Metarhizium anisopliae Malc2404 strain as well as preparation method and application thereof

Abstract

The invention discloses a metarhizium anisopliae Malc2404 strain as well as a preparation method and application thereof, the preservation name of the metarhizium anisopliae Malc2404 strain is metarhizium anisopliae Malc2404 strain, the metarhizium anisopliae Malc2404 strain is preserved in China General Microbiological Culture Collection Center (CGMCC), and the preservation number of the metarhizium anisopliae Malc2404 strain is CGMCC (China General Microbiological Culture Collection Center). The address of the preservation unit is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation date is May 30, 2024; the preservation number is CGMCC (China General Microbiological Culture Collection Center) The invention can be used for preventing and treating biocontrol fungi of an agricultural important pest, i.e., the agrotis ypsilon, has the characteristics of strong pathogenicity to the agrotis ypsilon, difficulty in generating drug resistance of the pest, environmental protection and no pollution, and can be widely used for preventing and treating the agrotis ypsilon.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a Metarhizium anisopliae Malc2404 strain and a preparation method and application thereof. Background Art

[0002] Cutworm ( Agrotis ipsilon ) belongs to the subfamily Agrotinae of the family Noctuidae of the order Lepidoptera. The larvae are also called earthworms, night thieves, and cutworms. They are widely distributed, have a varied diet, and cause serious damage. They are a major agricultural and forestry pest that occurs worldwide. They have a wide host range and can harm dryland crops such as cereals, beans, hemp, cotton, tobacco, and vegetables, as well as fruit trees, trees, and flowers. The 1st to 2nd instar larvae feed on the heart leaves or young leaves of plants, forming white spots or small holes. After the 3rd instar, they often bite off the stems or petioles of plants near the ground, causing the plants to die, resulting in missing seedlings and broken ridges, or even destroying and reseeding, causing significant losses to the agricultural economy. For a long time, the main means of controlling small cutworms has been spraying chemical pesticides. In recent years, with the global climate change and changes in farming methods, the distribution range of small cutworms has gradually expanded, and the damage to agricultural and forestry crops and vegetables has also increased year by year.

[0003] In the prior art, the main means of controlling cutworms is spraying chemical pesticides, which has resulted in strong resistance to a variety of pesticides. In addition, problems such as pesticide residues caused by chemical control pose a risk to human and animal safety and the ecological environment.

[0004] At present, there are few reports on the molecular mechanism of low temperature regulation of floral organ development, and there is a lack of a Metarhizium anisopliae Malc2404 strain and its preparation method and application. Summary of the invention

[0005] The purpose of the present invention is to provide a Metarhizium anisopliae Malc2404 strain and a preparation method and application thereof.

[0006] In order to solve the problems of the prior art, the present invention provides the following technical solutions: In a first aspect, the present application provides a strain of Metarhizium anisopliae Malc2404; In a second aspect, the present application provides a Metarhizium anisopliae fungal agent; In a third aspect, the present application provides a method for preparing a spore suspension of the Metarhizium anisopliae Malc2404 strain; In a fourth aspect, the present application provides a use of the Metarhizium anisopliae Malc2404 strain or a Metarhizium anisopliae agent in the preparation of a preparation for controlling small cutworms.

[0007] The present invention discloses a Malc2404 strain of Metarhizium anisopliae, which is classified as Metarhizium anisopliae ( Metarhizium anisopliae ), deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), the address of the depository is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is May 30, 2024; the deposit number is CGMCC No. 41249.

[0008] Furthermore, the ITS gene sequence of the Metarhizium anisopliae Malc2404 strain is the nucleotide sequence shown in SEQ ID No.1.

[0009] The Metarhizium anisopliae fungal agent is prepared from the Metarhizium anisopliae Malc2404 strain of the present invention.

[0010] Furthermore, the active ingredient is at least one of the following (a), (b), and (c): (a) Fermentation culture of Metarhizium anisopliae Malc2404 strain; (b) the obtained spore suspension of Metarhizium anisopliae Malc2404 strain; (c) The ultrasonic lysis precipitate of the obtained M. anisopliae Malc2404 strain cells.

[0011] The method for preparing the spore suspension of the Malc2404 strain of Metarhizium anisopliae of the present invention comprises the following steps: inoculating the isolated Malc2404 strain of Metarhizium anisopliae into a SMAY medium, and 15 days after the strain produces a large number of conidia, scraping the conidia on the surface of the medium with a sterile scalpel and placing the conidia in 0.02% sterile Tween-80 to prepare a 1.5×10 3 -1.5×10 8 / mL spore suspension.

[0012] The invention discloses an application of the Metarhizium anisopliae Malc2404 strain or the Metarhizium anisopliae agent in the preparation of a preparation for preventing and controlling small cutworms.

[0013] Beneficial effects: The green muscardine Malc2404 of the present invention is a biocontrol fungus that can be used to prevent and control the important agricultural pest small cutworm. It has the characteristics of strong pathogenicity to small cutworms, pests are not easy to develop drug resistance, and is environmentally friendly and pollution-free. It can be widely used in the prevention and control of small cutworms.

[0014] Compared with the prior art, the present invention has the following advantages: (1) Strong pathogenicity: The Malc2404 strain of Metarhizium anisopliae is highly pathogenic to the larvae of small cutworms and can effectively control this major agricultural and forestry pest.

[0015] Environmentally friendly and pollution-free: Using the green muscardine fungus Malc2404 as a biological control method is more environmentally friendly than chemical pesticides and will not pollute the environment.

[0016] Less likely to develop resistance: Compared with chemical pesticides, biological control methods are less likely to cause pests to develop resistance, so they can be used as a means of long-term pest control.

[0017] (2) Simple cultivation and fast growth: The Malc2404 strain of Metarhizium anisopliae is simple to cultivate, grows fast, produces large spores, has a high spore germination rate, and is easy to cultivate and reproduce in large quantities indoors.

[0018] Broad application prospects: Due to the above advantages, the green muscardine fungus Malc2404 can be widely used in the prevention and control of small cutworms, including the prevention and control of larvae and pupae, which helps to reduce the use of chemical pesticides and improve the sustainability of agricultural production.

[0019] (3) Cost-effectiveness: Biological control methods are generally more cost-effective than chemical control because they can reduce the amount and frequency of pesticide use while reducing negative impacts on the environment.

[0020] Safe for humans and animals: Biological control methods are generally safer for humans and animals because they do not involve the use of toxic chemicals.

[0021] Sustainability: By using the fungus Malc2404, the balance of agricultural ecosystems can be promoted, the impact on non-target organisms can be reduced, and the sustainability of agricultural production can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The sporangium stalk (A) and conidia morphology (B) of Metarhizium anisopliae Malc2404 of the present invention are shown; Figure 2 This is a colony morphology diagram of the Metarhizium anisopliae Malc2404 of the present invention; Figure 3 The symptom diagram of the larvae of small cutworm infected by the Metarhizium anisopliae Malc2404 of the present invention (A: early stage of infection; B: late stage of infection, producing conidia).

[0023] Figure 4 It is the cumulative mortality rate of the third-instar larvae of small cutworms in different time periods after inoculation with the Metarhizium anisopliae MaLc2024 of the present invention. DETAILED DESCRIPTION

[0024] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0025] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0026] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.

[0027] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0028] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0029] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also indicate the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as µg, mg, g, kg, etc.

[0030] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0031] In a first aspect, the present invention provides a strain of Metarhizium anisopliae Malc2404, which is named as Metarhizium anisopliae ( Metarhizium anisopliae ), deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), the address of the depository is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is May 30, 2024; the deposit number is CGMCC No. 41249.

[0032] The ITS gene sequence of the Metarhizium anisopliae Malc2404 strain is the nucleotide sequence shown in SEQ ID No.1.

[0033] A second aspect of an embodiment of the present application provides a Metarhizium anisopliae inoculum agent prepared from the Metarhizium anisopliae Malc2404 strain.

[0034] In some embodiments, the fermentation culture of Metarhizium anisopliae Malc2404 strain.

[0035] In some embodiments, the obtained spore suspension is of the Metarhizium anisopliae Malc2404 strain.

[0036] In some embodiments, the obtained cells of Metarhizium anisopliae Malc2404 strain are lysed and precipitated by ultrasonication.

[0037] The third aspect of the embodiment of the present application provides a method for preparing a spore suspension of the Malc2404 strain of Metarhizium anisopliae. The isolated Malc2404 strain of Metarhizium anisopliae is inoculated into a SMAY medium. After a large number of conidia are produced, conidia on the surface of the medium are scraped with a sterile scalpel and placed in 0.02% sterile Tween-80 to prepare a spore suspension of 1.5×10 3 -1.5×10 8 / mL spore suspension.

[0038] A fourth aspect of the embodiments of the present application provides an application of the Metarhizium anisopliae Malc2404 strain or a Metarhizium anisopliae agent in the preparation of a preparation for controlling small cutworms. Example 1

[0039] Insect pathogenic fungi are a type of fungi that can infect insects through their bodies and reproduce on their bodies and bodies, consuming nutrients in the insects and causing their death. Insect pathogenic fungi can also cause insect epidemics under natural conditions, have a continuous control over pests, and are not easy to make pests resistant, and are environmentally friendly. Therefore, insect pathogenic fungi are considered to be the next generation of new biological pesticides that are most likely to replace chemical pesticides.

[0040] Metarhizium anisopliae Metarhizium anisopliae ) belongs to the phylum Ascomycota, the orders Hypocreales, the family Clavicipitaceae, and the genus Metarhizium (Zhou Deqing, 2005). On April 5, 2024, the inventor of the present application collected the strain of Metarhizium anisopliae Malc2404 from the diseased larvae of small cutworms in Haozhi Village, Zhutang Township, Lancang County, Pu'er City, Yunnan Province (N22°44'5", E99°47'59", 1490m above sea level). After investigating and collecting the naturally diseased larvae of small cutworms in the field, the research team of the inventor of the present application found that the fungus has strong epidemicity and strong infection and pathogenicity in the field through isolation, purification, virulence determination and screening.

[0041] Given below are examples of the Metarhizium anisopliae Malc2404 provided by the present invention and its application in the control of small cutworms.

[0042] Isolation and identification of Metarhizium anisopliae Malc2404

[0043] 1.1 Materials 1.1.1 Test strains The strain was collected on April 5, 2024 from diseased black cutworm larvae in the potato field in Haozhi Village, Zhutang Township, Lancang County, Pu'er City, Yunnan Province.

[0044] 1.1.2 Isolation and culture of strains The collected 3rd instar larvae of the diseased cutworm were placed in a 5 mL sterile EP tube and brought back to the laboratory. The culture was cultured on Sabouraud maltose agar yeast medium (SMAY) (maltose 40 g, peptone 10 g, yeast extract powder 10 g, agar 20 g, sterile water 1000 mL, pH = 7) at (25 ± 1) ° C, L / / D = 12 h / / 12h, humidity (75 ± 5)% in a light incubator. After 7 days of culture, the conidia were transferred to a new medium for purification. The purified strain was stored in a 4 ° C refrigerator using SMAY slant medium.

[0045] 1.1.3 Colony morphology observation The culture dish was placed in a constant temperature incubator with a relative humidity of (75±5)%, a light condition of L / / D = 12 h / / 12 h, and a temperature of (25±1)℃ for 15 days. From the 3rd day after inoculation, the horizontal and vertical diameters of each treated colony were measured every 48 hours using a cross method with a digital display vernier caliper (ARZ-1331) and the colony growth rate was calculated. When the colony grew to 5 days, the colony morphology and color were observed, and the young hyphae of the strain were picked on a sterilized slide, and the hyphae width and conidiophore morphology were observed under a microscope.

[0046] 1.2 Results 1.2.1 Morphological identification results After obtaining the pure culture of the Malc2404 strain of Metarhizium anisopliae, its morphological characteristics were identified. On SMAY medium, the surface of the colony was fluffy to flocculent, white at the beginning of the culture, and gradually produced conidia with the growth of the hyphae, which were olive green. Under an optical microscope at 40 times, the separated branched hyphae could be seen, which were colorless and 1.5~2.0μm in diameter. The conidiophores were about 2μm in diameter, with bottle-shaped pedicels at the end, and the size was (10~18×1.5~2.1)μm. The conidiophores were solitary or aggregated, and bottle-shaped pedicels were formed at the end of the conidiophores. The end of the pedicels continuously produced a string of conidia in a base-oriented manner. The single conidia were bright in color, and the shape varied from oblong to short columnar, with one end slightly thinner and the flat top at the connection of the two ends with a small slope, and the size range was (5~8×2~3.5)μm. Conidia are bright in color when they exist alone, and olive green when they exist in piles. The fallen conidia often gather into diamond-shaped spore masses.

[0047] Based on the infection symptoms in the field, the collection of diseased insects for indoor isolation and observation, and the identification of Metarhizium anisopliae infection symptoms, conidia and hyphae morphological characteristics in "Insect Mycology", it was determined to be Metarhizium anisopliae Metarhizium anisopliae .

[0048] The nucleotide sequence of the ITS of the Metarhizium anisopliae Malc2404 strain is shown in SEQ ID No. 1 (as follows): TTTCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATCCAACTCCCACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTTTGAATTTTTTAATAAGTATTT TTTGAGTGGTTAAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATT GCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCTGCGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGGTCTCGCCGTGG CCCTCCTCTGCGCAGTAGTAAAGCACTCGCAACAGGAGCCCGGCGCGGTCCACTGCCGTAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTAGCCCGCTGAACTTAAGCATATCAATAAGCGGAAGAAA Example 2

[0049] Isolation and identification of Metarhizium anisopliae Malc2404

[0050] 1 Materials 1.1.1 Test insects Cutworms were collected from potato fields in Haozhi Village, Zhutang Township, Lancang County, Yunnan Province, and were raised indoors for three generations. The experiment was conducted in an intelligent artificial climate chamber (RG-300) at a temperature of (25±1)℃, relative humidity (RH) of (60±5)%, and a photoperiod of L∶D=16∶8. Cutworms were raised with fresh potato tubers.

[0051] 1.1 Preparation of spore suspension The isolated strain was inoculated into SMAY medium. After a large number of conidia were produced (about 15 days), the conidia on the surface of the medium were scraped with a sterile scalpel and placed in 0.02% sterile Tween-80 to prepare 1.5×10 3 -1.5×10 8 / mL spore suspension.

[0052] 1.1.2 Impregnation method Select healthy 3rd instar larvae of the same size and small cutworms, and use the dipping method for inoculation. Place the small cutworm larvae in the spore suspension for 5 seconds, take them out and use sterilized filter paper to absorb the excess water on the surface of the insect body. Then, place them in a 12-well cell culture plate with potato tubers and raise them in a 25℃, L / / D=16 h / / 8 h light incubator. Observe them regularly every day, and keep the dead insects moisturized at (25±1)℃, L / / D=16 h / / 8 h. The cause of death of the small cutworms to be treated is determined based on whether the treated insects grow the target bacteria. Set up 3 replicates, and use 30 insects in each replicate.

[0053] 1.1.3 Data Analysis Excel 2010 was used for data processing, and the toxicity regression equation was calculated using machine value analysis of DPS data processing system 14.0 software.

[0054] 2. Results 2.1 Mortality of infection by Metarhizium anisopliae Malc2404 against cutworm larvae The green muscardine MaLc2024 has a strong infection ability on the third-instar larvae of the small cutworm. After the third-instar larvae are infected with this strain, the body color of the insect body changes from normal to slightly red, and the insect body begins to become stiff; the insect body is cultured in a moisturizing environment. On the third day, except for the head, the thorax and abdomen of the insect body are covered with white hyphae; on the fifth day, light green spores begin to appear; by the seventh day, the entire abdomen of the insect body is covered with spores and is dark green.

[0055] 3.4.2 Cumulative mortality of Agrotis larvae after inoculation with bacterial suspensions of different spore concentrations After inoculation with different concentrations of Metarhizium anisopliae spore suspension, the third-instar larvae of Agrotissima died, and the mortality rate gradually increased with the increase of spore concentration ( Figure 4 ). The third instar larvae of cutworm were inoculated with 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 On the 10th day after exposure to spore suspension with a concentration of spores / mL, the cumulative mortality rates of the third instar larvae of the small cutworm were (21.67±3.33)%, (35.00±5.78)%, (58.33±6.10)%, (68.33±3.33)%, and (93.33±4.41)%, respectively, while the mortality rate of the control was only (3.33±1.67)%.

[0056] Figure 4It is the cumulative mortality rate of the third-instar larvae of small cutworms in different time periods after inoculation with the Metarhizium anisopliae MaLc2024 of the present invention.

[0057] 2.4.3 Dose effect of Metarhizium anisopliae MaLc2024 on infection and pathogenicity of Agrotissima larvae The strain MaLc2024 had a high pathogenicity to the third-instar larvae of Agrotis spp., and the LC50 of the strain MaLc2024 for infection and pathogenicity to Agrotis spp. showed that the lethal dose decreased with the extension of the treatment time after inoculation, indicating that the virulence continued to increase. On the 5th day after inoculation, the corrected mortality rate of Agrotis spp. larvae treated with the highest concentration of spore suspension was 46.67%; from the 6th to the 8th day after inoculation, the logarithmic value of the LC50 dose decreased from 8.348±0.624 to 6.554±0.374, and the LC90 dose decreased from the logarithmic value of 11.835±1.416 to 9.772±0.867; on the 10th day after inoculation, the logarithmic values ​​of the LC50 and LC90 doses were 5.635±0.347 and 8.166±0.536, respectively, which were significantly lower than the logarithmic value of the lethal dose on the 5th day (Table 1). The logarithmic values ​​of the lethal dose of Metarhizium anisopliae MaLc2024 to small cutworm larvae are shown in Table 1: Table 1

[0058] 2.4.4 Time effect of Metarhizium anisopliae MaLc2024 on infection and pathogenicity of Agrotissima larvae The results of toxicity test on the third-instar larvae of Agrotissima (Table 2) showed that the infection and pathogenicity time of Metarhizium anisopliae MaLc2024 strain on the third-instar larvae of Agrotissima decreased with the increase of inoculation concentration. 6 , 1×10 7 , 1×10 8 The LT50 of infection and disease after inoculation of spores / mL were 8.2 d, 7.6 d, and 5.1 d, and the LT90 were 11.9 d, 111.7 d, and 8.5 d, respectively. 8 At the concentration of spores / mL, the LT50 of Metarhizium anisopliae MaLc2024 on the third-instar larvae of small cutworms was the smallest, which was 5.1 d. This shows that the Metarhizium anisopliae MaLc2024 strain has a strong infection and pathogenic effect on the 3rd-instar larvae of small cutworms. The pathogenicity of Metarhizium anisopliae MaLc2024 on the third-instar larvae of small cutworms is shown in Table 2: Table 2

[0059] In summary, the Metarhizium anisopliae Malc2404 provided by the present invention is a biocontrol fungus that can be used to control small cutworms. It has the characteristics of strong pathogenicity to small cutworms, an underground pest in agriculture and forestry, being environmentally friendly and pollution-free, and not being easy to develop drug resistance. It can be used for the control of small cutworm larvae and pupae.

[0060] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A strain of Metarhizium anisopliae Malc2404, characterized in that: The classification of the Metarhizium anisopliae Malc2404 strain is named Metarhizium anisopliae ( Metarhizium anisopliae ), deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), the address of the depository is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is May 30, 2024; the deposit number is CGMCC No. 41249.

2. The Metarhizium anisopliae Malc2404 strain according to claim 1, characterized in that: The ITS gene sequence of the Metarhizium anisopliae Malc2404 strain is the nucleotide sequence shown in SEQ ID No.

1.

3. The Metarhizium anisopliae agent prepared from the Metarhizium anisopliae Malc2404 strain according to claim 1.

4. The Metarhizium anisopliae inoculum agent according to claim 3, characterized in that: The active ingredient is at least one of the following (a), (b), and (c): (a) a fermentation culture of the Metarhizium anisopliae Malc2404 strain according to claim 1; (b) a spore suspension of the Metarhizium anisopliae Malc2404 strain obtained according to claim 1; (c) The ultrasonic lysis precipitate of the cells of the Metarhizium anisopliae Malc2404 strain obtained according to claim 1.

5. The method for preparing the spore suspension of Metarhizium anisopliae Malc2404 strain according to claim 1, characterized in that: The isolated Metarhizium anisopliae Malc2404 strain of claim 1 was inoculated into SMAY medium, and 15 days after a large number of conidia were produced, conidia on the surface of the medium were scraped with a sterile scalpel and placed in 0.02% sterile Tween-80 to prepare 1.5×10 3 -1.5×10 8 / mL spore suspension.

6. Use of the Metarhizium anisopliae Malc2404 strain described in claim 1 or the Metarhizium anisopliae agent described in claim 3 in the preparation of a preparation for controlling small cutworms.

Images