Capsid rearranged adeno-associated virus vector and its use

Abstract

The present invention provides a capsid rearrangement adeno-associated virus vector and its use. Specifically, the present invention provides a capsid rearrangement serotype based on the existing AAV. The rearrangement serotype of the present invention has higher toxin production, high solid rate, low immunogenicity, and high transduction activity in human retinal tissue. The present invention also provides a recombinant virus vector containing the rearrangement AAV capsid and its use in disease treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a capsid rearranged adeno-associated virus vector and its use. Background Art

[0002] Prior art CN107012171A describes an AAV2 variant, AAV2.7m8, which is an improved adeno-associated virus (AAV) vector that exhibits stronger retinal cell infection activity after intravitreal injection than wild-type AAV2, but also faces a series of shortcomings that have not yet been overcome.

[0003] For example, when administered intravitrealally, AAV2.7m8 cannot efficiently transduce the outer nuclear layer of the retina due to its limited ability to penetrate the inner limiting membrane of the retina, which to some extent limits the therapeutic effect of AAV2.7m8 in diseases induced by photoreceptor lesions. Therefore, even though AAV2.7m8 shows stronger infectivity to retinal cells compared with wild-type AAV, the number of viruses that can enter the inner and outer nuclear layers is still small.

[0004] Therefore, there is a need in this field to develop a new type of AAV vector through directed evolution technology to improve the infection activity of AAV virus in the outer retinal tissue. Summary of the invention

[0005] The purpose of the present invention is to provide a novel AAV vector with high retinal infection activity.

[0006] In a first aspect of the present invention, a reassortant adeno-associated virus (AAV) capsid protein is provided, wherein:

[0007] (1) The N-terminal domain of the rearranged AAV capsid protein VP1 is a fragment from the Anc80L65 serotype, and the C-terminal domain is a fragment from one or more other AAV serotypes; or

[0008] (2) The C-terminal domain of the rearranged AAV capsid protein VP1 is a fragment from the Anc80L65 serotype, and the N-terminal domain is a fragment from one or more other AAV serotypes; or

[0009] (3) The N-terminal domain and C-terminal domain of the rearranged AAV capsid protein VP1 are fragments from the Anc80L65 serotype, and the middle domain is a fragment from one or more other AAV serotypes.

[0010] In another preferred embodiment, the reassortant adeno-associated virus (AAV) capsid protein is used for intraocular delivery of adeno-associated virus, preferably for intravitreal injection delivery of adeno-associated virus.

[0011] In another preferred embodiment, the rearranged AAV capsid protein VP1 has a structure as shown in the following formula I:

[0012] D1-D2-D3 (I),

[0013] Among them, D1 is absent or a fragment from VP1 of Anc80L65 serotype;

[0014] D2 is a segment from VP1 of one or more other AAV serotypes;

[0015] D3 is absent or a fragment from VP1 of the Anc80L65 serotype;

[0016] Furthermore, D1 and D3 are not both zero.

[0017] In another preferred embodiment, D1 is derived from the N-terminal amino acid sequence of Anc80L65 serotype VP1; preferably, the amino acid sequence of D1 is shown in the amino acid sequence of positions 1-125 of Anc80L65 serotype VP1.

[0018] In another preferred embodiment, D3 is derived from the C-terminal amino acid sequence of Anc80L65 serotype VP1; preferably, the amino acid sequence of D3 is as shown in the 686-800 amino acid sequence of Anc80L65 serotype VP1.

[0019] In another preferred example, D2 is from one or more AAV serotypes selected from the following group: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, sh10, Anc113, or a combination thereof.

[0020] In another preferred embodiment, D2 includes sequence fragments from 2-6 AAV serotype VP1, preferably 2-4.

[0021] In another preferred embodiment, D2 includes a sequence fragment from AAV6 serotype VP1.

[0022] In another preferred embodiment, D2 includes or consists of sequence fragments from AAV6 and AAV9 serotypes.

[0023] In another preferred embodiment, D2 includes or consists of sequence fragments from AAV2, AAV6, AAV8 and Anc113 serotypes.

[0024] In another preferred embodiment, the rearranged AAV capsid protein VP1 comprises an amino acid sequence fragment selected from the following group:

[0025] 1-125 of the amino acid sequence of VP1 of serotype Anc80L65;

[0026] 126-130 of the amino acid sequence of VP1 of AAV9 serotype;

[0027] Positions 131-180 of the amino acid sequence of VP1 of AAV6 serotype; and

[0028] Positions 181-800 of the amino acid sequence of VP1 of AAV9 serotype.

[0029] In another preferred embodiment, the rearranged AAV capsid protein VP1 consists of the following fragments from N-terminus to C-terminus:

[0030] 1-125 of the amino acid sequence of VP1 of serotype Anc80L65;

[0031] 126-130 of the amino acid sequence of VP1 of AAV9 serotype;

[0032] Positions 131-180 of the amino acid sequence of VP1 of AAV6 serotype; and

[0033] Positions 181-800 of the amino acid sequence of VP1 of AAV9 serotype.

[0034] In another preferred embodiment, the rearranged AAV capsid protein VP1 comprises an amino acid sequence fragment selected from the following group:

[0035] 1-83 of the amino acid sequence of VP1 of AAV8 serotype;

[0036] positions 84-106 of the amino acid sequence of VP1 of AAV6 serotype;

[0037] 107-241 of the amino acid sequence of VP1 of AAV2 serotype;

[0038] 242-266 of the amino acid sequence of VP1 of serotype Anc113;

[0039] Positions 267-686 of the amino acid sequence of VP1 of AAV2 serotype; and

[0040] Position 687-800 of the amino acid sequence of VP1 of serotype Anc80L65.

[0041] In another preferred embodiment, the rearranged AAV capsid protein VP1 consists of the following fragments from N-terminus to C-terminus:

[0042] 1-83 of the amino acid sequence of VP1 of AAV8 serotype;

[0043] positions 84-106 of the amino acid sequence of VP1 of AAV6 serotype;

[0044] 107-241 of the amino acid sequence of VP1 of AAV2 serotype;

[0045] 242-266 of the amino acid sequence of VP1 of serotype Anc113;

[0046] Positions 267-686 of the amino acid sequence of VP1 of AAV2 serotype; and

[0047] Position 687-800 of the amino acid sequence of VP1 of serotype Anc80L65.

[0048] In another preferred embodiment, the amino acid sequence of VP1 of the rearranged AAV capsid protein is selected from the following group:

[0049] (i) a sequence as shown in SEQ ID NO: 3 or 4;

[0050] (ii) a sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or 4.

[0051] In another preferred embodiment, the VP1 amino acid sequence of the rearranged AAV capsid protein is as shown in SEQ ID NO: 3 or 4.

[0052] In the second aspect of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide encodes the rearranged AAV capsid protein described in the first aspect of the present invention.

[0053] In the third aspect of the present invention, a vector is provided, wherein the vector contains the polynucleotide as described in the second aspect of the present invention.

[0054] In another preferred embodiment, the vector is a plasmid.

[0055] In the fourth aspect of the present invention, a host cell is provided, wherein the host cell contains the vector as described in the third aspect of the present invention, or the polynucleotide as described in the second aspect of the present invention is integrated into the genome.

[0056] In another preferred embodiment, the host cell further contains a helper plasmid containing the target nucleic acid.

[0057] In another preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell.

[0058] In another preferred embodiment, the host cell is a plant cell, an insect cell, or an animal cell, preferably a mammalian cell.

[0059] In another preferred embodiment, the host cell is HEK-293 cell.

[0060] In a fifth aspect of the present invention, a recombinant adeno-associated virus (rAAV) particle is provided, wherein the rAAV particle comprises:

[0061] (i) the rearranged AAV capsid protein as described in the first aspect of the present invention;

[0062] (ii) a nucleic acid of interest packaged within the AAV capsid.

[0063] In another preferred embodiment, the target nucleic acid is an ophthalmic disease-related gene, or a nucleic acid encoding a protein for treating ophthalmic diseases.

[0064] In the sixth aspect of the present invention, a method for preparing the rAAV particles as described in the fifth aspect of the present invention is provided, comprising the steps of: culturing the host cells as described in the fourth aspect of the present invention under suitable conditions to obtain the rAAV particles.

[0065] In another preferred example, the method further comprises the step of isolating and / or purifying the rAAV particles from the culture.

[0066] In a seventh aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0067] (a) the rAAV particle according to the fifth aspect of the present invention; and

[0068] (b) a pharmaceutically acceptable carrier.

[0069] In an eighth aspect of the present invention, a drug combination is provided, comprising:

[0070] (a) a first active ingredient: the rAAV particle according to the fifth aspect of the present invention, or the pharmaceutical composition according to the seventh aspect of the present invention; and

[0071] (b) a second active ingredient.

[0072] In another preferred embodiment, the second active ingredient is an immunomodulator, such as an immunosuppressant.

[0073] In another preferred embodiment, the second active ingredient is an ophthalmic therapeutic agent.

[0074] In the ninth aspect of the present invention, there is provided the use of the rAAV particles as described in the fifth aspect of the present invention, or the pharmaceutical composition as described in the seventh aspect of the present invention, or the drug combination as described in the eighth aspect of the present invention, or a combination thereof in the preparation of a drug for treating a disease.

[0075] In another preferred embodiment, the disease is an eye disease.

[0076] In another preferred embodiment, the disease is a retinal disease.

[0077] In another preferred embodiment, the eye disease is selected from the following group: dry age-related macular degeneration (dAMD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), diabetic retinopathy, retinal vein occlusion, geographic atrophy, crystalline retinal degeneration (BCD), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, inherited retinal degeneration (IRD).

[0078] In another preferred embodiment, the disease is selected from the following group: hemophilia, Canavan disease, Alzheimer's disease, lysosomal storage disease, adrenomedullary neuropathy, Parkinson's disease, amyotrophic lateral sclerosis (ALS), hereditary cardiomyopathy, familial hypercholesterolemia, Wilson's disease, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), epidermolysis bullosa (EB), hereditary deafness, and type 1 diabetes.

[0079] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0081] Figure 1 The process of directed virus screening of libraries based on the DNA shuffling technology platform is shown.

[0082] Figure 2 Shown are the results of an enrichment screen of AAV capsid variants in mouse retinal tissue.

[0083] Figure 3 Parental amino acid contributions of AAV capsid variants M04 and C72 are shown.

[0084] Figure 4 The toxin production efficiency of the M04 virus serotype is shown.

[0085] Figure 5 The temperature stability of the M04 virus serotype is shown.

[0086] Figure 6 The transduction efficiency of the M04 virus serotype in cells in vitro is shown.

[0087] Figure 7 The in vivo distribution efficiency of the M04 virus serotype when injected via intravitreal (IVT) is shown.

[0088] Figure 8 The tissue distribution of M04 virus serotype in different retinal cells is shown.

[0089] Fig. 9 Shown is the transduction efficiency of the M04 virus serotype in human retinal organoids.

[0090] Fig.10 The toxin production efficiency of the C72 virus serotype is shown.

[0091] Fig.11 The target gene packaging efficiency of C72 virus serotype is shown.

[0092] Fig.12 The in vivo tissue distribution of C72 virus serotype upon intravitreal (IVT) injection is shown.

[0093] Fig.13 Shown is the transduction efficiency of C72 virus serotype in human-derived retinal organoids. DETAILED DESCRIPTION

[0094] After extensive and in-depth research, the inventors have developed for the first time a capsid rearrangement adeno-associated virus vector and its use. The present invention constructs a retina-targeted AAV library, screens chimeric capsids based on existing AAV serotype genes, and obtains a capsid rearrangement AAV variant with high toxin production, high solid rate, and low immunogenicity. Compared with the existing AAV capsid AAV2.7m8, the capsid variant of the present invention further increases the retinal transduction activity by more than 3 times; in addition, the present invention ultimately verifies the high transduction activity of the new serotype in human retinal tissue through humanized retinal organoids, which is consistent with that in small animal models. The new AAV serotype of the present invention significantly reduces the single dose of the virus while improving the level of gene therapy or long-term expression of the target protein, reduces the innate immune response, and improves the performance and clinical application potential of AAV as a gene therapy vector. On this basis, the present invention is completed.

[0095] the term

[0096] For the purpose of interpreting this specification, the following definitions will be used, and whenever appropriate, terms used in the singular may also include the plural, and vice versa. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0097] The term "about" or "approximately" includes within statistically significant ranges of values. Such ranges may be within an order of magnitude of a given value or range, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% or within 1%. The permissible variations encompassed by the term "about" or "approximately" depend on the specific system under study and can be readily appreciated by those of ordinary skill in the art.

[0098] As used herein, the term "and / or" means any one of the alternatives or two or more or all of the alternatives.

[0099] As used herein, the term "comprising" or "including" means including the stated elements, integers or steps, but not excluding any other elements, integers or steps. In this article, when the term "comprising" or "including" is used, unless otherwise indicated, it also covers the situation consisting of the stated elements, integers or steps. For example, when referring to a polypeptide "comprising" a specific sequence, it is also intended to cover a polypeptide consisting of the specific sequence.

[0100] As described in this article, adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Dependinovirus of the family Parvoviridae. It is the simplest type of single-stranded DNA defective virus discovered so far, and requires a helper virus (usually adenovirus) to participate in replication. It encodes the VP1 gene and rep gene in the middle of the inverted repeat sequence (ITR) at the two ends. ITR plays a decisive role in the replication and packaging of the virus. The VP1 gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of the virus. AAV can infect a variety of cells. Because adeno-associated viruses are smaller than other viral vectors, have no pathogenicity, and can infect dividing and non-dividing cells, gene therapy methods based on AAV vectors for eye diseases, especially inherited retinal degenerative diseases, have received widespread attention.

[0101] Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its good safety, wide range of host cells (dividing and non-dividing cells), low immunogenicity, and long-term expression of foreign genes in vivo, it is regarded as one of the most promising gene transfer vectors and is widely used in gene therapy and vaccine research worldwide. In medical research, rAAV is used in the study of gene therapy for a variety of diseases (including in vivo and in vitro experiments). At the same time, as a characteristic gene transfer vector, it is also widely used in gene function research, construction of disease models, preparation of gene knockout mice, etc.

[0102] The term "capsid protein" refers to a protein that is part of the viral capsid. For adeno-associated viruses, the capsid proteins are generally referred to as VP1, VP2 and / or VP3, and are each encoded by a single VP1 gene. For AAV, the three AAV capsid proteins are produced in an overlapping manner from the capsid open reading frame (ORF) via alternate mRNA splicing and / or alternate translation start codons. All three proteins use a common stop codon (Warrington et al. (2004) J. Virol. 78: 6595).

[0103] As used herein, the term "rAAV" refers to recombinant adeno-associated virus, also referred to as recombinant adeno-associated viral particles or recombinant AAV.

[0104] The term "retinal cell" may refer herein to any cell type, including the retina, such as retinal ganglion cells, amacrine cells, horizontal cells, bipolar cells, and photoreceptor cells (including rods and cones), Mullerian glial cells, and retinal pigment epithelial cells.

[0105] The term "rearranged AAV capsid protein" includes a rearranged AAV capsid protein having an amino acid sequence as shown in SEQ ID NO: 3 or 4, or having at least 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or 4. The rearranged AAV capsid protein of the present invention has an amino acid sequence from AAV2, AAV6, AAV8, AAV9, Anc113, Anc80L65, or a combination thereof.

[0106] The term "transduction" or "infection" and the like refers to the introduction of nucleic acid into target cells by a viral vector. The term "transduction efficiency" refers to the fraction (e.g., percentage) of cells expressing the target nucleotide after incubation with a set number of viral vectors containing the target nucleotide. Well-known methods for determining transduction efficiency include fluorescence-activated cell sorting of cells transduced with a fluorescent reporter gene, PCR for expression of the target nucleotide, and the like.

[0107] "Identity" or "percent identity (%)" of an amino acid sequence or nucleic acid sequence refers to the percentage of amino acid residues / nucleotides in a candidate sequence that are identical to the amino acid residues / nucleotides of a specific sequence shown in this specification, after aligning the candidate sequence with the specific sequence shown in this specification and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity, and not considering any conservative substitutions as part of the sequence identity. In some embodiments, the present invention includes variants of proteins or polypeptides or nucleic acids of the present invention, which have a considerable degree of identity, such as at least 80%, 85%, 90%, 95%, 97%, 98% or 99% or more, relative to the polypeptides or proteins or nucleic acids specifically disclosed herein. The variants may contain conservative changes.

[0108] The terms "individual" or "subject" are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual is a human.

[0109] The term "treatment" includes administering a composition or hybrid polypeptide to prevent or delay the onset of symptoms, complications, or biochemical indications of a disease, to alleviate symptoms, or to arrest or inhibit further development of a disease, condition, or disorder. The term "prevention" includes inhibition of the occurrence or development of a disease or disorder or symptoms of a particular disease or disorder.

[0110] The term "pharmaceutical excipient" refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete)), excipient, carrier, stabilizer, or the like, which is administered together with the active substance.

[0111] The term "pharmaceutical composition" refers to a composition that is in a form that permits the biological activity of the active ingredient contained therein to be effective, and that contains no additional ingredients that are unacceptably toxic to a subject to which the composition would be administered.

[0112] The term "effective amount" refers to that amount or dosage of a rAAV or composition or combination of the invention which, after administration in single or multiple doses to a patient, produces the desired effect in a patient in need of treatment or prevention.

[0113] The term "therapeutically effective amount" refers to an amount effective to achieve the desired therapeutic outcome at the required dosage and for the required period of time. A therapeutically effective amount is also an amount in which any toxic or deleterious effects of the rAAV or composition or combination are outweighed by the therapeutically beneficial effects. A "therapeutically effective amount" preferably inhibits a measurable parameter or improves a measurable parameter by at least about 40%, even more preferably by at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or even 100% relative to an untreated subject.

[0114] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides or their analogs. A polynucleotide may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. As used herein, the term polynucleotide may refer alternately to double-stranded and single-stranded molecules.

[0115] The term "target nucleic acid" refers to the nucleic acid to be transduced by recombinant AAV viral particles, which encodes, for example, preventive or therapeutic proteins, particularly proteins for preventing or treating ophthalmic diseases, such as AIPL1, PROM1, RS1, RPE65, macromolecular antibodies and antibody analogs, etc.

[0116] Rearranged AAV capsid protein

[0117] The present invention provides a rearranged adeno-associated virus (AAV) capsid protein. The rearranged AAV capsid protein VP1 of the present invention comprises an N-terminal domain or a C-terminal domain fragment from the Anc80L65 serotype, and a VP1 fragment from one or more other AAV serotypes.

[0118] The present invention found that the N-terminal domain and / or C-terminal domain of the Anc80L65 serotype is particularly beneficial for improving the efficiency of intraocular delivery of AAV (especially intravitreal injection delivery). Based on this, the present invention recombines the N-terminal domain and / or C-terminal domain of the Anc80L65 capsid protein VP1 with capsid protein fragments from other AAV serotypes to provide a rearranged AAV capsid protein with high transfection efficiency.

[0119] In some embodiments, the present invention relates to a novel rearranged AAV capsid protein, wherein the amino acid sequence of VP1 of the rearranged AAV capsid protein is selected from the following group:

[0120] (i) a sequence as shown in SEQ ID NO: 3 or 4;

[0121] (ii) a sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or 4.

[0122] In another preferred embodiment, the VP1 amino acid sequence of the rearranged AAV capsid protein is as shown in SEQ ID NO: 3 or 4.

[0123] The present invention also relates to a plasmid comprising a nucleic acid encoding the rearranged AAV capsid protein of the present invention.

[0124] Target nucleic acid

[0125] The capsid protein of the present invention can package the target nucleic acid to form virus particles.

[0126] The nucleic acid of interest suitable for being encoded by the viral particles of the present invention is any nucleic acid encoding a therapeutic or preventive protein, in particular a nucleic acid encoding a protein for the prevention or treatment of ophthalmic diseases, such as ophthalmology-related genes, such as RPE65, AIPL1, PROM1, RS1 genes, etc. In some embodiments, proteins for the prevention or treatment of ophthalmic diseases include, but are not limited to, for example, RPE65, AIPL1, PROM1, RS1 or antibody analogs, etc.

[0127] The nucleic acid of interest can be contained in an expression cassette and packaged within an AAV capsid.

[0128] In some embodiments, the expression cassette comprises at least one ITR sequence so that the vector genome can be smoothly assembled by the capsid. The expression cassette can be single-stranded DNA, double-stranded DNA, or single-stranded RNA or double-stranded RNA.

[0129] In some embodiments, the expression cassette may comprise one or more regulatory sequences to direct the expression of the target nucleic acid coding sequence in a target cell (e.g., a retinal target cell, such as a photoreceptor cell or an optic nerve cell). The regulatory sequence may be selected from a transcription initiation sequence, a termination sequence, a promoter and / or an enhancer sequence operably linked to the coding sequence; an efficient RNA processing signal such as a splicing and polyadenylation (poly A) region, including a human growth hormone polyadenylation region; an inverted repeat sequence (e.g., L-ITR or R-ITR); a selective marker or reporter gene, such as a resistance gene; a microRNA; a post-transcriptional regulatory sequence, such as WPRE (a post-transcriptional regulatory sequence of woodchuck hepatitis virus); a sequence that stabilizes cytoplasmic mRNA; a nucleic acid restriction site; a homologous recombination sequence; a sequence that enhances translation efficiency (e.g., a Kozak sequence); a sequence that enhances protein stability; and a sequence that enhances secretion of the encoded product when desired.

[0130] In some preferred embodiments, the regulatory sequence is located in the 5'UTR or 3'UTR. In some preferred embodiments, the regulatory sequence is selected from one or more of the following:

[0131] Promoters, inverted repeats, introns, enhancers, post-transcriptional regulatory sequences, polyadenylation regions, selectable markers or reporter genes.

[0132] Examples of promoters suitable for use in the present invention include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including monkeys and humans). Promoters may be constitutive or inducible. Constitutive promoters initiate RNA synthesis independently of regulatory influences.

[0133] The expression cassette of the present invention may also include a selective marker or reporter gene, for example to determine the expression of the vector in a growth system (e.g., bacterial cell) or in a target cell." Selectable marker " or " reporter gene " of the present invention may be selected from those known in the art. Suitable reporter genes include, but are not limited to, enhanced green fluorescent protein, red fluorescent protein, luciferase and secreted embryo alkaline phosphatase (seAP), which may include sequences encoding geneticin, hygromycin or puromycin resistance, etc. Such selective markers or reporter genes (which may be located or not located outside the viral genome to be packaged into the virion) may be used to send a signal of the presence of a plasmid in a bacterial cell, such as an antibiotic resistance marker gene, for example ampicillin or tetracycline resistance or kanamycin resistance.

[0134] The expression cassette or expression vector of the present invention may also comprise a polyadenylation region, such as hGHpA (human growth hormone polyadenylation region).

[0135] The expression cassette or expression vector of the present invention may also contain introns, such as introns of chimeric or native genes.

[0136] Virus particles

[0137] The present invention relates to a recombinant AAV virus (rAAV) particle comprising

[0138] (i) a rearranged AAV capsid protein of the present invention; and

[0139] (ii) a target nucleic acid packaged in the AAV capsid, such as a gene associated with an ophthalmic disease or a nucleic acid encoding a protein for treating an ophthalmic disease.

[0140] Preparation method

[0141] The present invention relates to a method for preparing recombinant AAV virus particles (rAAV). Many methods are known in the art for packaging and producing rAAV. Currently commonly used rAAV packaging systems mainly include a three-plasmid co-transfection system, a system with adenovirus as a helper virus, a packaging system with herpes simplex virus type 1 (HSV1) as a helper virus, and a packaging system based on baculovirus. Each packaging system has its own characteristics, and those skilled in the art can make appropriate choices as needed.

[0142] rAAV production cultures for producing rAAV viral particles all require: 1) suitable host cells, including, for example, human-derived cell lines such as HEK-293T cells, or insect-derived cell lines (in the case of baculovirus production systems); 2) suitable helper functions, which are provided by wild-type or mutant adenovirus (such as temperature-sensitive adenovirus), herpes virus, baculovirus, or plasmid constructs that provide helper functions; 3) AAV rep and VP1 genes and gene products; 4) the target gene / target nucleic acid, which is flanked by at least one AAV ITR sequence that retains full function and is preferably driven by an operably linked promoter; and 5) a suitable culture system to support rAAV production.

[0143] In some embodiments, the present invention relates to a method for producing recombinant AAV virus particles, comprising culturing packaging cells under conditions sufficient to produce recombinant AAV virus particles, wherein the packaging cells comprise a plasmid comprising a nucleic acid encoding a rearranged AAV capsid protein according to the present invention or a nucleic acid encoding a rearranged AAV capsid protein according to the present invention.

[0144] In some embodiments, the packaging cell further comprises a helper plasmid and / or a transfer plasmid comprising the nucleic acid of interest.

[0145] In some embodiments, the method further comprises isolating the recombinant AAV viral particles from the culture supernatant.

[0146] In some embodiments, the method further comprises lysing the packaging cells and isolating recombinant AAV viral particles from the cell lysate.

[0147] In some embodiments, the method further comprises one or more of the following steps:

[0148] a. Remove cell debris,

[0149] b. Treating the supernatant containing recombinant AAV virus particles with universal nuclease,

[0150] c. Concentrated recombinant AAV virus particles,

[0151] d. Purify the recombinant AAV virus particles.

[0152] Therefore, the present invention also relates to a packaging cell for producing recombinant AAV virus particles, wherein the packaging cell comprises a plasmid comprising a nucleic acid encoding the rearranged AAV capsid protein of the present invention or a capsid protein encoding nucleic acid of the present invention or an expression cassette of the present invention.

[0153] Composition, medicine or preparation

[0154] The present invention provides a preparation, composition or drug, which contains (a) the rAAV of the present invention, and (b) pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

[0155] As used herein, "pharmaceutical carrier" includes any and all solvents, dispersion media, isotonic and absorption delaying agents, etc. that are physiologically compatible. For the use of pharmaceutical excipients and their uses, see also "Handbook of Pharmaceutical Excipients", 8th Edition, RC Rowe, PJ Seskey and SC Owen, Pharmaceutical Press, London, Chicago.

[0156] In some embodiments, pharmaceutical excipients include, but are not limited to, one or more compatible solid or liquid fillers or gel substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here refers to the ability of the components in the composition to blend with the active ingredients of the present invention and with each other without significantly reducing the efficacy of the active ingredients. Suitable pharmaceutical excipients will be known to those skilled in the art. Examples of pharmaceutically acceptable carrier parts include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0157] The preparation or composition or medicine of the present invention can be liquid or solid, for example powder, gel or paste. Preferably, the preparation or composition or medicine of the present invention is liquid, preferably an injectable liquid. Preferably, the injectable liquid is provided as a capsule or in a syringe.

[0158] The rAAV of the present invention or a preparation, composition or drug comprising the same can be administered intravenously, intramuscularly, subcutaneously, orally, by mucosal contact, intraperitoneally and intralesionally, preferably topically to the eye, for example, by intraretinal administration or intravitreal administration, for example, intravitreal injection, subretinal injection or suprachoroidal injection. In some embodiments, the rAAV of the present invention or a preparation, composition or drug comprising the same can be administered intraretinally or intravitreally, for example, by intravitreal or subretinal administration, for example, intravitreal administration (IVT administration). In any mode of administration, preferably, the preparation, composition or drug of the present invention is provided as an injectable liquid.

[0159] The composition or formulation or medicament may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0160] The composition of the present invention, such as a pharmaceutical composition or a pharmaceutical preparation, may further comprise other active ingredients, such as one or more other therapeutic agents, such as an immunomodulator (eg, an immunosuppressant).

[0161] Combination Products

[0162] The invention also provides combination products (eg, pharmaceutical combination products) comprising the rAAV of the invention, and one or more other therapeutic agents. The combination products of the invention can be used in the treatment methods of the invention.

[0163] The present invention also provides a kit comprising the combination product, for example, the kit comprises in the same package:

[0164] a first container containing the rAAV of the present invention or a medicament comprising the same;

[0165] A second container of a pharmaceutical composition comprising one or more additional therapeutic agents (eg, an immunomodulatory agent).

[0166] In some embodiments, the other therapeutic agent is an immunomodulator, such as an immunosuppressant, for example, to reduce the immune response generated by the rAAV particles, such as an immune inflammatory response.

[0167] Treatment

[0168] In one embodiment, the rAAV, formulation or composition or medicament of the invention is used to treat an ocular disease.

[0169] In some embodiments, ocular diseases include, but are not limited to, dry age-related macular degeneration (dAMD), geographic atrophy, crystalline retinal degeneration (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, hereditary retinal degeneration (IRD), congenital cataract, glaucoma, congenital retinal, iris or choroidal coloboma, retinoblastoma, pathological myopia, congenital optic neuropathy, strabismus, keratoconus, etc.

[0170] In one embodiment, the rAAV, formulation or composition or medicament of the invention is administered intraocularly, for example, intraretinal administration or intravitreal administration, for example, subretinal administration or intravitreal administration. In one embodiment, the administration is injection.

[0171] In one embodiment, the present invention also relates to the use of recombinant AAV virus particles, preparations or compositions or combination products containing the same in the preparation of a medicament for treating an eye disease of the present invention.

[0172] The main advantages of the present invention include:

[0173] 1) The novel AAV variant M04 of the present invention is more stable when stored at 37°C compared with the wild-type AAV virus, which provides the possibility for the storage and transportation of AAV under different conditions and improves the durability of AAV gene therapy.

[0174] 2) The novel AAV variant of the present invention has better single-cell virus production, a high virus solidity rate, no VP3 truncated protein was found in the M04 virus, and the transduction activity in in vitro optic nerve cells was significantly higher than that of AAV2.7m8.

[0175] 3) The transduction efficiency and range of the new AAV variant M04 of the present invention in the eyes of living mice are higher than those of the prior art AAV2.7m8. When injected into the mouse eye through the vitreous cavity, the results of fundus autofluorescence, retinal flat mounts, and immunofluorescence-labeled retinal tissue sections all showed that M04 carrying the fluorescent reporter gene had higher fluorescence intensity and wider distribution. Compared with existing serotypes, M04 has stronger ability of specific transduction and tissue distribution range on the retina, and can efficiently transduce the outer retinal tissue.

[0176] 4) The novel AAV variant M04 of the present invention has verified its transduction efficiency and spatial distribution in retinal organoids. Compared with the prior art AAV2.7m8, the transgene expression intensity and range of M04 in retinal cells increased by more than 7 times, which is consistent with the results of in vivo experiments in mice, indicating that M04 has more advantages as a delivery vector in the treatment of human retinal diseases.

[0177] 5) The transduction efficiency and range of the novel AAV variant C72 in the eyes of living mice are higher than those of the prior art AAV2.7m8. When injected into the mouse eye through the vitreous cavity, the results of fundus autofluorescence and retinal flat-mounts showed that the average fluorescence intensity and distribution of C72 carrying the fluorescent reporter gene were significantly enhanced compared with AAV2.7m8, and this result was verified in human retinal organoids.

[0178] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0179] Example 1 Screening of novel AAV capsids targeting the retina

[0180] Experimental methods and principles: A retina-targeted AAV library was constructed using DNA shuffling technology.

[0181] Steps: Using AAV2, AAV5, AAV6, AAV8, AAV9, sh10, Anc80L65, and Anc113 cap genes as templates, use the upstream primer DS1-F1 (CACGGACAGAAAGACTGTTTAGAGTG, SEQ ID NO: 5) and the reverse primer DS1-R1 (CGAGACCACATGGTGTCGC, SEQ ID NO: 6) to perform PCR amplification on the above 8 cap genes, mix the recovered DNA fragments in equal moles, use NEB Next dsDNA Fragmentase to digest the mixed plasmid to obtain DNA fragments of different sizes, recover the fragments in the range of 250-1000 bp, and then perform nested PCR to obtain the full-length cap fragment, which is a chimera of the 8 original genes. The PCR product was cloned back to the wild-type (WT) AAV backbone (AAV2), and the combined clones were electroporated to construct a plasmid library. At the same time, several clones were randomly selected for Sanger testing, and PCR was performed on the plasmid library, and sent to NGS and Pacbio for sequencing. The plasmid library was packaged with viruses to generate a starting virus library, so that each capsid variant virus corresponds to its viral genome. Therefore, by corresponding the infection information of the virus library with the genome information, a new AAV capsid variant with high enrichment can be selected.

[0182] RHO-EGFP mice were used as a library screening model because rhodopsin is the visual pigment of rod cells. After knocking in the GFP gene, it can be directly sorted by FACS (Wensel et al. (2005) Vision Res. 45: 3445). The viral library obtained by DNA shuffling technology was diluted to 2 μL with a genome titer of about 3×10 12 10 viral genomes (vg) / mL were injected into RHO-GFP mice by IVT. One week after the injection, the eyes were dissected and the mouse retinal tissue was harvested. The retinal tissue was lysed using Neural Tissue Dissociation Kits(T) (Miltenyi biotec, 5230509503) and the photoreceptor cells with GFP were separated using a flow cytometer (FACS). The cell genome was extracted and the viral gene was amplified using PCR. NGS and Pacbio sequencing were performed, and retinal-targeted AAV capsid variants were screened by simulating qualitative evolution. According to the sequencing results, the AAV capsid variant with the highest enrichment in retinal tissue was selected and named M04, and this variant was not enriched in the initial plasmid library. Figure 2 shown.

[0183] Example 2 Virus Preparation of Capsid Rearrangement AAV

[0184] Based on the above sequencing results, we selected the AAV capsid variant M04 with the highest abundance in retinal tissue, and its parental amino acid contribution was as follows: Figure 3 As shown. In the initial virus library, the AAV capsid variant C72 with the thirteenth enrichment was selected, and its parental amino acid contribution is as follows Figure 3 shown.

[0185] The following describes the construction of M04 and C72 plasmids, and the packaging of a series of AAV viruses containing the red fluorescent protein mScarlet reporter gene, including M04, C72, AAV2, AAV9, AAV2.7m8, etc., to enable subsequent in vitro cell and in vivo mouse transduction experiments.

[0186] (1) Construction of M04 plasmid

[0187] The viral library obtained by DNA shuffling technology was diluted to 2 μL with a genome titer of about 3×10 12Viral genomes (vg) / mL were injected into RHO-GFP mice by IVT. One week after injection, the eyes were dissected and the mouse retinal tissues were harvested. The retinal tissues were lysed using Neural Tissue Dissociation Kits(T) (Miltenyi biotec, 5230509503) and the photoreceptor cells carrying GFP were separated using flow cytometry (FACS). The cell genome was extracted and the 5' end amplification primers DS1-F2 (GATTTGGATGACTGCATCTTTGAAC, SEQ ID NO: 7) and 3' end amplification primers DS1-R1-34 (GTTTAAACTGTACATTCTCAGGGG, SEQ ID NO: 8) were used for polymerase chain reaction (PCR). The retinal cell genome was amplified once, and the target band of about 2200 bp was purified by agarose gel electrophoresis using an ultrathin DNA product purification kit (Tiangen, Y1804) to recover the PCR product, and the 5' end amplification primer DS1-F2 (GATTTGGATGACTGCATCTTTGAAC, SEQ ID NO: 7) and the 3' end amplification primer M04R (CGACTCCACCCCTCCGCCCGCTGTTTAAACTGTACATTCTCAGGGGTCCCGACATCGTATTTCCGTTTGAGTCGTC, SEQ ID NO: 9) were used to amplify the retinal cell genome once, and the PCR product was purified by a polymerase chain reaction (PCR). The recovered DNA fragments were amplified for the second round, and the target band of about 2200 bp was purified by agarose gel electrophoresis using an ultra-thin DNA product purification kit (Tiangen, Y1804) to recover the PCR products. The PCR products were recombined back to the wild-type (WT) AAV backbone (AAV2), and clones were selected for next-generation sequencing. According to the sequencing results, the submitted clones were used as templates, and 5' end amplification primers DS1-F2 (GATTTGGATGACTGCATCTTTGAAC, SEQ ID NO: 7) and 3' end amplification primers M01-R5 (CGACTCCACCCCTCCGCCCGCTGTTTAAACGCCCGGGCTGTAGTTAATGATTAAC, SEQ ID NO: 10) were used for polymerase chain reaction (PCR) amplification. The recovered PCR products were recombined back to the wild-type (WT) AAV backbone (AAV2), and clones were selected for next-generation sequencing. After the sequence was consistent with the NGS result, subsequent experiments were carried out.

[0188] (2) Construction of C72 plasmid

[0189] According to the results of virus sequencing of a round of library, the present invention uses 5' end amplification primer DS1-F2 (GATTTGGATGACTGCATCTTTGAAC, SEQ ID NO: 7) and 3' end amplification primer DS-V-R1-13 (GTTTAAACTGTACACGTACGTGG, SEQ ID NO: 11) to perform one round of polymerase chain reaction (PCR) amplification on the initial virus library, and uses an ultra-thin DNA product purification kit (Tiangen, Y1804) to recover the PCR product of the target band of about 2200 bp by agarose gel electrophoresis, and uses 5' end amplification primer DS1-F2 (GATTTGGATGACTGCATCTTTGAAC, SEQ ID NO: 7) and 3' end amplification primer DS-V-R2-13 (CGTATTTCCGTACCAGCCCAT, SEQ ID NO: 12) After two rounds of polymerase chain reaction (PCR) amplification, the PCR product was recovered by agarose gel electrophoresis using an ultrathin DNA product purification kit (Tiangen, Y1804) for the target band of about 2200 bp, and the PCR product was recombined back into the wild-type (WT) AAV backbone (AAV2).

[0190] (3) AAV packaging and purification

[0191] 293T adherent cell virus packaging: 24h before the experiment, 293T cells were inoculated in a 15cm dish. The next day, when the cell density reached 80%, a transfection complex solution of PEI: DNA mixture = 1.5μL:1μL was prepared. Solution A: LX-GOI-E10 (mScarlet reporter genome plasmid), M04 or C72 (Rep-Cap plasmid), pHelper (auxiliary packaging plasmid) were dissolved in 500μL serum-free DMEM culture medium (a 15cm culture dish) according to the molecular weight ratio of 1:1:1, and the plasmids were gently mixed. Solution B: PEI pro needs to be vortexed before use. Dissolve 45μL PEI in 500μL serum-free DMEM culture medium (a 15cm culture dish) and mix gently. Add solution B to solution A and mix gently, vortex for 10 seconds, and incubate at room temperature for 15min. Add 1 ml of transfection complex to each 15 cm culture dish and add it dropwise to the culture dish. After 24 hours, replace it with low-glucose DMEM containing 2% serum and double antibodies. After 96 hours, collect the cells by centrifugation at 1500 rpm in a horizontal rotor for 10 minutes, resuspend them in 10 ml PBS, freeze and thaw them repeatedly with liquid nitrogen three times, add all-purpose enzyme (200 U / μL, working concentration 50 U / ml), incubate at 37°C for 2 hours, centrifuge at 4000 rpm in a horizontal rotor for 15 minutes, collect the supernatant, perform iodixanol ultracentrifugation, take the 40% iodixanol layer, use a 50 ml Millipore 100KD ultrafiltration tube to replace PBS, and store the virus at -80°C.

[0192] 293F suspension cell virus packaging: Use 300ml suspension culture medium (Jian Shun, CD293 01) to dilute 293F cells to 1E+6 / ml, and culture at 37℃, 120rpm, 5% CO2 shaker for 24h. When the cell density reaches 2E+6 / ml, virus packaging is performed. Add the three plasmids to 15ml antibiotic-free and serum-free Jian Shun culture medium. The molar ratio of LX-GOI-E10 (mScarlet reporter genome plasmid), M04 or C72 (Rep-Cap plasmid), and pHelper (auxiliary packaging plasmid) for three plasmid packaging is 3:1:2. Add 600μL Fecto VIR-AAV to the plasmid mixture, vortex for 10s, and let stand at room temperature for 30min. Add the mixture dropwise to the suspension cells and culture at 37℃, 120rpm, 5% CO2 shaker. 24 hours after packaging, add Feed A (Jian Shun) at 3% of the total volume and Feed B (Jian Shun) at 0.3% of the total volume. After 72 hours, collect the cells by centrifugation at 1500 rpm in a horizontal rotor for 10 minutes, resuspend in 100 ml PBS, add 11 ml 10*Lysis buffer and all-purpose enzyme (200 U / μL, working concentration 50 U / ml), incubate at 37°C for 2 hours, centrifuge at 4000 rpm in a horizontal rotor for 15 minutes, collect the supernatant, and purify the virus by affinity and anion exchange, and store the virus at -80°C.

[0193] (4) AAV viral genome titer determination

[0194] Compared with traditional detection methods, digital droplet polymerase chain reaction (ddPCR) has higher accuracy in measuring viral genomes and can reduce measurement errors. Therefore, this experiment uses real-time fluorescence quantitative polymerase chain reaction (QPCR) and ddPCR to determine the viral genome titer. When QPCR is used to detect the viral genome titer, the virus needs to be processed. The processing method is to take 5μL of purified virus and add water to 44.75μL; add 0.25μL of proteinase K (working concentration 100ug / ml); 55 degrees for 10min, 95 degrees for 20min, and record it as E-1 (10-fold dilution); QPCR is performed on viruses with dilutions of 100 times and 500 times. When measuring viral genome titers by ddPCR, the virus needs to be diluted according to the viral genome titers obtained by QPCR. The virus with the appropriate dilution gradient is prepared with ddPCR supermix (BIO-RAD, #12001925) to prepare a mixture. The mixture and oil are placed in a droplet generation plate, and droplets are generated in the QX200 Droplet Generator. The droplets are transferred to the ddPCR Plates 96-Well and sealed with a preheated PX1 heat sealer. The operating program is: 180°C, 10 s. Polymerase chain reaction (PCR) amplification is performed, and the fluorescence signal of the generated droplets is read using the QX200™ Droplet Reader.

[0195] The results of M04 virus packaging showed that the virus production of M04 was higher than that of AAV2 and AAV2.7m8, whether it was 293T adherent cells or 293F suspension cells. Figure 4 As shown in a, when 293T adherent virus packaging was performed, the viral genome produced by a single M04 cell increased by about 1.28 times compared with AAV2 and by about 0.17 times compared with AAV2.7m8. Figure 4 b shows that when 293F suspension packaging was performed, the viral genome produced by a single M04 cell increased by about 0.71 times compared with AAV2 and by about 0.62 times compared with AAV2.7m8. The increase in AAV production can effectively reduce drug production costs to a certain extent.

[0196] Example 3 Temperature stability study of new serotypes

[0197] Specific experimental steps: First, dilute M04, AAV2, AAV8, and AAV9 viruses to 1E12 vg / μL and aliquot. Place the virus in a 37°C incubator and take out the virus at D0, D4, D7, D14, and D21 and store it at -80°C. 293T cells were plated in 24-well plates at a density of 1E4 cells / well. After 24 hours, M04 and AAV2 were infected with MOI=1000, and AAV8 and AAV9 were infected with MOI=250000. After 24 hours of infection, 10% FBS high-glucose DMEM medium was added to the 24-well plates. 72 hours after infection, the cells were digested, the culture medium was discarded, 300 μL PBS was added to the cells, the PBS was discarded, 50 μL 0.5% trypsin was added, and digestion was carried out at room temperature for 1 min. 300 μL DMEM containing 10% FBS was added to terminate the digestion, and the mScarlet autofluorescence in the cells was detected by flow cytometry.

[0198] The stability of viral capsids directly affects the feasibility of their storage and transportation, as well as their durability in therapeutic applications. The present invention simulated the storage of M04, AAV2, AAV8, and AAV9 viruses at 37°C for different time periods (D0, D4, D7, D14, and D21), and infected 293T cells to evaluate the stability of the M04 capsid. Figure 5 As shown in the figure, the percentage of mScarlet-positive cells of M04 capsid slowly decreased between D0 and D7 in a wide temperature range, and the infection effect decreased rapidly between D7 and D14 days, while the infection effect of wild-type control viruses AAV2, AAV8, and AAV9 decreased rapidly between D0 and D4. The specific decrease was that the infection activity of AAV2, AAV8, and AAV9 decreased significantly when stored at 37°C for 4 days, which was about 21.47%, 28.5%, and 18.57% lower than that of viruses not placed at 37°C, respectively. The infection activity of M04 decreased significantly when it was stored at 37°C for 14 days, and decreased by about 17.27% compared with the virus placed at 37°C for 7 days. In general, the stable storage time of M04 virus at 37°C is significantly longer than that of AAV2, AAV8, and AAV9, maintaining good stability, which makes it possible to store and transport it under different conditions.

[0199] Example 4 Verification of transduction activity of capsid-rearranged AAV in cells in vitro

[0200] In IVT (intravitreal) injection, after AAV viruses of different serotypes pass through the inner limiting membrane (ILM), they must also pass through multiple layers of cells, first through the RGC layer, and then to the inner plexiform layer, inner nuclear layer, outer plexiform layer, outer nuclear layer, etc. Since RGC-5 is a bridge neuron that connects retinal input to the visual processing center in the central nervous system, it is often used as an important model in the study of retinal diseases. The present invention uses RGC-5 cells to detect the infectious activity of the virus, infects RGC-5 with AAV2, AAV9, AAV2.7m8, and M04, and performs flow analysis.

[0201] Specific steps: AAV2, AAV9, AAV2.7m8, and RC-V25 viruses were uniformly diluted to 1E12vg / μL. RGC-5 cells were plated in 24-well plates at a density of 2E5cells / well, and RGC-5 was infected at MOI=500 / 2500 24 hours later. 10% FBS high-glucose DMEM medium was added to the 24-well plate 24 hours after infection. 72 hours after infection, the cells were digested, the medium was discarded, 300μL PBS was added to the cells, PBS was discarded, 50μL 0.5% trypsin was added, digested at room temperature for 1min, 300μL DMEM containing 10% FBS was added to terminate the digestion, and the mScarlet autofluorescence in the cells was detected by flow cytometry.

[0202] like Figure 6 As shown in a, the peak pattern of the flow cytometry analysis results showed that the expression level of M04 mScarlet was higher than that of AAV2.7m8, and significantly higher than that of AAV2 and AAV9. Figure 6 As shown in b, the percentage of M04mScarlet-positive cells at MOI 500 was 10-15% higher than AAV2.7m8, 10-15% higher than AAV2, and about 25% higher than AAV9; at MOI 500, it was about 25% higher than AAV2.7m8, 40-45% higher than AAV2, and about 85% higher than AAV9. Figure 6 As shown in c, the average fluorescence intensity of RGC-5 transduced by M04 was also significantly higher than that of AAV2, AAV9, and AAV2.7m8, and the trend of the result was consistent with the percentage of mScarlet-positive cells.

[0203] Example 5 In vivo activity evaluation using intravitreal (IVT) injection

[0204] Four 6- to 8-week-old C57 / BL6 mice were prepared as experimental subjects. The prepared M04-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet serotypes were administered by intravitreal (IVT) injection with equal amounts (1x10 8vg / μL, 2μL; 1x10 9 vg / μL, 2μL) of M04, AAV2 and AAV2.7m8 viruses (all carrying red fluorescent protein reporter gene) were injected into the mouse eyes. In vivo autofluorescence (AF) was examined at 3 weeks and 6 weeks after administration, and retinal flat mounts and sections were performed at 6 weeks to evaluate the in vivo transduction efficiency. Figure 7 a The results of in vivo autofluorescence showed that the average fluorescence intensity of the M04 reporter gene mScarlet was significantly stronger than that of the control group AAV2 and AAV2.7m8. ImageJ was used to calculate the fluorescence intensity and fluorescence area of ​​both eyes of all mice AF, as shown in the figure. Figure 7 b, 7c, at 3 weeks after injection, the M04 low-dose group (2x10 8 The average fluorescence intensity of the M04 high-dose group (2x10 9 The average fluorescence intensity of the M04 low-dose group (2x10 8 The average fluorescence intensity of the M04 high-dose group (2x10 9 The average fluorescence intensity of vg / eye is about 1.89 times that of AAV2 and 1.38 times that of AAV2.7m8. Figure 7 d and 7e, in the high-dose group (2x10 9 vg / eye) observed that the fluorescence area of ​​M04 infection was higher than that of the control group AAV2 (3 weeks: about 1.37 times, 6 weeks: about 1.81 times) and AAV2.7m8 (3 weeks: about 1.28 times, 6 weeks: about 1.34 times) regardless of whether it was infected for 3 weeks or 6 weeks. In addition, retinal tissue was flat-mounted at 6 weeks. Figure 7 f, the retina was observed under a fluorescence microscope, and the results showed that the expression and distribution of M04 capsid in the retina were significantly enhanced compared with AAV2 and AAV2.7m8. In summary, M04 can be injected into the vitreous at a low dose of 2x10 8 At 6 weeks of vg / eye infection, the spatial distribution and expression of M04 in retinal tissue were stronger than those of AAV2 and AAV2.7m8, regardless of whether the infection intensity was evaluated by mean fluorescence intensity or fluorescence area.

[0205] Six weeks later, retinal tissue sections were immunofluorescently stained with antibodies against specific cell markers to detect the expression distribution of mScarlet in different retinal layers by M04, AAV2, and AAV2.7m8 vectors. Figure 8As shown in the figure, the results of immunofluorescence staining showed that M04 robustly expressed mScarlet in many cell types, including retinal ganglion cells (RGCs) and Muller cells as well as the nuclei of the outer nuclear layer (ONL), and the panoramic image of the slice showed that mScarlet was uniformly expressed throughout the retinal slice. M04 had obvious fluorescence signals from the ganglion cell layer to the outer nuclear layer, while AAV2 and AAV2.7m8 vectors only had weak mScarlet fluorescence expression, and the number of cells expressed in each cell and the expression intensity of the target protein were less than M04. In general, M04 had a wider infection area and stronger expression of mScarlet than AAV2 and AAV2.7m8 vectors.

[0206] Example 6 Study on the transduction activity of the new serotype in retinal organoids

[0207] Retinal organoids are differentiated from human iPSC cells and can form a three-dimensional structure containing all retinal cell types. Compared with traditional animal models, human retinal organoids have higher biological similarity and lower ethical controversy, and therefore show great potential in retinal disease research. Along with the development of retinal organoids, specific markers present in the retina such as retinal ganglion cells, horizontal cells, cone photoreceptor cells and amacrine cells are formed in the early retina, while rod photoreceptors, bipolar and Müller glial cells also gradually appear in the later stages of development. When the retina is cultured to the 180th day, it contains the complete structure of the retina. Therefore, the present invention selects 180-day retinal organoids for experiments to evaluate the performance of M04, AAV2, and AAV2.7m8 in a retinal environment that is closer to the real human body.

[0208] Experimental methods:

[0209] (1) Differentiation of retinal organoids

[0210] Wild-type H9 cells were used for retinal organoid differentiation. On Day 0, human embryonic stem cell line H9 cells were gently digested at 37°C and embryoid bodies (EBs) were established in ultra-low attachment 6-well plates. On Day 1-5, NIM medium (DMEM / F12 + 1xN2 + MEM-NEAA + Heparin) was replaced every 2 days. On Day 7-15, EBs were transferred to a 6-well plate in Matrigel Coat using a Pasteur pipette, and half of the NIM medium was replaced on D9, D12, and D15. On Day 16-25, 3:1 Medium (DMEM / F12 + 1x B27 + MEM-NEAA) was used to replace the medium every 2 days to isolate retinal organoids. The cells were scraped off with the cross method of the pipette tip and transferred to a low-adhesion 6-well plate with a Pasteur pipette. After the retinal organoids were isolated, the culture medium was changed to 3D-RDM (DMEM / F12 +10% FBS+MEM-NEAA+1xB27+100uM Taurine+CDLS); Day 30-40, the retinal organoids with obvious structures were picked under a stereomicroscope for long-term culture. The first stage of retinal organoid differentiation lasts as late as the sixth week after isolation, and this stage is characterized by the beginning of the appearance of a black core in the center; 17-24 weeks after the isolation of retinal organoids, most iPSC-derived optic cups develop to the second stage, which is characterized by the reappearance of obvious surface hair-like appendages and a thin outer edge. At the beginning of the third stage of differentiation (later than 148-196 days), the optic cup reaches an advanced state of photoreceptor cell development, including the formation of inner and outer segments, outer nuclear layer, and outer plexiform layer, and can be tested for AAV infection.

[0211] (2) Retinal organoid infection

[0212] AAV2, AAV9, AAV2.7m8, and M04 viruses were uniformly diluted to 1E9 and 1E8 vg / μL. Differentiated mature retinal organoids were infected with 2E8 vg and 2E9 vg, and the 3D-RDM medium was replaced every three days. Fluorescence photography was performed at 2 and 4 weeks of infection.

[0213] result:

[0214] like Fig. 9 As shown in a, the transduction efficiency of M04 in human retinal organoids was significantly higher at low doses (1x10 8 vg / μL, 2μL) or high dose (1x10 9 vg / μL, 2μL), which were significantly higher than AAV2 and AAV2.7m8, and the infection efficiency increased with the infection time. ImageJ was used to count the expression intensity and distribution of mScarlet in retinal organoids. The results are shown in the figure. Fig. 9 b, 9c, M04 was used at a dose of 2 μL, 1x108 When retinal organoids were infected with 100 vg / μL titer, the fluorescence area and cumulative fluorescence intensity of the M04 vector were about 5.53 times and 7.8 times higher than those of the AAV2.7m8 vector, respectively. As the infection time increased, at 4 weeks of infection, the fluorescence area and cumulative fluorescence intensity of the M04 vector were about 3.8 times and 3.63 times higher than those of the AAV2.7m8 vector, respectively, indicating that the transgenic expression of the M04 vector can be efficiently expressed in a shorter time. This result was observed at high doses (1x10 9 vg / μL, 2μL) infection group was confirmed again. Fig. 9 d, as shown in 9e.

[0215] Example 7 Novel retinal targeting capsid-C72

[0216] (1) C72 single cell toxin production

[0217] Analysis of the C72 virus packaging results showed that the virus production of C72 was higher than that of AAV2 and AAV2.7m8 when the virus was packaged in 293F suspension cells. Fig.10 As shown, when 293F suspension packaging was performed, the viral genome produced by C72 single cells increased by about 1 times compared with AAV2 and by about 1.61 times compared with AAV2.7m8.

[0218] (2) C72 genome copy number / viral particle number (VG / VP) detection

[0219] The present invention uses AAV2 Xpress ELISA kit (PROGEN, A23007) to detect the number of viral particles of AAV2, AAV2.7m8, and C72, and analyzes the ratio of the number of viral particles (VP) determined by the enzyme-linked immunosorbent assay results to the number of genome copies determined by digital droplet polymerase chain reaction (ddPCR). The results are as follows: Fig.11 As shown, the ratio of C72VG / VP increased by about 2.92 times compared with AAV2 and by about 1.92 times compared with AAV2.7m8. This indicates that during the production and purification process of C72, the packaging efficiency of viral particles is higher than that of AAV2 and AAV2.7m8, and the genome is effectively encapsulated in the viral capsid.

[0220] (3) Intravitreal (IVT) drug efficacy test in animals

[0221] Fig.12 a The results of in vivo autofluorescence showed that the average fluorescence intensity of the C72 reporter gene mScarlet was significantly stronger than that of the control group AAV2 and AAV2.7m8. ImageJ was used to calculate the fluorescence intensity and fluorescence area of ​​both eyes of all mice AF, as shown in the figure. Fig.12 b, 12d, at 3 weeks after injection, the C72 high-dose group (2x10 9 The total fluorescence intensity of the C72 low-dose group (2x10 8 The total fluorescence intensity of the C72 high-dose group (2x10 9 The total fluorescence intensity of vg / eye is about 1.99 times that of AAV2 and 1.51 times that of AAV2.7m8. Fig.12 c, 12e analysis showed that the C72 virus high dose group (2x10 9 At 3 weeks after infection with AAV2, the infected fluorescent area was about 1.39 times that of AAV2 and 1.84 times that of AAV2.7m8. In addition, at 6 weeks, retinal tissue was flat-mounted. Fig.12 f, the retina was observed under a fluorescence microscope, and the results showed that the expression and distribution of C72 capsid in the retina were significantly enhanced compared with AAV2 and AAV2.7m8. In summary, C72 can be injected into the vitreous with a high dose of 2x10 9 At 3 weeks after vg / eye infection, the spatial distribution and expression of C72 in retinal tissue were stronger than those of AAV2, especially AAV2.7m8, whether the infection intensity was evaluated by mean fluorescence intensity or fluorescence area.

[0222] (4) Retinal organoid experiments

[0223] The present invention selected D180 day retinal organoids for experiments to evaluate the performance of C72, AAV2, and AAV2.7m8 in a retinal environment that is closer to the real human body. Fig.13 As shown in a, the transduction efficiency of C72 in human retinal organoids was significantly higher at low doses (1x10 8 vg / μL, 2μL) or high dose (1x10 9 vg / μL, 2μL) was significantly higher than AAV2 and AAV2.7m8, and the infection efficiency increased with the infection time. ImageJ was used to count the expression intensity and distribution of mScarlet in retinal organoids. The results are shown in the figure. Fig.13 b, 13c, C72 was used at a dose of 2 μL, 1x10 8When retinal organoids were infected with a titer of vg / μL, the fluorescence results at 2 weeks showed that the fluorescence area and cumulative fluorescence intensity of the C72 vector were about 6.99 times and 9 times higher than those of the AAV2.7m8 vector, respectively. As the infection time increased. At 4 weeks of infection, the fluorescence area and cumulative fluorescence intensity of the C72 vector were 2.59 times and 2.09 times higher than those of the AAV2.7m8 vector, respectively. Fig.13 As shown in Figures 13d and 13e, from the 4-week fluorescence results, it can be seen that the fluorescence area and cumulative fluorescence intensity of the C72 vector are approximately 2.07 times and 2.26 times higher than those of the AAV2.7m8 vector, respectively. As the infection time increases, at 4 weeks of infection, the fluorescence area and cumulative fluorescence intensity of the C72 vector are 1.35 times and 1.49 times higher than those of the AAV2.7m8 vector, respectively, indicating that the transgenic expression of the C72 vector can be efficiently expressed in a shorter time.

[0224] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0225] AAV2 VP1 amino acid sequence:

[0226] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL (SEQ ID NO: 1)

[0227] The VP1 amino acid sequence of AAV2.7m8:

[0228] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNLALGETTRPRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL (SEQ ID NO: 2)

[0229] The VP1 amino acid sequence of M04:

[0230] MAADGYLPDWLEDNLSEGIREWWDLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRLLEPLGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNLQRGNLALGDVTRPARQAATADVNTQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIKNTPVPADPPTAFNKDKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSNNVEFAVNTEGVYSEPRPIGTRYLTRNL* (SEQ ID NO: 3)

[0231] Amino acid sequence of VP1 of C72:

[0232] *(SEQ ID NO: 4).

Claims

1. A reassortant adeno-associated virus (AAV) capsid protein, characterized in that: The amino acid sequence of VP1 of the rearranged AAV capsid protein is shown in SEQ ID NO: 3 or 4.

2. An isolated polynucleotide encoding the rearranged AAV capsid protein according to claim 1.

3. A vector comprising the polynucleotide according to claim 2.

4. A host cell, comprising the vector according to claim 3, or the polynucleotide according to claim 2 integrated into its genome.

5. A recombinant adeno-associated virus (rAAV) particle, the rAAV particle comprising: (i) the rearranged AAV capsid protein according to claim 1; (ii) a nucleic acid of interest packaged in the AAV capsid.

6. The rAAV particle of claim 5, wherein The target nucleic acid is a nucleic acid encoding a protein for treating ophthalmic diseases.

7. A method for preparing the rAAV particles as described in claim 5, comprising the steps of: culturing the host cells as described in claim 4 under suitable conditions to obtain the rAAV particles.

8. A pharmaceutical composition, comprising: (a) the rAAV particle of claim 5; and (b) a pharmaceutically acceptable carrier.

9. Use of the rAAV particles according to claim 5 or the pharmaceutical composition according to claim 8 in the preparation of a drug for treating retinal diseases.

Images