized under the term "bacteria" include spore-forming, root-colonizing bacteria, or bacteria and their metabolites used as bioinsecticides, bionematicides, bioacaricides or biofungicides or soil conditioners that improve plant health and growth. The bacteria used or utilized according to the present invention are as follows.

[0263] Bacillus cereus strains, including strain CNCM I-1562 (see U.S. Pat. No. 6,406,690), Bacillus firmus, Bacillus pumilus, and in particular strain GB34 (product known as YIELD ) and strain QST2808 (product called QST2808), Bacillus subtilis, in particular strain GB03 (product known as ), strain QST713 (product called QST713), strain AQ30002 (also known as QST30002; NRRL accession number B-50421, known in WO 2012 / 087980, which is incorporated herein by reference), strain AQ30004 (also known as QST30004; NRRL accession number B-50455, known in WO 2012 / 087980, which is incorporated herein by reference), strain AQ743 (NRRL accession number B-21665), strain AQ153 (ATCC accession number 55614 as described in WO 98 / 21964), (1.79) Streptomyces galbus strain AQ 6047 (accession number NRRL 30232), (1.91) Rhodococcus spherical globerulus) AQ719 (NRRL Accession No. B-21663), (1.92) Bacillus sp. AQ175 (ATCC Accession No. 55608), (1.93) Bacillus sp. AQ 177 (ATCC Accession No. 55609), (1.94) Bacillus sp. AQ178 (ATCC Accession No. 53522), (1.95) Streptomyces sp. strain described in WO 02 / 26041A2 (NRRL Accession No. B-30145), (1.96) Streptomyces microflavus strain NRRL B-50550, (1.97) Streptomyces tenuiflavus strain M (accession number 091013-02), a fermentation product of Streptomyces containing glutathione as described in WO2014 / 059275, and Streptomyces fulvus QST6047 (described in US Pat. No. 6,682,925).

[0264] In a specific embodiment, the following bacteria are used in combination with the above-described recombinant Bacillus sporogenous cells producing spore exines:

[0265] Bacillus firmus, in particular strain I-1582 (products known as Bionem, Votivo, Flocter),

[0266] Bacillus pumilus, especially strain GB34 (product known as YIELD ) and strain QST2808 (product called QST2808),

[0267] Bacillus subtilis, in particular strain GB03 (product known as ), strain QST713 (product called QST713); NRRL Accession No. B-50455, known in WO 2012 / 087980, which is incorporated herein by reference), or Bacillus subtilis var. amyloliquefaciens FZB24 (product known as ), strain AQ743 (NRRL accession number B-21665), strain AQ153 (ATCC accession number 55614 as described in WO 98 / 21964),

[0268] In one embodiment, the composition of the invention comprises a combination of at least one specific biocontrol agent described herein and at least one other biocontrol agent selected from the group consisting of Bacillus chitinosporus AQ746 (NRRL Accession No. B-21618), Bacillus mycoides AQ726 (NRRL Accession No. B-21664), Bacillus pumilus QST2808 (NRRL Accession No. B-30087), Bacillus pumilus AQ717 (NRRL Accession No. B-21662), Bacillus species (Bacillus sp.) AQ175 (ATCC Accession No. 55608), Bacillus species AQ177 (ATCC Accession No. 55609), Bacillus species AQ178 (ATCC Accession No. 53522), Bacillus subtilis AQ743 (NRRL Accession No. B-21665), Bacillus subtilis AQ713 (NRRL Accession No. B-21661), Bacillus subtilis AQ153 (ATCC Accession No. 55614), Muscodor albus) 620 (NRRL Accession No. 30547), Muscodorroseus A3-5 (NRRL Accession No. 30548), Rhodococcus sphaeroides AQ719 (NRRL Accession No. B-21663), Streptomyces flavus (NRRL Accession No. 30232), Streptomyces species (NRRL Accession No. B-30145), Bacillus subtilis AQ30002 (NRRL Accession No. B-50421) and Bacillus subtilis AQ30004 (NRRL Accession No. B-50455) and / or mutants of these strains having all the identifying characteristics of the respective strains, and / or at least one metabolite produced by the respective strains that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0269] Other biological control agents such as the following are known in the art:

[0270] Bacillus acutosporus AQ746 (NRRL Accession No. B-21618) is known from WO 98 / 2166 A2. It has specific activity against nematodes and insects and produces non-exotoxin, non-protein active metabolites in its supernatant. These metabolites are active against nematodes and cockroaches, but not against flies, corn rootworms or beet armyworms.

[0271] Bacillus mycoides AQ726 (NRRL Accession No. B-21664) and its water-soluble metabolites kill or stunt the development of insects, such as corn rootworm larvae and aphids (WO 99 / 09820A1).

[0272] As described in WO 00 / 58442 A1, Bacillus pumilus QST2808 (NRRL Accession No. B-30087) is capable of inhibiting a wide range of fungal plant diseases in vivo. Commercial preparations of this strain are available under the trade name BREFOX® from Bayer CropScience LP (North Carolina, USA). and PLUS sales.

[0273] Bacillus pumilus AQ717 (NRRL Accession No. B-21662) is known from WO 99 / 10477 A1. It produces metabolites that show pesticide activity against corn rootworms, nematodes and beet armyworms.

[0274] The bacterial strains Bacillus sp. AQ175 (ATCC Accession No. 55608), Bacillus sp. AQ177 (ATCC Accession No. 55609) and Bacillus sp. AQ178 (ATCC Accession No. 53522) described in WO 98 / 21967 A1 are effective in treating and protecting plants against aboveground fungal and bacterial infections.

[0275] The metabolite-producing strain Bacillus subtilis AQ743 (NRRL Accession No. B-21665) kills or stunts the development of corn rootworm larvae, beet armyworm larvae, adult flies, and nematodes (see WO 99 / 09819).

[0276] Bacillus subtilis AQ713 (Accession No. B-21661), also known as Bacillus subtilis QST713, exhibits broad fungicidal and bactericidal activity and also exhibits corn rootworm activity (WO 98 / 50422A1). Commercial preparations of this strain are available from Bayer CropScience LP (North Carolina, USA) under the trade name MAX, SERENADE ASO, CPB and MAX obtained. The product (U.S. EPA Registration No. 69592-12) contains a proprietary strain of Bacillus subtilis (strain QST713) and a number of different lipopeptides that work synergistically to destroy disease pathogens and provide excellent antimicrobial activity. The products are used to protect plants (eg vegetable crops, fruit crops, nut crops and vine crops) against diseases (eg fire blight, botrytis, acid rot, rust, sclerotinia, powdery mildew, bacterial spot and white mold). The products are available in liquid or dry formulations and can be applied as foliar and / or soil treatments. Products (including ASO, MAX and Copies of the U.S. EPA master label for ) are publicly available through the National Pesticide Information Retrieval System (NPIRSv) USEPA / OPP Pesticide Product Labeling System (PPLS).

[0277] ASO (Aqueous Suspension-Organic) contains 1.34% of dry QST713 as active ingredient and 98.66% of other ingredients. ASO contains at least 1×10 9 cfu / g of QST713, and the maximum amount of QST713 has been determined to be 3.3×10 10 cfu / g. For more information, see the January 4, 2010 The U.S. EPA master label for ASO is incorporated herein by reference in its entirety.

[0278] MAX contains 14.6% dry QST713 as the active ingredient and 85.4% other ingredients. MAX contains at least 7.3×10 9 cfu / g of QST713, and the maximum amount of QST713 has been determined to be 7.9×10 10 cfu / g. For more information, see The U.S. EPA Master Label for MAX is incorporated herein by reference in its entirety.

[0279] Bacillus subtilis AQ153 (ATCC Accession No. 55614) as described in WO 98 / 21964 A1 effectively inhibits the growth of phytopathogenic bacteria and fungi.

[0280] WO 02 / 02082898 A1 describes plant endophytic fungi including Muscodor albus 620, also known as Muscodor albus QST20799 (NRRL Accession No. 30547) and Muscodor roseus A3-5 (NRRL Accession No. 30548), which produce a mixture of volatile antibiotics active against fungi, bacteria, insects and nematodes.

[0281] Rhodococcus sphaeroides AQ719 (NRRL Accession No. B-21663) produces metabolites that exhibit pesticide activity against corn rootworms (U.S. Patent No. 6,027,723A).

[0282] WO 01 / 79480 A2 describes strains of Streptomyces flavosus (NRRL Accession No. 30232) which exhibit insecticidal activity against Lepidoptera.

[0283] The Streptomyces sp. strain described in WO 02 / 26041 A2 (NRRL Accession No. B-30145) exhibits antifungal activity against specific plant pathogens such as Alternaria, Phytophthora, Botrytis, Rhizoctonia and Sclerotinia.

[0284] The strains Bacillus subtilis AQ30002 (also known as QST30002) (NRRL Accession No. B-50421, deposited on October 5, 2010) and Bacillus subtilis AQ30004 (also known as QST30004) (NRRL Accession No. B-50455, deposited on October 5, 2010) are known from WO 2012 / 087980A1, which is incorporated herein by reference. As described herein, these BCAs exhibit a wide range of fungicidal and bactericidal activities. B19 and B20 have mutations in the swrA gene, resulting in impaired swarming ability and enhanced plant health promotion compared to strains containing the wild-type swrA gene. The mutations cause these BCAs to form more robust biofilms compared to the wild-type strain, thereby enhancing their fungicidal and bactericidal activities.

[0285] In some embodiments, the biological control agent is a strain of Bacillus subtilis, such as Bacillus subtilis QST713, which produces a fengycin-type compound, an iturin-type compound, and / or a subtilis surfactin-type compound. In some aspects, the lipopeptide is a fengycin-type compound, such as thujasuline A1, thujasuline B1, thujasuline B2, fengycin A, fengycin B, agrastatin 1, or agrastatin 2. In other aspects, the lipopeptide is an iturin-type compound, such as iturin A, mycosubtiline, or a bacillus antimycin.

[0286] Other lipopeptide-producing strains suitable for use in the compositions and methods of the present invention include Bacillus amyloliquefaciens strain D747 (which can be used as Available from Etec Crop Solutions, NZ and also available as DOUBLE NICKEL TM obtained from Certis, US); Bacillus subtilis MBI600 (available as Obtained from Becker Underwood, U.S. EPA Registration No. 71840-8); Bacillus subtilis Y1336 (available as WP was obtained from Bion-Tech, Taiwan, China, and is registered as a biofungicide in Taiwan, China, with registration numbers 4764, 5454, 5096, and 5277); Bacillus amyloliquefaciens, particularly strain FZB42 (can be used as Obtained from ABiTEP, DE); Bacillus subtilis var. amyloliquefaciens FZB24 as a fungicide or ECO (EPA Registration No. 70127-5) was obtained from Novozymes Biologicals Inc. (Salem, Virginia) or Syngenta Crop Protection, LLC (Greensboro, North Carolina).

[0287] In some embodiments, the biological control agent in the synergistic combination of the present invention is:

[0288] Bacillus firmus, including strain I-1582 (products known as Bionem, Votivo, Flocter), disclosed in U.S. Pat. No. 6,406,690 (which is incorporated herein by reference) and deposited with the CNCM on May 29, 1995, under registration number CNCM I-1582,

[0289] Bacillus pumilus, including strain GB34 (product known as YIELD ) and strain QST2808 (product called QST2808),

[0290] Bacillus subtilis and Bacillus amyloliquefaciens, including those producing lipopeptides, particularly thujacetin or a combination of fengycin, surfactin and / or iturin. In addition, for Bacillus subtilis, particularly strain GB03 (product known as See U.S. EPA, Pesticide Fact Sheet--Bacillus subtilis GB03 1992), strain QST713 (product called QST713), strain AQ30002 (also known as QST30002; NRRL Accession No. B-50421, known in WO 2012 / 087980, which is incorporated herein by reference), and strain AQ30004 (also known as QST30004; NRRL Accession No. B-50455, known in WO 2012 / 087980, which is incorporated herein by reference).

[0291] According to the invention, biological control agents that may be comprised in the compositions of the invention and are summarized under the terms "fungi" or "yeast" are the following organisms and / or their mutants having all the identifying characteristics of the respective strains and / or metabolites produced by the respective strains that show activity against insects, mites, nematodes and / or phytopathogens (numbering is used in the full description):

[0292] White gas-producing mold, especially strain QST20799 (product known as ARABESQUE TM OR ANDANTE TM ), Coniothyrium minitans, in particular strain CON / M / 91-8 (product known as ), Lagenidium giganteum (product called , Paecilomyces lilacinus, specifically spores of Paecilomyces lilacinus strain 251 (produced by AgraQuest, Inc.) See Crop Protection 2008, 27, 352-361).

[0293] According to one embodiment of the present invention, the biological control agent includes not only pure cultures of the respective microorganisms, but also their suspensions in whole broth cultures, or supernatants containing metabolites, or purified metabolites obtained from whole broth cultures of strains. "Whole broth culture" refers to a liquid culture containing both cells and culture medium. "Supernatant" refers to the liquid broth remaining when cells grown in broth are removed by centrifugation, filtration, sedimentation or other means known in the art.

[0294] The metabolites produced by the non-pathogenic microorganisms include antibiotics, enzymes, siderophores and growth promoters, such as zwittermicin-A, kanosamine, polyoxine, enzymes such as α-amylase, chitinase and pektinase, plant hormones and their precursors such as auxins, gibberellin-like substances, cytokinin-like compounds, lipopeptides such as iturins, thujacetin or surfactins, such as agrastatin A, bacillomycin D, bacilysin, difficidin, macrolactin, fengyrin, bacillaene and bacillaene.

[0295] According to the present invention, the biocontrol agents described herein can be employed or used in any physiological state, such as an active state or a dormant state.

[0296] Compositions of the present invention

[0297] According to the present invention, the composition comprises a synergistically effective amount of a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from the group consisting of: enzymes involved in the production or activation of plant growth stimulating compounds; enzymes that degrade or modify bacterial, fungal or plant nutrient sources; and proteins or peptides that protect plants against pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exosporium of a member of the Bacillus cereus family; and b) at least one additional and different specific biological control agent disclosed herein and / or a mutant of a specific strain of a microorganism disclosed herein (which has all the identifying characteristics of the respective strain), and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0298] A "synergistically effective amount" according to the present invention refers to an amount of the combination of a recombinant sporulating exine-producing Bacillus cell expressing a fusion protein and at least one other specific biological control agent described herein that is more effective against insects, mites, nematodes and / or plant pathogens than a recombinant sporulating exine-producing Bacillus cell expressing a fusion protein or such other biological control agent alone. A "synergistically effective amount" according to the present invention also refers to an amount of the combination of a recombinant sporulating exine-producing Bacillus cell expressing a fusion protein and at least one other specific biological control agent described herein that is more effective in enhancing plant growth and / or promoting plant health than a recombinant sporulating exine-producing Bacillus cell expressing a fusion protein or such other biological control agent alone.

[0299] The invention includes every combination of every other specific biocontrol agent described herein and a recombinant sporulating exine-producing Bacillus cell.

[0300] In a preferred embodiment, the composition of the invention comprises at least one additional fungicide and / or at least one insecticide, with the proviso that the recombinant sporulating exine Bacillus cells, insecticide and fungicide are not the same.

[0301] The term "active compound" or "active ingredient" is used in this specification to refer to the recombinant exine-sporing Bacillus cells, the at least one other biological control agent and / or a mutant thereof having all the identifying characteristics of the respective strain, and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or plant pathogens, the at least one insecticide and the at least one fungicide.

[0302] Other additives

[0303] One aspect of the present invention provides a composition as described above, which further comprises at least one auxiliary selected from extenders, solvents, self-generation promoters, carriers, emulsifiers, dispersants, antifreeze agents, thickeners and adjuvants. Those compositions are called formulations.

[0304] Thus, one aspect of the invention provides the formulation and the application form prepared therefrom as a crop protection agent and / or pesticide (e.g. drench, drip and spray liquid), which comprises the composition of the invention. The application form may comprise other crop protection agents and / or pesticides, and / or activity-enhancing adjuvants such as penetrants, examples being vegetable oils (e.g. rapeseed oil, sunflower oil), mineral oils (e.g. liquid paraffin), alkyl esters of vegetable fatty acids (e.g. rapeseed oil methyl ester or soybean oil methyl ester), or alkanol alkoxylates, and / or spreaders such as alkylsiloxanes and / or salts, examples being organic or inorganic ammonium or phosphonium salts (e.g. ammonium sulfate or diammonium hydrogen phosphate), and / or retention promoters such as dioctyl sulphosuccinate or hydroxypropyl guar polymers, and / or humectants (e.g. glycerol) and / or fertilizers (e.g. ammonium fertilizers, potash fertilizers or phosphate fertilizers).

[0305] Examples of typical formulations include water-soluble liquids (SL), emulsifiable concentrates (EC), emulsions in water (EW), suspension concentrates (SC, SE, FS, OD), water-dispersible granules (WG), granules (GR) and capsule concentrates (CS); these formulations and other possible formulation types are described by, for example, Crop Life International in the following documents: Pesticide Specifications, Manual on Development and Use of FAO and WHO Specifications for Pesticides, FAO Plant Production and Protection Papers-173 (Developed by the Joint Conference of the Food and Agriculture Organization of the United Nations / World Health Organization on Pesticide Manuals, 2004, ISBN: 9251048576). The formulations may contain active agrochemical compounds other than one or more active compounds of the present invention.

[0306] The formulation or application form under study preferably comprises an auxiliary agent, such as a filler, a solvent, a self-generating promoter, a carrier, an emulsifier, a dispersant, an antifreeze agent, a microbicide (biocides), a thickener and / or other auxiliary agents, such as an adjuvant. In this context, an adjuvant is a component that enhances the biological efficacy of the formulation, while the component itself does not have a biological efficacy. Examples of adjuvants are agents that promote retention, diffusion, attachment to the leaf surface, or penetration.

[0307] These preparations are prepared in a known manner, for example by mixing the active compound with adjuvants, for example extenders, solvents and / or solid carriers and / or other adjuvants, for example surfactants. The preparations are prepared in a suitable plant or before or during application.

[0308] Suitable for use as auxiliaries are substances which are suitable for imparting certain properties (for example certain physical, technical and / or biological properties) to the preparations of active compounds or to the application forms prepared from these preparations (for example useful crop protection agents, such as spray liquors or seed dressings).

[0309] Suitable extenders are, for example, water, polar and nonpolar organic chemical liquids, for example from the following classes: aromatic and nonaromatic hydrocarbons (for example paraffins, alkylbenzenes, alkylnaphthalenes, chlorobenzenes), alcohols and polyols (which, if appropriate, may also be substituted, etherified and / or esterified), ketones (for example acetone, cyclohexanone), esters (including fats and oils) and (poly)ethers, unsubstituted and substituted amines, amides, lactams (for example N-alkylpyrrolidones) and lactones, sulfones and sulfoxides (for example dimethyl sulfoxide).

[0310] If the extender used is water, it is also possible to use, for example, organic solvents as auxiliary solvents. In principle, suitable liquid solvents are: aromatic compounds, such as xylene, toluene or alkylnaphthalenes; chlorinated aromatic compounds and chlorinated aliphatic hydrocarbons, such as chlorobenzene, vinyl chloride or methylene chloride; aliphatic hydrocarbons, such as cyclohexane or paraffins, for example petroleum fractions, mineral oils and vegetable oils; alcohols, such as butanol or ethylene glycol, and their ethers and esters; ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone; strongly polar solvents, such as dimethylformamide and dimethyl sulfoxide, and water.

[0311] In principle, all suitable solvents can be used. Suitable solvents are, for example, aromatic hydrocarbons, such as xylene, toluene or alkylnaphthalenes; chlorinated aromatic compounds or chlorinated aliphatic hydrocarbons, such as chlorobenzene, vinyl chloride or methylene chloride; aliphatic hydrocarbons, such as cyclohexane, paraffins, petroleum fractions, mineral oils and vegetable oils; alcohols, such as methanol, ethanol, isopropanol, butanol or ethylene glycol, and ethers and esters thereof; ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone; strongly polar solvents, such as dimethyl sulfoxide, and water.

[0312] In principle, all suitable carriers can be used. Suitable carriers are, in particular, for example, ammonium salts and ground natural minerals, such as kaolins, clays, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth, and ground synthetic minerals, such as finely divided silicon dioxide, aluminum oxide and natural or synthetic silicates, resins, waxes and / or solid fertilizers. It is likewise possible to use mixtures of the carriers mentioned. Suitable carriers for granules include, for example, crushed and fractionated natural minerals, such as calcite, marble, pumice, sepiolite, dolomite, and synthetic granules of inorganic and organic powders, and granules of organic material, such as sawdust, paper, coconut shells, corn cobs and tobacco straw.

[0313] Liquefied gaseous extenders or solvents may also be used. Particularly suitable are those extenders or carriers which are gaseous at standard temperature and standard pressure, examples being aerosol propellants, such as halogenated hydrocarbons, and also butane, propane, nitrogen and carbon dioxide.

[0314] Examples of emulsifiers and / or foam formers, dispersants or wetting agents having ionic or nonionic properties, or mixtures of these surface-active substances are: polyacrylates, ligninsulfonates, phenolsulfonates or naphthalenesulfonates, polycondensates of ethylene oxide with fatty alcohols or with fatty acids or with fatty amines, with substituted phenols, preferably alkylphenols or arylphenols, salts of sulfosuccinates, taurine derivatives, preferably alkyltaurates, phosphoric esters of polyethoxylated alcohols or phenols, fatty acid esters of polyols, and derivatives of compounds containing sulfates, sulfonates and phosphates, examples being alkylaryl polyglycol ethers, alkylsulfonates, alkyl sulfates, arylsulfonates, protein hydrolysates, ligninsulfite waste liquors and methylcellulose. The presence of a surface-active substance is advantageous if one of the active compounds and / or one of the inert carriers is insoluble in water and application is carried out in water.

[0315] Other auxiliaries that may be present in the preparations and application forms derived therefrom include colorants such as inorganic pigments, examples being iron oxide, titanium oxide and Prussian blue, and organic dyes, for example alizarin dyes, azo dyes and metal phthalocyanine dyes, and nutrients and trace nutrients, for example iron salts, manganese salts, boron salts, copper salts, cobalt salts, molybdenum salts and zinc salts.

[0316] Stabilizers such as low temperature stabilizers, preservatives, antioxidants, light stabilizers or other agents that improve chemical and / or physical stability may also be present. Foaming or defoaming agents may also be present.

[0317] In addition, the preparations and the application forms derived therefrom may also contain as additional adjuvants a sticker (e.g. carboxymethylcellulose), natural and synthetic polymers in the form of powders, granules or latexes (e.g. gum arabic, polyvinyl alcohol, polyvinyl acetate), and natural phospholipids (e.g. cephalin and lecithin), as well as synthetic phospholipids. Other possible adjuvants include mineral oils and vegetable oils.

[0318] Other adjuvants may be present in the formulations and the application forms derived therefrom. Examples of such additives include fragrances, protective colloids, binders, adhesives, thickeners, thixotropic substances, penetrants, retention promoters, stabilizers, chelating agents, complexing agents, wetting agents and spreaders. In general, the active compound can be combined with any solid or liquid additive commonly used for formulation purposes.

[0319] Suitable retention promoters include all substances which reduce the dynamic surface tension (eg dioctyl sulfosuccinate) or increase the viscoelasticity (eg hydroxypropyl guar polymers).

[0320] Suitable penetrants in this context include all substances that are commonly used to enhance the penetration of active agrochemical compounds into plants. Penetrants are defined in this context as substances that are able to penetrate the cuticle of plants starting from a (usually aqueous) application solution and / or from a spray coating, thereby increasing the mobility of the active compound in the cuticle. This property can be determined using the method described in the literature (Baur et al., 1997, Pesticide Science 51, 131-152). Examples include alcohol alkoxylates such as coconut fat ethoxylate (10) or isotridecyl ethoxylate (12), fatty acid esters such as rapeseed oil methyl ester or soybean oil methyl ester, fatty amine alkoxylates such as tallow amine ethoxylate (15), or ammonium and / or phosphonium salts such as ammonium sulfate or diammonium hydrogen phosphate.

[0321] The preparation preferably contains 0.0001% to 98% by weight of active compound, or particularly preferably 0.01% to 95% by weight of active compound, more preferably 0.5% to 90% by weight of active compound, based on the weight of the preparation. The content of active compound is defined as the sum of the recombinant exine-spore-forming Bacillus cells and other specific biological control agents as described herein and / or mutants of specific microbial strains as described herein having all the identifying characteristics of the respective strains, and / or at least one metabolite produced by the respective strains that exhibits activity against insects, mites, nematodes and / or plant pathogens, and fungicides and / or insecticides, if present.

[0322] The active compound content of the application forms (crop protection products) prepared from the formulations can vary within a wide range. The active compound concentration in the application forms can generally be from 0.0001% to 95% by weight of active compound, preferably from 0.0001% to 1% by weight, based on the weight of the application form. Application is carried out in a conventional manner suitable for the application form.

[0323] Furthermore, in one aspect of the present invention, a kit of parts is provided, comprising spatially separated synergistically effective amounts of recombinant spore-forming exine Bacillus cells and at least one other specific biological control agent disclosed herein and / or a mutant of a specific microbial strain disclosed herein having all the identifying characteristics of the respective strain, and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes and / or plant pathogens.

[0324] In another embodiment of the present invention, the above kit of parts further comprises at least one fungicide and / or at least one insecticide, provided that the recombinant sporulating exine-producing Bacillus cells, the insecticide, and the fungicide are not the same. The fungicide and / or insecticide may be present in the biological control agent component based on the recombinant sporulating exine-producing Bacillus cereus family member of the spatially separated kit of parts, or in the components of the kit of parts comprising the specific biological control agent disclosed herein, or in both components. In one embodiment, the fungicide and insecticide are present in the biological control agent component based on the recombinant sporulating exine-producing Bacillus cereus family member.

[0325] Furthermore, the kit of parts of the present invention may additionally comprise at least one auxiliary selected from the group consisting of fillers, solvents, self-generation promoters, carriers, emulsifiers, dispersants, antifreeze agents, thickeners and adjuvants as described below. The at least one auxiliary may be present in the component of the biological control agent based on the recombinant sporulating exine of the Bacillus cereus family member in the spatially separated kit of parts, or in the component of the kit of parts comprising the specific biological control agent disclosed herein, or in both components.

[0326] In another aspect of the invention, the above composition is used to reduce overall damage to plants and plant parts and losses in harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens.

[0327] Furthermore, in another aspect of the present invention, the above composition improves overall plant health.

[0328] The term "plant health" generally encompasses various plant improvements that are not related to pest control. For example, advantageous properties that may be mentioned are improved crop properties, which include: emergence, crop yield, protein content, oil content, starch content, more developed root system, improved root growth, improved root size maintenance, improved root efficiency, improved stress tolerance (e.g., tolerance to drought, heat, salt, UV, water, cold), ethylene reduction (reduced production and / or inhibited uptake), increased tillering, increased plant height, larger leaves, fewer dead basal leaves, stronger tillers, greener leaf color, pigment content, photosynthetic activity, less input (such as fertilizer or water) required, less seeds required, more productive tillers, earlier flowering, earlier grain maturity, less plant inversion (lodging), faster shoot growth, enhanced plant vigor, increased plant uprightness and earlier and better germination.

[0329] For use in the present invention, improved plant health preferably refers to improved plant characteristics including: crop yield, more developed root system (improved root growth), improved root size maintenance, improved root efficiency, increased tillering, increased plant height, larger leaves, fewer dead basal leaves, stronger tillers, greener leaf color, photosynthetic activity, more productive tillers, enhanced plant vigor and increased plant stand.

[0330] In relation to the present invention, improved plant health particularly preferably refers to improved plant characteristics selected from the group consisting of: crop yield, a more developed root system, improved root growth, improved root size maintenance, improved root efficiency, increased tillering and increased plant height.

[0331] The effect of the composition of the invention on plant health as defined herein can be determined by comparing plants grown under the same environmental conditions, wherein one part of the plant is treated with the composition of the invention and another part of the plant is not treated with the composition of the invention. In contrast, the other part is not treated at all or is treated with a placebo (i.e., no application of the composition of the invention, e.g., no application of all active ingredients (i.e., no recombinant sporulating exine Bacillus cells as described herein and no other specific biological control agents as described herein), or no application of recombinant sporulating exine Bacillus cells as described herein, or no application of other specific biological control agents disclosed herein).

[0332] The composition of the present invention can be applied in any desired manner, for example in the form of seed coating, soil drench, and / or directly in the furrow, and / or as a foliar spray, and can be applied before emergence, after emergence, or before and after emergence. In other words, the composition can be applied to seeds, plants or harvested fruits and vegetables, or to the soil (plant growth site) where the plant is growing or expected to grow.

[0333] Reducing overall damage to plants and plant parts generally results in healthier plants and / or increased plant vigor and yield.

[0334] Preferably, the compositions according to the invention are used for treating conventional plants or transgenic plants or their seeds.

[0335] The present invention also relates to methods of stimulating plant growth using any of the above compositions, the compositions comprising a recombinant sporulating exine Bacillus cell expressing a fusion protein and at least one other specific biological control agent as described herein. The method for stimulating plant growth comprises applying a composition to a plant, a plant part, to a locus surrounding a plant, or to a locus (e.g., soil or other growth medium) where the plant will be planted, the composition comprising a synergistically effective amount of a recombinant sporulating exine Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide; and (ii) a targeting sequence, an exosporium protein, or an exosporium protein fragment, and at least one other specific biological control agent disclosed herein and / or a mutant of a specific strain of a microorganism disclosed herein (which has all the identifying characteristics of the respective strain), and / or at least one metabolite produced by the respective strain that exhibits activity against insects, mites, nematodes, and / or plant pathogens.

[0336] In another aspect of the present invention, a method for reducing overall damage to plants and plant parts, as well as losses in harvested fruits or vegetables, caused by insects, mites, nematodes and / or plant pathogens is provided, comprising the step of simultaneously or sequentially applying a synergistically effective amount of recombinant sporulating exine Bacillus cells and at least one other specific biological control agent as described herein.

[0337] In one embodiment of the method of the present invention, the composition further comprises at least one fungicide. In one aspect, the at least one fungicide is a synthetic fungicide. In another aspect of this embodiment, the at least one fungicide is selected from the group consisting of bitertanol, bixafen, bromuconazole, carbendazim, carpropamid, dichlofluanid, fenamidone, fenhexamid, fentinacetate, fentin hydroxide, and fentin pyrochlore. hydroxide), fluopicolide, fluopyram, fluoxastrobin, fluquinconazole, fosetyl, iprodione, iprovalicarb, isotianil, metominostrobin, ofurace, pencycuron, penflufen, prochloraz, propamocarb, propineb, prothioconazole, pyrimethanil, spiroxamine, tebuconazole, tolylfluanid, triadimefon, triadimenol, triazoxide and trifloxystrobin.

[0338] In another embodiment, the composition comprises at least one insecticide in addition to or in place of the fungicide, with the proviso that the insecticide, the fungicide, the recombinant exine-spore-forming Bacillus cell, and the specific biological control agent disclosed herein are not the same.

[0339] In one embodiment, the at least one insecticide is a synthetic insecticide. In another embodiment, the at least one insecticide is selected from the group consisting of acetamiprid, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, ethoprophos, fenamiphos, fenobucarb, fenthion, fipronil, flubendiamide, fluopyram, flup yradifurone, formetanate, heptanophos, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide, oxydemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifen, spirotetramat, thiacloprid, thiodicarb, tralomethrin, triazophos, triflumuron and vamidothion.

[0340] The methods of the present invention include application methods in which both the recombinant exine-spore-forming Bacillus cells and the at least one other specific biological control agent disclosed herein are formulated into a single, stable composition with an agriculturally acceptable shelf life (a so-called "single formulation") or combined before or at the time of use (a so-called "combination formulation").

[0341] If not otherwise indicated, the term "combination" represents various combinations of the recombinant exine-spore-forming Bacillus cells and the at least one other specific biological control agent disclosed herein and optionally the at least one fungicide and / or at least one insecticide in the form of a single formulation, in the form of a single "ready-mix", in the form of a combined spray mixture (such as a "tank-mix") consisting of the individual formulations, and in particular in the form of a combined use when the individual active ingredients are applied in a conventional sequential manner, i.e. one after the other within a reasonably short period of time (e.g., a few hours or a few days, e.g., 2 hours to 7 days). The order of application of the compositions of the invention is not critical for practicing the invention. Thus, the term "combination" also encompasses the presence of recombinant spore-forming exine Bacillus cells and at least one other specific biological control agent disclosed herein, and optionally at least one fungicide and / or insecticide, on or in the plant to be treated or its environment, habitat or storage space, for example, after the recombinant spore-forming exine Bacillus cells and at least one other specific biological control agent disclosed herein, and optionally at least one fungicide and / or insecticide are applied simultaneously or consecutively to the plant or its environment, habitat or storage space.

[0342] If the recombinant exine-forming Bacillus cells and at least one other specific biological control agent as described herein, and optionally at least one fungicide and / or at least one insecticide, are used or employed in a sequential manner, the plants or plant parts (including seeds and plants germinated therefrom), harvested fruits and vegetables are preferably treated according to the following method: first , applying at least one fungicide and / or at least one insecticide to the plants or plant parts; Secondly , the other specific biological control agents described herein and the recombinant sporulating exines of the Bacillus sporangioides cells are applied to the same plant or plant part. By this mode of application, the amount of insecticide / fungicide remaining on the plant at harvest is as low as possible. The time period between the first application and the second application within the (crop) growth cycle can be different and depends on the effect to be achieved. For example, a first application is performed to prevent insects, mites, nematodes and / or plant pathogens from attacking plants or plant parts (especially when treating seeds) or to combat attack by insects, mites, nematodes and / or plant pathogens (especially when treating plants or plant parts), and a second application is performed to prevent or control attack by insects, mites, nematodes and / or plant pathogens and / or promote plant growth. In this context, "control" means that the composition comprising the recombinant sporulating exines of the Bacillus sporangioides cells and the specific biological control agents disclosed herein cannot completely eradicate pests or plant pathogenic fungi, but can keep the attack at an acceptable level.

[0343] The present invention also provides the method for killing, suppressing, preventing and / or repelling activity that strengthens the present composition by multiple applications. In some other embodiments, during any desired developmental stage or under any predetermined pest pressure, the composition of the present invention is applied to plants and / or plant parts twice at intervals of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about 2 weeks, about 3 weeks, about 1 month or longer. Still in some embodiments, during any desired developmental stage or under any predetermined pest pressure, the composition of the present invention is applied to plants and / or plant parts more than twice, for example 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times or more at intervals of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about 2 weeks, about 3 weeks, about 1 month or longer. If desired, the intervals between each application can be varied. One skilled in the art will be able to determine the number of applications and length of intervals depending on the plant species, plant pest species and other factors.

[0344] According to the above steps, very low levels of residues of the at least one fungicide and / or at least one insecticide on the treated plants, plant parts, and harvested fruits and vegetables can be achieved.

[0345] If not otherwise specified, the treatment of plants or plant parts (including seeds and plants germinated from seeds), and harvested fruits and vegetables with the composition of the present invention is carried out directly or by acting on their environment, habitat or storage space, using conventional treatment methods, such as dipping, spraying, atomizing, irrigation, evaporation, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching), drip irrigation. Recombinant sporulating exine Bacillus cells, at least one other specific biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide can also be applied as a single formulation or a combined formulation by the ultra-low volume method, or the composition of the present invention can be injected into the soil (in-furrow) as a composition or as a single formulation.

[0346] The term "plant to be treated" encompasses every part of the plant, including its root system and material - such as soil or nutrient medium - which is within a radius of at least 10 cm, 20 cm, 30 cm around the main stem or trunk of the plant to be treated or at least 10 cm, 20 cm, 30 cm around the root system of the plant to be treated.

[0347] The amount of recombinant sporulating exine Bacillus cells used or utilized in combination with at least one other specific biological control agent described herein, optionally in the presence of at least one fungicide and / or at least one insecticide, depends on the final formulation and the size or species of the plant, plant part, harvested fruit and vegetable to be treated. Typically, the recombinant sporulating exine Bacillus cells used in the present invention are present in an amount of about 1% to about 80% (weight / weight), preferably about 1% to about 60% (weight / weight), more preferably about 10% to about 50% (weight / weight) in a single formulation or in a combined formulation with at least one other specific biological control agent described herein and optionally a fungicide and / or at least one insecticide.

[0348] Likewise, the amount of at least one other specific biological control agent disclosed herein used or utilized in combination with the recombinant sporulating exine Bacillus cells, optionally in the presence of at least one fungicide and / or at least one insecticide, depends on the final formulation and the size and species of the plants, plant parts, harvested fruits and vegetables to be treated. Typically, the other specific biological control agents described herein used in the present invention are present in an amount of about 0.1% to about 80% (weight / weight), preferably about 1% to about 60% (weight / weight), more preferably about 10% to about 50% (weight / weight) in their single formulations or in a combined formulation with the recombinant sporulating exine Bacillus cells and optionally at least one fungicide and / or at least one insecticide.

[0349] The application of the recombinant spore-producing exine Bacillus cells can be carried out in the form of a foliar spray, a soil treatment and / or a seed treatment / dressing. When used as a foliar treatment, in one embodiment, about 1 / 16 to about 5 gallons of whole broth are applied per acre. When used as a soil treatment, in one embodiment, about 1 to about 5 gallons of whole broth are applied per acre. When used for seed treatment, about 1 / 32 to about 1 / 4 gallon of whole fermentation broth is applied per acre. For seed treatment, the final application formulation contains at least 1×10 4 , at least 1×10 5 , at least 1×10 6 , 1×10 7 , at least 1×10 8 , at least 1×10 9 , at least 1×10 10 Colony forming units / g.

[0350] The recombinant sporulating exine Bacillus cells and at least one other specific biological control agent disclosed herein, and preferably also a fungicide and / or an insecticide, if present, are used or utilized in a synergistic weight ratio. The skilled person is able to find the synergistic weight ratio of the present invention by conventional methods. The skilled person will understand that these ratios refer to the ratio of the recombinant sporulating exine Bacillus cells described herein and at least one other specific biological control agent disclosed herein in a combined formulation and the calculated ratio of these two components when applied to the plant to be treated as a single formulation. Because the volumes and amounts of the recombinant sporulating exine Bacillus cells and at least one other specific biological control agent disclosed herein, respectively, in a single formulation are known to the skilled person, the skilled person is able to calculate the ratio by simple mathematical operations.

[0351] The ratio can be calculated based on the following values: the amount of at least one other specific biological control agent disclosed herein at the time point when the components of the combination of the present invention are applied to the plant or plant part, and the amount of recombinant spore-forming exine Bacillus cells shortly before (e.g., 48h, 24h, 12h, 6h, 2h, 1h) or at the time point when the components of the combination of the present invention are applied to the plant or plant part.

[0352] The recombinant spore-producing exine Bacillus cells and at least one other specific biocontrol agent disclosed herein can be applied to a plant or plant part at the same time or at different times, as long as both components are present on or in the plant after application. In the case where the recombinant spore-producing exine Bacillus cells and the other specific biocontrol agent disclosed herein are applied at different times and the other specific biocontrol agent disclosed herein is applied before the recombinant spore-producing exine Bacillus cells, the skilled artisan can determine the concentration of the other specific biocontrol agent disclosed herein on / in the plant at or shortly before the time point of application of the recombinant spore-producing exine Bacillus cells by chemical analysis methods known in the art. Vice versa, when the recombinant spore-producing exine Bacillus cells are applied to the plant first, the concentration of the recombinant spore-producing exine Bacillus cells can be determined at or shortly before the time point of application of the other specific biocontrol agent disclosed herein using tests known in the art.

[0353] In particular, in one embodiment, the synergistic weight ratio of the recombinant sporulating exine Bacillus cells (i.e., unformulated spore preparation) and at least one other specific biocontrol agent disclosed herein is in the range of 1:1000 to 1000:1; in the range of 1:500 to 500:1; in the range of 1:300 to 500:1. Additional ratios are between 20:1 and 1:20, such as 10:1, 5:1, or 2:1. In embodiments where the biocontrol agent is Bacillus-based, the weight-to-weight ratio should be applicable to unformulated Bacillus spore preparations. In one aspect of this embodiment, the spore preparations of both the recombinant sporulating exine Bacillus cells and the Bacillus-based biocontrol agent are spore preparations containing at least about 1×10 4 cfu / g, at least about 1×10 5 cfu / g, at least about 1×10 6 cfu / g, at least about 1×10 7 cfu / g, at least about 1×10 8 cfu / g, at least about 1×10 9 cfu / g, at least about 1×10 10 cfu / g and at least about 1×10 11 In another embodiment, the ratio of colony forming units of the recombinant exine-producing Bacillus cells and the specific Bacillus-based biocontrol agents described herein to colony forming units is in the range of 1:100,000 to 100,000:1, in the range of 1:10,000 to 10,000:1, in the range of 1:1000 to 10000:1, in the range of 1:1000 to 1000:1, in the range of 1:500 to 500:1, in the range of 1:100 to 100:1, in the range of 1:10 to 10:1, in the range of 1:5 to 5:1, in the range of 1:1.

[0354] In one embodiment of the invention, the concentration of the biological control agent based on the recombinant spore-forming exine of the Bacillus cereus family member after dispersal is at least 50 g / ha, such as 50-7500 g / ha, 50-2500 g / ha, 50-1500 g / ha; at least 250 g / ha (hectare), at least 500 g / ha or at least 800 g / ha.

[0355] The application rate of the composition to be utilized or used according to the invention may vary. A skilled person will be able to find a suitable application rate by routine experimentation.

[0356] In another aspect of the present invention, there is provided a seed treated with the composition described above.

[0357] It is known for a long time and is the theme of continuous improvement to prevent and treat insects, mites, nematodes and / or plant pathogens by treating the seeds of plants. However, there is a series of problems that cannot be solved in a satisfactory manner in seed treatment. Therefore, it is desirable to develop a method for protecting seeds and germinating plants, which removes or at least significantly reduces the demand for additional delivery of crop protection compositions during storage, after sowing or after plants emerge from the soil. In addition, it is desirable to optimize the amount of the active component used in this way, so that the most possible protection is provided for seeds and germinating plants to resist the invasion and attack of insects, mites, nematodes and / or plant pathogens, and the active component used can not cause damage to the plant itself. Especially, the method for treating seeds should also consider the inherent insecticidal and / or nematicidal properties of the transgenic plants that resist insects or tolerate insects, so that the best protection to seeds and germinating plants can be realized when the crop protection compositions are used at least.

[0358] Therefore, the present invention also relates in particular to a method for protecting seeds and germinating plants from attack by pests by treating the seeds with a recombinant sporulating exine-producing Bacillus cell as defined above and at least one other biological control agent selected from specific microorganisms disclosed herein and / or a mutant of a specific strain of a microorganism disclosed herein having all the identifying characteristics of the respective strains, and / or at least one metabolite produced by the respective strains that exhibits activity against insects, mites, nematodes and / or plant pathogens, and optionally at least one fungicide and / or optionally at least one insecticide of the present invention. The method of the present invention for protecting seeds and germinating plants from attack by pests encompasses a method for treating seeds simultaneously with a recombinant sporulating exine-producing Bacillus cell and at least one other specific biological control agent as described herein, and optionally at least one fungicide and / or optionally at least one insecticide in one operation. It also encompasses a method for treating seeds with a recombinant sporulating exine-producing Bacillus cell and at least one other specific biological control agent disclosed herein, and optionally at least one fungicide and / or at least one insecticide at different times.

[0359] Likewise, the invention relates to the use of a composition according to the invention for treating seed for protecting the seed and the resulting plant against insects, mites, nematodes and / or phytopathogens.

[0360] The present invention also relates to seeds that have been treated simultaneously with a recombinant sporulating exine-producing Bacillus cell and at least one other specific biological control agent as described herein, and optionally at least one fungicide and / or at least one insecticide. The present invention also relates to seeds that have been treated at different times with a recombinant sporulating exine-producing Bacillus cell and at least one other specific biological control agent as disclosed herein, and optionally at least one fungicide and / or at least one insecticide. In the case of seeds that have been treated at different times with a recombinant sporulating exine-producing Bacillus cell and at least one other specific biological control agent as disclosed herein, and optionally at least one fungicide and / or at least one insecticide, the individual active ingredients in the composition of the present invention may be present in different layers of the seed.

[0361] Furthermore, the present invention relates to seeds which, after being treated with the composition of the present invention, are subjected to a coating process to prevent dust from abrading the seeds.

[0362] One of the advantages of the present invention is that, due to the unique systemic properties of the compositions of the present invention, the treatment of seeds with these compositions provides protection not only for the seeds themselves but also for the plants derived from the seeds (after their emergence) against insects, mites, nematodes and / or phytopathogens. In this way, it is not necessary to treat the crop directly at the time of sowing or shortly thereafter.

[0363] Another advantage can be seen in the fact that, by treating seeds with the composition of the invention, germination and emergence of the treated seeds can be promoted.

[0364] It is likewise considered to be advantageous that the compositions according to the invention can also be used, in particular, in transgenic seeds.

[0365] It is also stated that the compositions of the invention can be used in combination with agents of signal transduction technology, with the result that, for example, colonization with symbionts is improved, such as enhanced rhizobia, mycorrhizae and / or endophytic bacteria, and / or nitrogen fixation is optimized.

[0366] The composition of the invention is suitable for protecting the seeds of any plant variety used in agriculture, greenhouses, forestry or gardening. More specifically, the seeds studied are seeds of cereals (e.g., wheat, barley, rye, oats and millet), corn, cotton, soybeans, rice, potatoes, sunflowers, coffee, tobacco, canola, rapeseed, beets (e.g., sugar beets and fodder beets), peanuts, vegetables (e.g., tomatoes, cucumbers, beans, Brassicas, onions and lettuce), fruit plants, lawns and ornamental plants. It is particularly important to treat the seeds of cereals (e.g., wheat, barley, rye and oats), corn, soybeans, cotton, canola, rapeseed and rice.

[0367] As mentioned above, it is particularly important to treat transgenic seeds with the composition of the invention. The seeds studied herein are seeds of plants that usually contain at least one heterologous gene that controls the expression of a polypeptide, in particular a polypeptide having insecticidal and / or nematicidal properties. These heterologous genes in transgenic seeds may originate from microorganisms, such as Bacillus, Rhizobium, Pseudomonas, Serratia, Trichoderma, Clavibacter, Glomus or Gliocladium. The present invention is particularly suitable for treating transgenic seeds containing at least one heterologous gene derived from a Bacillus species. Particularly preferably, the heterologous gene studied originates from Bacillus thuringiensis.

[0368] For the purpose of the present invention, the composition of the present invention is applied to the seed alone or in a suitable formulation. The seed is preferably treated in such a state that the stability of the seed is such that no damage occurs during the treatment process. In general, the seed can be treated at any time point between harvesting and sowing. Usually, the seed used is one that has been separated from the plant and the cob, shell, stem, pod, hair or pulp has been removed. Therefore, for example, seeds that have been harvested, purified and dried to a moisture content of less than 15% by weight can be used. Alternatively, for example, seeds that have been treated with water after drying and then dried can also be used.

[0369] In general, when treating seed, it must be ensured that the amount of the composition according to the invention and / or other additives applied to the seed is chosen so that germination of the seed is not adversely affected and / or so that the plant emerging from the seed is not damaged. This is especially true when using active ingredients that can exhibit phytotoxic effects at certain application rates.

[0370] The composition of the invention can be applied directly, in other words, without further components and without dilution. Generally, it is preferred to apply the composition to the seed in the form of a suitable formulation. Suitable formulations and methods for treating seeds are known to the skilled person and are described, for example, in the following documents: U.S. Patents 4,272,417A; 4,245,432A; 4,808,430A; 5,876,739A; U.S. Patent Publication 2003 / 0176428A1; WO 2002 / 080675 A1; WO 2002 / 028186 A2.

[0371] The combinations that can be used according to the invention can be converted into conventional seed dressing formulations, such as solutions, emulsions, suspensions, powders, foams, slurries and other seed coating compositions, and ULV formulations.

[0372] These preparations can be prepared in a known manner by mixing the compositions with conventional adjuvants, such as, for example, conventional fillers and solvents or diluents, colorants, wetting agents, dispersants, emulsifiers, defoamers, preservatives, secondary thickeners, stickers, gibberellins and water.

[0373] Colorants that may be present in the seed dressing formulations that can be used according to the invention include all colorants conventionally used for such purposes. In this context, not only pigments with low water solubility but also water-soluble dyes can be used. Examples include the colorants known by the names Rhodamine B, CI Pigment Red 112 and CI Solvent Red 1.

[0374] Wetting agents which may be present in the seed dressing formulations which can be used according to the invention include all substances which promote wetting and are customary in the formulation of active agrochemical ingredients. Alkylnaphthalenesulfonates, such as diisopropylnaphthalenesulfonate or diisobutylnaphthalenesulfonate, can preferably be used.

[0375] Dispersants and / or emulsifiers which may be present in the seed dressing formulations which can be used according to the invention include all nonionic, anionic or cationic dispersants which are conventionally used for the formulation of active agrochemical ingredients. It is preferred to use nonionic or anionic dispersants, or mixtures of nonionic or anionic dispersants. Suitable nonionic dispersants are in particular ethylene oxide-propylene oxide block polymers, alkylphenol polyglycol ethers and tristyrylphenol polyglycol ethers, and phosphated or sulfated derivatives thereof. Suitable anionic dispersants are in particular lignin sulfonates, polyacrylates and arylsulfonate-formaldehyde condensates.

[0376] Antifoams which may be present in the seed dressing formulations which can be used according to the invention include all foam inhibitors which are customary for the formulation of active agrochemical ingredients. Silicone antifoams and magnesium stearate can preferably be used.

[0377] Preservatives that may be present in the seed dressing formulations which can be used according to the invention include all substances which can be used for such purposes in agrochemical compositions. Examples include dichlorophenol and benzyl alcohol hemiformal.

[0378] Secondary thickeners which may be present in the seed dressing formulations which can be used according to the invention include all substances which can be used for such purposes in agrochemical compositions. Preferred secondary thickeners include cellulose derivatives, acrylic acid derivatives, xanthan gum, modified clays and highly dispersed silicas.

[0379] Stickers that may be present in the seed dressing formulations which can be used according to the invention include all customary binders which can be used for seed dressing products. Polyvinyl pyrrolidone, polyvinyl acetate, polyvinyl alcohol and methylcellulose (tylose) may be mentioned as being preferred.

[0380] Gibberellins which may be present in the seed dressing formulations which can be used according to the invention preferably include gibberellins A1, A3 (=gibberellic acid), A4 and A7; gibberellic acid is particularly preferably used. Gibberellins are known (cf. R. Wegler, "Chemie der Pflanzenschutz-und ", Volume 2, Springer Verlag, 1970, pp.401-412).

[0381] The seed dressing formulations that can be used according to the invention can be used directly or after dilution with water for the treatment of any seed of various types. Thus, the seeds of cereals such as wheat, barley, rye, oats and triticale, as well as the seeds of corn, rice, rape, peas, soybeans, cotton, sunflower and beet, or the seeds of any of a variety of different vegetables can be dressed with concentrates or preparations obtained therefrom by dilution with water. The seed dressing formulations that can be used according to the invention or their diluted preparations can also be used for dressing the seeds of transgenic plants. In this case, additional synergistic effects can occur in the interaction with the substances formed by expression.

[0382] Suitable mixing equipment for treating seed with the seed dressing formulations which can be used according to the invention or with formulations prepared therefrom by adding water includes all equipment customary for seed dressing. More particularly, seed dressing is carried out by placing the seeds in a mixer, adding the seed dressing formulation in the specific desired amount (as such or after prior dilution with water), and mixing until the formulation is evenly distributed over the seeds. A drying operation may then be carried out.

[0383] The application rate of the seed dressing formulations that can be used according to the invention can vary within a relatively wide range. The application rate is determined by the specific amount of the recombinant sporulating exine Bacillus cells and at least one other specific biological control agent described herein in the formulation and the seed. In the case of a composition, the application rate is generally in the range of 0.001-50 g / kg seed, preferably in the range of 0.01-15 g / kg seed.

[0384] Furthermore, the compositions according to the invention preferably have effective microbicidal activity and can be employed for controlling undesirable microorganisms, such as fungi and bacteria, in crop protection and in the protection of materials.

[0385] The invention furthermore relates to a method for controlling unwanted microorganisms, characterized in that a composition according to the invention is applied to the phytopathogenic fungi, phytopathogenic bacteria and / or their habitat.

[0386] Fungicides can be used for controlling phytopathogenic fungi in crop protection. The fungicides are characterized by a pronounced efficacy against a broad spectrum of phytopathogenic fungi, including soil-borne pathogens, in particular members of the classes Plasmodiophoromycetes, Peronosporomycetes (synonym: Oomycetes), Chytridiomycetes, Zygomycetes, Ascomycetes, Basidiomycetes and Deuteromycetes (synonym: Fungiimperfecti). Some fungicides are systemically active and can be used in plant protection as foliar, seed dressing or soil fungicides. Furthermore, they are suitable for combating fungi, in particular fungi which infest the wood or roots of plants.

[0387] Bactericides can be used in crop protection for controlling Pseudomonadaceae, Rhizobiaceae, Enterobacteriaceae, Corynebacteriaceae and Streptomycetaceae.

[0388] Non-limiting examples of pathogens of fungal diseases that can be treated according to the present invention include:

[0389] Diseases caused by powdery mildew pathogens, such as Blumeria species, such as Blumeria graminis; Podosphaera species, such as Podosphaera leucotricha; Sphaerotheca species, such as Sphaerotheca fuliginea; Uncinula species, such as Uncinulanecator;

[0390] Diseases caused by rust pathogens, such as Gymnosporangium species, such as Gymnosporangium sabinae; Hemileia species, such as Hemileia vastatrix; Phakopsora species, such as Phakopsora pachyrhizi and Phakopsora meibomiae; Puccinia species, such as Puccinia recondite, P. triticina, P. graminis or P. striiformis or P. hordei; Uromyces species, such as Uromyces appendiculatus;

[0391] Diseases caused by pathogens of the class Oomycetes, such as species of Albugo, for example Albugo candida; species of Bremia, for example Bremia alactae; species of Peronospora, for example Peronospora pisi, P. parasitica or P. brassicae; species of Phytophthora, for example Phytophthora infestans; species of Plasmopara, for example Plasmopara aviticola; species of Pseudoperonospora, for example Pseudoperonospora humuli or Pseudoperonospora spp. cubensis); Pythium species, such as Pythium ultimum;

[0392] Leaf spot and leaf wilt diseases caused, for example, by the following pathogens: Alternaria species, such as Alternaria solani; Cercospora species, such as the pathogen Cercospora beticola; Cladiosporium species, such as Cladiosporium cucumerinum; Cochliobolus species, such as Cochliobolus sativus (conidial form: Drechslera, synonym: Helminthosporium), Cochliobolus miyabeanus; Colletotrichum species, such as Colletotrichum lindemuthanium; Cycloconium species, such as Cycloconium oleaginum; Diaporthe species, such as Diaporthecitri; Elsinoe species, such as Elsinoe fawcettii; Gloeosporium species, such as Gloeosporium laeticolor; Glomerella species, such as Glomerella cingulata; Guignardia species, such as Guignardia bidwelli; Leptosphaeria species, such as Leptosphaeria maculans, Leptosphaeria truncatula, and Leptosphaeria spp. nodorum; Magnaporthe species, such as Magnaporthe grisea; Microdochium species, such as Microdochium nivale; Mycosphaerella species, such as Mycosphaerella graminicola, M. arachidicola and M. fijiensis.fijiensis; Phaeosphaeria species, such as Phaeosphaerianodorum; Pyrenophora species, such as Pyrenophora teres and Pyrenophora tritici repentis; Ramularia species, such as Ramularia collo-cygni and Ramularia areola; Rhynchosporium species, such as Rhynchosporium secalis; Septoria species, such as Septoria apii and Septoria lycopersii; Typhula species, such as Typhula incarnata); Venturia species, such as Venturia inaequalis;

[0393] Diseases of roots and stems caused, for example, by the following pathogens: Corticium species, for example Corticium graminearum; Fusarium species, for example Fusarium oxysporum; Gaeumannomyces species, for example Gaeumannomyces graminis; Rhizoctonia species, such as, for example Rhizoctonia solani; Sarocladium diseases, for example caused by Sarocladium oryzae; Sclerotium diseases, for example caused by Sclerotium oryzae; Tapesia species, for example Tapesia acuformis; Thielaviopsis species, for example Thielaviopsis basicola;

[0394] Diseases of spadix and panicles (including cobs) caused by, for example, Alternaria species, such as Alternaria spp.; Aspergillus species, such as Aspergillus flavus; Cladosporium species, such as Cladosporium cladosporioides; Claviceps species, such as Claviceps purpurea; Fusarium species, such as Fusarium culmorum; Gibberella species, such as Gibberella zeae; Monographella species, such as Monographella spp. nivalis); Septoria species, such as Septoria nodorum;

[0395] Diseases caused by smut fungi, such as Sphacelotheca species, such as Sphacelotheca reiliana; Tilletia species, such as Tilletia caries, T.controversa; Urocystis species, such as Urocystis occulta; Ustilago species, such as Ustilago nuda, U.nuda tritici;

[0396] Fruit rot caused by, for example, the following pathogens: Aspergillus species, such as Aspergillus flavus; Botrytis species, such as Botrytis cinerea; Penicillium species, such as Penicillium expansum, P. purpurogenum; Sclerotinia species, such as Sclerotiniasclerotiorum; Verticilium species, such as Verticilium alboatrum;

[0397] Seed-borne and soil-borne spoilage, mildew, wilt, rot and damping-off diseases caused, for example, by the following pathogens: Alternaria species, for example, Alternaria brassicicola; Aphanomyces species, for example, Aphanomyces euteiches; Ascochyta species, for example, Ascochyta lentis; Aspergillus species, for example, Aspergillus flavus; Cladosporium species, for example, Cladosporium herbarum; Cochliobolus species, for example, Cochliobolus graminis. sativus); (conidial forms: Drechslera, Bipolaris, synonym: Helminthosporium); Colletotrichum species, for example caused by Colletotrichum coccodes; Fusarium species, for example caused by Fusarium culmorum; Gibberella species, for example caused by Gibberella zeae; Macrophomina species, for example caused by Macrophomina phaseolina; Monographella species, for example caused by Monographella nivalis; Penicillium species, for example caused by Penicillium expansum. expansum; Phoma species, such as caused by the pathogen Phoma lingam; Phomopsis species, such as caused by Phomopsis sojae; Phytophthora species, such as caused by Phytophthora cactorum; Pyrenophora species, such as caused by Pyrenophora graminea; Pyricularia species, such as caused by Pyricularia oryzae;Pythium species, for example caused by Pythium ultimum; Rhizoctonia species, for example caused by Rhizoctonia solani; Rhizopus species, for example caused by Rhizopus oryzae; Sclerotium species, for example caused by Sclerotium rolfsii; Septoria species, for example caused by Septoria nodorum; Typhula species, for example caused by Typhula incarnata; Verticillium species, for example caused by Verticillium dahliae;

[0398] Cancer, gall and witches' broom diseases caused by pathogens such as Nectria species, such as Nectria galligena;

[0399] Wilt diseases caused by pathogens such as Monilinia species, such as Monilinia laxa;

[0400] Leaf blister or leaf roll diseases caused by pathogens such as Exobasidium species, such as Exobasidium vexans;

[0401] Taphrina species, for example Taphrina deformans;

[0402] Degenerative diseases of woody plants: Esca diseases caused by, for example, Phaemoniella clamydospora, Phaeoacremonium aleophilium and Fomitiporia mediterranea; Eutypa dyeback caused by, for example, Eutypa lata; Ganoderma diseases caused by, for example, Ganoderma boninense; Rigidoporus diseases caused by, for example, Rigidoporus lignosus;

[0403] Diseases of flowers and seeds caused by pathogens such as: Botrytis species, for example Botrytis cinerea;

[0404] Plant tuber diseases caused by pathogens such as Rhizoctonia species, such as Rhizoctonia solani; Helminthosporium species, such as Helminthosporium solani;

[0405] Clubroot diseases caused by pathogens such as: Plasmodiophora species, such as Plamodiophora brassicae;

[0406] Diseases caused by bacterial pathogens, such as Xanthomonas species, for example Xanthomonas campestris pv. oryzae; Pseudomonas species, for example Pseudomonas syringa pv. lachrymans; Erwinia species, for example Erwinia amylovora.

[0407] Preferably, the following soybean diseases can be controlled:

[0408] Fungal diseases on leaves, stems, pods and seeds caused by pathogens such as Alternaria leaf spot (Alternaria spec. atrans tenuissima), anthracnose (Colletotrichum gloeosporoides dematium var. truncatum), brown spot (Septoria glycines), Cercospora leaf spot and blight (Cercospora kikuchii), Choanephora leaf blight (Choanephora infundibulifera trispora (Syn.)), dactuliophora leaf spot (Dactuliophora glycines), downy mildew (Peronospora manshurica), drechslera wilt (Drechslera kikuchii), and spore blight. glycini), frogeye leaf spot (Cercospora sojina), leptosphaerulina leaf spot (Leptosphaerulina trifolii), phyllostica leaf spot (Phyllosticta sojaecola), pod and stem blight (Phomopsis sojae); powdery mildew (Microsphaera diffusa), pyrenochaeta leaf spot (Pyrenochaeta glycines), Rhizoctonia aerial parts, leaf blight and damping-off (Rhizoctonia solani), rust (Phakopsora pachyrhizi, Phakopsora meibomiae), scab (Sphaceloma glycines), stemphylium leaf blight (Stemphylium botryosum), target spot (Corynespora cassiicola).

[0409] Fungal diseases of the roots and base of the stems caused by pathogens such as black root rot (Calonectria crotalariae), charcoal rot (Macrophomina phaseolina), Fusarium blight or wilt, root rot and pod and crown rot ((Fusarium oxysporum, Fusarium orthoceras, Fusarium semitectum, Fusarium equiseti), mycoleptodiscus root rot (Mycoleptodiscus terrestris), neocosmospora (Neocosmopspora vasinfecta), pod and stem blight (Diaporthe phaseolorum), stem canker (Diaporthe phaseolorumvar.caulivora), Phytophthora rot (Phytophthora megasperma), brown stem rot (Phialophora gregata), Pythium rot (Pythium aphanidermatum, Pythium irregulare, Pythium debaryanum, Pythium myriotylum, Pythium ultimum), Rhizoctonia root rot, stem rot and damping-off (Rhizoctonia solani), Sclerotinia stem rot (Sclerotinia sclerotiorum), Sclerotinia white rot (Sclerotinia rolfsii), Thielaviopsis root rot (Thielaviopsis basicola).

[0410] The compositions of the invention can be used for curative or protective / preventive control of phytopathogenic fungi. Therefore, the present invention also relates to a curative and protective method for controlling phytopathogenic fungi by using the compositions of the invention, wherein the compositions of the invention are applied to seeds, plants or plant parts, fruits or soil in which the plants grow.

[0411] The fact that the compositions are well tolerated by plants at the concentrations required for controlling plant diseases makes it possible to treat aerial parts of plants, propagation rhizomes and seeds, and also the soil.

[0412] All plants and plant parts can be processed according to the present invention.Plant means all plants and plant populations, such as needed and unwanted wild plants, cultivars and plant variants (whether protected by plant variety or plant breeder's rights).Cultivars and plant variants can be plants obtained by conventional breeding and breeding methods, and the conventional breeding and breeding methods can be assisted or supplemented by one or more biotechnology methods, such as by using double haploid, protoplast fusion, random and directed mutagenesis, molecules or genetic markers, or by bioengineering and genetic engineering methods.Plant parts mean all above-ground and underground parts and organs of plants, such as buds, leaves, flowers and roots, and accordingly list such as leaves, needles, stems, branches, flowers, fruiting bodies, fruits and seeds and roots, bulbs and rhizomes.Crops and asexual and sexual propagation materials, such as cuttings, bulbs, rhizomes, runners and seeds also belong to plant parts.

[0413] When having good plant tolerance, the composition of the invention has favorable homeothermic animal toxicity and can be fully tolerated by the environment, and is suitable for protecting plants and plant organs, for increasing harvest yield, and improving the quality of harvested materials. It is preferably used as a crop protection composition. It is active against generally sensitive and resistant species and is active against all or some developmental stages.

[0414] Plants that can be treated according to the present invention include the following major crop plants: corn, soybean, alfalfa, cotton, sunflower, Brassica oilseeds (e.g. Brassica napus (e.g. canola, rapeseed), Brassica rapa, B. juncea (e.g. mustard) and Brassica carinata), Arecaceae sp. (e.g. oil palm, coconut), rice, wheat, sugar beet, sugar cane, oats, rye, barley, millet and sorghum, triticale, flax, nuts, grapes and vines and various fruits and vegetables from various plant taxa, such as Rosaceae sp. sp.) (e.g., pome fruits (e.g., apples and pears), as well as stone fruits (e.g., apricots, cherries, almonds, plums and peaches), and berry fruits (e.g., strawberries, raspberries, red and blackcurrants and gooseberries)), Ribesioidae sp., Juglandaceae sp., Betulaceae sp., Anacardiaceae sp., Fagaceae sp., Moraceae sp., Oleaceae sp. (e.g., olive trees), Actinidaceae sp., Lauraceae sp. (e.g., avocado, cinnamon, camphor), Musaceae sp. (e.g., banana trees and banana plantations), Rubiaceae sp. (e.g., coffee), Theaceae sp. sp. (e.g., tea), Sterculiceae sp., Rutaceae sp. (e.g., lemon, orange, tangerine, and grapefruit); Solanaceae sp. (e.g., tomato, potato, pepper, chili, eggplant, tobacco), Liliaceae sp., Compositae sp. (e.g., lettuce, artichoke, and chicory - including root chicory, endive, or common chicory), Umbelliferae sp. (e.g., carrot, parsley, celery, and celery root), Cucurbitaceae sp. (e.g., cucumber - including pickled cucumbers, zucchini, watermelon, gourd, and papaya), Alliaceae sp. (e.g., leek, onion), Cruciferae sp.) (e.g. white cabbage, red cabbage, broccoli, cauliflower, Brussels sprouts, pakchoi, kohlrabi, radish, horseradish, watercress and Chinese cabbage), Leguminosae sp. (e.g. peanuts, peas, lentils and beans - such as sword beans and broad beans), Chenopodiaceae sp. (e.g. chard, fodder beets, spinach, beetroot), Linaceae sp. (e.g. cannabis), Cannabeacea sp. (e.g. Indian hemp), Malvaceae sp. (e.g. okra, cocoa), Papaveraceae (e.g. poppy), Asparagaceae (e.g. asparagus); useful and ornamental plants for horticulture and forestry, including lawns, lawns, pastures and Stevia rebaudiana; and in each case, genetically modified versions of each of these plants.

[0415] Depending on the plant species or plant cultivars, their location and growth conditions (soils, climate, vegetation period, nutrition), the use or employment of the compositions according to the invention may also result in superadditive ("synergistic") effects. Thus, for example, by using or employing the compositions according to the invention in the treatment according to the invention, the following effects beyond what is actually expected may be achieved: reduced application rates and / or broadened activity spectrum and / or increased activity, improved plant growth, increased tolerance to high or low temperatures, increased tolerance to drought or to water or soil salinity, improved flowering performance, easier harvesting, accelerated ripening, higher harvest yields, larger fruits, taller plants, greener leaves, earlier flowering, higher quality of the harvested product and / or its nutritional value, higher sugar concentration in the fruit, better storage stability and / or better processability of the harvested product.

[0416] At certain application rates of the composition of the present invention, a strengthening effect may also be present in the plant in the treatment of the present invention. The plant's defense system is mobilized to resist unwanted phytopathogenic fungi and / or microorganisms and / or viruses. In this article, plant strengthening (resistance inducing) substances are understood to mean those substances or combinations of substances that can stimulate the plant's defense system in such a way that when subsequently inoculated with unwanted phytopathogenic fungi and / or microorganisms and / or viruses, the treated plants show a great degree of resistance to these phytopathogenic fungi and / or microorganisms and / or viruses. Therefore, by using or adopting the composition of the present invention in the treatment of the present invention, plants can be protected from the above-mentioned pathogens within a certain period of time after the treatment. After the plant is treated with the active compound, the time period for achieving the protective effect generally lasts 1-10 days, preferably 1-7 days.

[0417] Likewise preferably, the plants and plant cultivars treated according to the invention are resistant to one or more biotic stresses, ie the plants exhibit an improved defence against animal and microbial pests (for example against nematodes, insects, mites, phytopathogenic fungi, bacteria, viruses and / or viroids).

[0418] Plants and plant cultivars that may also be treated according to the invention are those that are resistant to one or more abiotic stresses, i.e. those that have shown increased plant health with respect to stress tolerance. Abiotic stress conditions may include, for example, drought, low temperature exposure, heat exposure, osmotic stress, waterlogging, increased soil salinity, enhanced mineral exposure, ozone exposure, high light exposure, limited nitrogen nutrient availability, limited phosphorus nutrient availability, shade avoidance. Preferably, treatment of these plants and cultivars with the compositions of the invention additionally increases overall plant health (see above).

[0419] Plants and plant cultivars that may also be treated according to the invention are those plants characterized by enhanced yield characteristics, i.e. those plants that have shown increased plant health for this characteristic. The increased yield of the plants may result, for example, from improved plant physiology, growth and development, such as water use efficiency, water retention efficiency, improved nitrogen utilization, enhanced carbon assimilation, improved photosynthesis, increased germination rate and accelerated maturity.

[0420] Yield may also be affected by improved plant architecture (under stress and non-stress conditions), including but not limited to: early flowering, flowering control for hybrid seed production, seedling vigor, plant size, number of internodes and internode distance, root growth, seed size, fruit size, pod size, number of pods or ears, number of seeds per pod or ear, seed quality, improved seed fullness, reduced seed dispersal, reduced pod dehiscence, and lodging resistance. Other yield characteristics include seed composition, such as carbohydrate content, protein content, oil content and composition, nutritional value, reduction in anti-nutritional compounds, improved processability and better storage stability. Preferably, treatment of these plants and cultivars with the compositions of the present invention additionally increases overall plant health (see above).

[0421] Plants that can be processed according to the present invention are hybrid plants that have expressed heterosis or hybrid vigor characteristics, which usually result in higher yields, vigor, health and better resistance to biotic and abiotic stress factors. Such plants are usually made by hybridizing a selfing male sterile parental line (female parent) with another selfing male fertile parental line (male parent). Hybrid seeds are usually harvested from male sterile plants and sold to growers. Male sterile plants can sometimes (for example in corn) be made by emasculation (i.e. mechanical removal of male reproductive organs or male flowers), but more generally, male sterility is caused by genetic determinants in the plant genome. In this case, particularly when seed is a desired product to be harvested from hybrid plants, it is usually useful to ensure that the complete recovery of male fertility (fertility) in hybrid plants. This can be accomplished by ensuring that the male parent has a suitable fertility recovery gene that can restore male fertility in hybrid plants containing the genetic determinants responsible for male sterility. The genetic determinants responsible for male sterility can be located in the cytoplasm. Examples of cytoplasmic male sterility (CMS) are described, for example, in Brassica species. However, the genetic determinants responsible for male sterility can also be located in the nuclear genome. Male sterile plants can also be obtained by plant biotechnology methods such as genetic engineering. A particularly useful method for obtaining male sterile plants is described in WO 89 / 10396, in which, for example, ribonucleases such as barnase are selectively expressed in the tapetum cells in the stamens. Fertility can subsequently be restored by expressing ribonuclease inhibitors such as barstar in the tapetum cells.

[0422] Plants or plant cultivars (obtained by plant biotechnology methods such as genetic engineering) which may be treated according to the invention are herbicide-tolerant plants, i.e. plants made tolerant to one or more given herbicides. These plants can be obtained by genetic transformation or by selection of plants containing mutations that impart such herbicide tolerance.

[0423] The following non-limiting examples are provided to further illustrate the present invention.

[0424] Example

[0425] Example 1: Formula for the efficacy of a combination of multiple active ingredients

[0426] A synergistic effect of active ingredients exists when the activity of the combination of active ingredients exceeds the sum of the activities of the active ingredients when applied separately. The expected activity of a given combination of two active ingredients can be calculated as follows (reference Colby, SR, "Calculating Synergistic and Antagonistic Responses of Herbicide Combinations," Weeds 1967, 15, 20-22):

[0427] if

[0428] X is the efficacy of active ingredient A at an application rate of m ppm (or g / ha),

[0429] Y is the efficacy of active ingredient B when applied at an application rate of n ppm (or g / ha),

[0430] E is the efficacy of active ingredients A and B when applied at application rates of m and n ppm (or g / ha), respectively,

[0431] but

[0432] If the actual activity exceeds the calculated value, the activity of the combination is superadditive, i.e., there is a synergistic effect. In this case, the actual observed efficacy must be greater than the value of the expected efficacy (E) calculated by the above formula.

[0433] For example, the formula and analysis can be applied to the evaluation of plant growth promotion. Such determinations are evaluated a few days after application to the plant. 100% refers to the plant weight corresponding to the untreated control plant. Efficacy refers to the additional % of the plant weight compared to the plant weight of the untreated control in this case. For example, a treatment that results in a plant weight of 120% compared to the untreated control plant will have an efficacy of 20%. If the plant growth promoting effect of the combination (i.e., the observed efficacy of the % bud weight of the plant treated with the combination) exceeds the calculated value, the activity of the combination is superadditive, i.e., there is a synergistic effect.

[0434] The formula and analysis can also be used to assess synergy in disease control assays. The degree of efficacy is expressed in %. 0% means an efficacy that corresponds to the control, while an efficacy of 100% means that no disease is observed.

[0435] If the actual insecticidal or fungicidal activity exceeds the calculated value, then the activity of the combination is superadditive, i.e. there is a synergistic effect. In this case, the actual observed efficacy must be greater than the value of the expected efficacy (E) calculated by the above formula.

[0436] Another method for demonstrating synergistic effects is the method of Tammes (see "Isoboles, A Graphic Representation of Synergismin Pesticides," Neth. J. Plant Path., 1964, 70, 73-80).

[0437] Example 2: Plant growth promotion using Bacillus subtilis QST713 and recombinant Bacillus thuringiensis cells expressing phospholipase C

[0438] Experiments were conducted to analyze the efficacy of a combination of a product based on Bacillus subtilis QST713 and a fermentation product of a recombinant Bacillus thuringiensis cell expressing phospholipase C ("BEPC"). Corn seeds were planted in a sterile mixture of synthetic medium and sand in small three-inch square pots on a light stand in a plant growth room at 25-28°C and 50% humidity and grown for approximately 14 days. Two seeds were planted in each pot. At planting, the growth medium in each pot was saturated with the following treatments. After 14 days, the total plant biomass of the plants was measured. In some experiments, roots were analyzed using a WinRhizo Root scanner. In all tables in these examples, UTC refers to the untreated control. "Calculated" refers to the expected effect calculated using the Colby equation above, and "efficacy" refers to the actual effect observed.

[0439] Will The ASO products were diluted in water (1% and 5% v / v) and the diluted solutions were used to saturate the growth medium. ASO application rate refers to the product The amount of Bacillus subtilis QST713 (i.e., spore preparation) contained in ASO is 1.34%. The minimum spore concentration of the formulated product is 1×10 9 cfu / g.

[0440] A recombinant Bacillus cereus family member (Bacillus thuringiensis BT013A) (BEPC) expressing phospholipase C on its spore exine was produced in the following manner. To produce a plasmid for expressing fusion proteins in Bacillus cereus family members, a PCR fragment encoding the BclA promoter (SEQ ID NO: 85), a methionine start codon, and amino acids 20-35 of BclA (SEQ ID NO: 1), followed by a 6-alanine linker sequence fused in frame to Bacillus thuringiensis BT013A phospholipase C (SEQ ID NO: 108) was produced. These PCR fragments were digested with XhoI and ligated to the SalI site of the pSUPER plasmid to produce the plasmid pSUPER-BclA20-35-phospholipase. The pSUPER plasmid was produced by fusing the pUC57 plasmid (containing an ampicillin resistance cassette) with the pBC16-1 plasmid (containing tetracycline resistance) from Bacillus. This 5.5 kbp plasmid can replicate in E. coli and Bacillus species. The pSUPER-BclA20-35-phospholipase plasmid was transformed and propagated into a dam methylase negative E. coli strain and finally transformed into Bacillus thuringiensis BT013A.

[0441] To obtain a full broth culture of BEPC, a 15 mL Erlenmeyer flask containing brain heart infusion medium (BHI) was inoculated with BEPC and grown for 7-8 hours at about 30°C on a shaker setting of 300 rpm. The next day, a 250 μl aliquot from each flask was inoculated into a 250 mL flask containing 50 mL of yeast extract-based medium and grown at about 30°C. After about 2 days of incubation, when sporulation was at least 95% complete, the culture broth was collected and colony forming units were counted. The fermentation broth was diluted to 5% in 50 mL of water and the following colony forming units were applied to each pot.

[0442] Table 3

[0443]

[0444]

[0445] The experiment was repeated as above, but using 1% dilution of ASO product. The results are shown in Table 4 below.

[0446] Table 4

[0447]

[0448] The results of root volume measurements performed using the WinRhizo root scanner are shown in Table 5.

[0449] Table 5

[0450]

[0451] The results show that when the combination Super-additive plant yield effects of ASO and BEPC.

[0452] Example 3: Plant growth promotion using Bacillus subtilis QST713 and recombinant Bacillus thuringiensis cells expressing endoglucanase

[0453] Experiments similar to those of Example 2 were performed using recombinant Bacillus thuringiensis cells expressing endoglucanase (SEQ ID NO: 107) (referred to in these examples as BEE). Whole broth cultures of BEE were generated as described above, except that endoglucanase (SEQ ID NO: 107) was used instead of phosphatidyl lipase. The effects of combinations of ASOs on plant yield are shown in the table below.

[0454] Table 6

[0455]

[0456] Table 7

[0457]

[0458]

[0459] Table 8

[0460]

[0461] The above results indicate a super-additive effect on plant yield when Bacillus subtilis QST713 and BEE are applied in combination.

[0462] Example 4: Plant growth promotion using Bacillus firmus strain 1-1582 and recombinant Bacillus thuringiensis cells

[0463] Corn seeds were grown in loamy sand in a greenhouse at 20° C. and 70% humidity for about 11 days. About 11 days after the treatment, seedlings were cut on the soil and the fresh weight was determined.

[0464] Recombinant Bacillus thuringiensis cells expressing the endoglucanase encoded by SEQ ID NO: 107 or the phospholipase C encoded by SEQ ID NO: 108 and prepared as described above are administered at about 50 μg / kernel. Bacillus firmus strain 1-1582 will also be administered at about 50 μg / kernel.

[0465] It is expected that the % shoot weight of corn plants treated with the combination of recombinant Bacillus thuringiensis and Bacillus firmus strain 1-1582 will exceed the calculated value based on the % shoot weight of corn plants treated with the two active ingredients alone, ie, a synergistic effect is observed.

[0466] Bacillus subtilis AQ713 was deposited on March 7, 1997 under accession number B-21661 at the National Agricultural Research Service (NRRL), 1815 North University Street, Peoria, Illinois 61604, USA.

Claims

1. A composition comprising a synergistically effective amount of the following substances: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide; and (ii) a targeting sequence, an exosporium protein or an exosporium protein fragment; and b) at least one biological control agent selected from the group consisting of a lipopeptide-producing strain of Bacillus subtilis, a lipopeptide-producing strain of Bacillus amyloliquefaciens, a strain of Bacillus firmus, and a strain of Bacillus pumilus.

2. The composition of claim 1, wherein the at least one plant growth stimulating protein or peptide is selected from enzymes involved in the production or activation of plant growth stimulating compounds and enzymes that degrade or modify bacteria, fungi or plant nutrient sources.

3. The composition of claim 1, wherein the exine-forming Bacillus cell is a cell of a member of the Bacillus Cereus family.

4. The composition of claim 3, wherein the Bacillus cereus family member is selected from the group consisting of Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudmycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis, and combinations thereof.

5. The composition of any one of claims 1 to 4, wherein the targeting sequence or spore wall protein comprises: an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; A targeting sequence comprising SEQ ID NO: 1; or A spore wall protein comprising an amino acid sequence at least 85% identical to SEQ ID NO:

2.

6. The composition of any one of claims 2 to 5, wherein the enzyme involved in the production or activation of a plant growth stimulating compound is selected from the group consisting of 3-hydroxybutanone reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase, tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side chain oxidase, nitrile hydrolase, hydrolase), nitrilase, peptidase, protease, adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5' ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyl transferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, deacetylation of chitosanase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylate deaminase, and enzymes involved in the production of nodulation factors.

7. The composition of claim 6, wherein the enzyme involved in the production or activation of the plant growth stimulating compound is chitosanase.

8. The composition of claim 7, wherein the fusion protein comprises SEQ ID NO:

109.

9. The composition of any one of claims 2 to 5, wherein the enzyme that degrades or modifies a bacterial, fungal or plant nutrient source is selected from the group consisting of cellulases, lipases, lignin oxidases, proteases, glycoside hydrolases, phosphatases, nitrogenases, nucleases, amidases, nitrate reductases, nitrite reductases, amylases, ammonia oxidases, ligninases, glucosidases, phospholipases, phytases, pectinases, glucanases, sulfatases, ureases, xylanases and siderophores.

10. The composition of claim 9, wherein the enzyme is a cellulase selected from the group consisting of endocellulase, exocellulase and beta-glucosidase.

11. The composition of claim 10, wherein the fusion protein comprises a Bacillus subtilis endoglucanase.

12. The composition of claim 11, wherein the fusion protein comprises SEQ ID NO:

107.

13. The composition of claim 12, wherein the recombinant Bacillus cell is derived from Bacillus thuringiensis BT013A.

14. The composition of claim 9, wherein the enzyme is a phospholipase.

15. The composition of claim 14, wherein the fusion protein comprises SEQ ID NO:

108.

16. The composition of any one of claims 1 to 15, wherein the fusion protein is expressed under the control of a native sporulation promoter of the targeting sequence of the fusion protein, the exosporium protein or the exosporium protein fragment.

17. The composition of any one of claims 1 to 16, wherein the fusion protein is expressed under the control of a high-expressing sporulation promoter.

18. The composition of claim 17, wherein the high expression sporulation promoter comprises a sigma-K sporulation-specific polymerase promoter sequence.

19. The composition of any one of claims 16 to 18, wherein the sporulation promoter comprises a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 85-103.

20. The composition of any one of claims 1 to 19, wherein the at least one biological control agent is a lipopeptide-producing Bacillus subtilis strain or a lipopeptide-producing Bacillus amyloliquefaciens strain.

21. The composition of claim 20, wherein the Bacillus subtilis strain or Bacillus amyloliquefaciens strain is Bacillus subtilis QST713, Bacillus subtilis MBI600, Bacillus amyloliquefaciens D747, Bacillus amyloliquefaciens FZB42, Bacillus subtilis variant Bacillus amyloliquefaciens FZB24, or a mutant thereof having all of the identifying characteristics of the respective strain.

22. The composition of any one of claims 1 to 19, wherein the at least one biological control agent is Bacillus firmus strain 1-1582.

23. Seed treated with a composition according to any one of claims 1 to 22.

24. Use of a composition according to any one of claims 1 to 23 for enhancing plant growth and / or promoting plant health.

25. The use according to claim 24 for treating conventional or transgenic plants or their seeds.

26. A method of treating plants, plant parts or the area surrounding plants to enhance plant growth and / or promote plant health comprising the step of simultaneously or sequentially applying synergistically effective amounts of: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide; and (ii) a targeting sequence, an exosporium protein or an exosporium protein fragment; and b) at least one biological control agent selected from the group consisting of a lipopeptide-producing Bacillus subtilis strain, a lipopeptide-producing Bacillus amyloliquefaciens strain, a Bacillus firmus strain, and a Bacillus pumilus strain.

27. The method of claim 26, wherein the targeting sequence or spore exosporium protein comprises: an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; A targeting sequence comprising SEQ ID NO: 1; or A spore wall protein comprising an amino acid sequence at least 85% identical to SEQ ID NO:

2.

28. A composition comprising a synergistically effective amount of: a) a recombinant exosporium-producing Bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide; and (ii) a targeting sequence, an exosporium protein or an exosporium protein fragment; and b) at least one biological control agent selected from any of the specific biological control agents disclosed in paragraphs [00183] to [00226] herein.

29. The composition of claim 28, wherein the fusion protein comprises an endoglucanase or a phospholipase; the targeting sequence is an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; and the recombinant Bacillus cell is derived from Bacillus thuringiensis or Bacillus mycoides.

30. The composition of claim 29, wherein the fusion protein comprises SEQ ID NO: 107; the targeting sequence comprises amino acids 20-35 of SEQ ID NO: 1; and the Bacillus thuringiensis is Bacillus thuringiensis BT013A.

31. The composition of claim 29, wherein the fusion protein comprises SEQ ID NO: 108; the targeting sequence comprises amino acids 20-35 of SEQ ID NO: 1; and the Bacillus thuringiensis is Bacillus thuringiensis BT013A.

Images