Burkholderia sp. For biocontrol of tobacco bacterial wilt and application of burkholderia sp.

Abstract

The invention discloses tobacco bacterial wilt biocontrol burkholderia and application thereof, relates to the technical field of agricultural microorganisms, and is technically characterized in that the burkholderia S8288 is preserved in China General Microbiological Culture Collection Center (CGMCC) in October 2024, the preservation number of the burkholderia S8288 is CGMCC NO.32293, the preservation number of the burkholderia S8288 is CGMCC NO.32293, and the preservation number of the burkholderia S8288 is CGMCC NO.32293. The 16S rRNA (ribosomal Ribonucleic Acid) gene sequence of the Burkholderia sp. S8288 strain is as shown in SEQ ID No. 1. The strain has a good inhibition effect on pathogenic fine diseases and oomycetes such as Coreiella solani causing tobacco bacterial wilt and phytophthora nicotianae causing tobacco black shank, and the prevention effect on the tobacco bacterial wilt reaches 50%. The strain can induce death of plant cells and stimulate expression of plant-related immune genes. Besides, the Burkholderia sp. S8288 can decompose potassium, hydrolyze inorganic phosphorus and organic phosphorus and produce protease and NH3, and has potential capabilities of improving soil nutrition and promoting crop growth, and greenhouse tests show that the strain can significantly promote tobacco growth and development.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural microorganisms, and in particular to Burkholderia bacteria for biocontrol of tobacco bacterial wilt and application thereof. Background Art

[0002] As an important cash crop in my country, tobacco is crucial to maintaining local economic stability and ensuring people's livelihood. However, tobacco is easily infected by various pathogenic microorganisms during the planting process, which affects its yield and quality. In particular, the excessive use of pesticides and fertilizers leads to soil degradation and nutrient loss, which further aggravates the occurrence of tobacco soil-borne diseases. Among them, tobacco bacterial wilt caused by infection with Ralstonia solanacearum has become one of the most serious soil-borne diseases in tobacco production. Tobacco bacterial wilt is a typical high temperature and high humidity disease. High temperature and high humidity conditions in summer are extremely conducive to the infection and outbreak of bacterial wilt. During the vigorous growth period of tobacco, the temperature conditions in the field are suitable for the disease. Once precipitation or flooding occurs, bacterial wilt can break out severely in one to two weeks. Tobacco bacterial wilt has occurred in major tobacco-growing areas in my country for many years, causing heavy losses. The chemical control of production relying on pesticides has brought about a series of problems such as environmental pollution, resistance and food safety, which seriously restricts the sustainable production of the industry. Therefore, it is urgent to explore new green disease prevention and control strategies.

[0003] The development of biological control products using beneficial microbial resources has become an important means of plant disease prevention and control. As a green biological control product, microbial preparations have a certain degree of target specificity, are environmentally friendly, safe and non-toxic, and can delay the development of resistance to pesticides in pests and diseases. At present, most commercial microbial preparations are based on beneficial microorganisms such as Trichoderma, Streptomyces, Bacillus, and Pseudomonas. Although these preparations play a key role in plant disease prevention and control, they face the problems of homogeneity and a single mechanism of action.

[0004] Burkholderia is a type of Gram-negative bacteria with a wide geographical and ecological niche distribution. Plant-beneficial Burkholderia is an important type of plant growth promoting rhizobacteria (PGPR), which is commonly found in soil and plant roots. Studies have shown that plant-beneficial Burkholderia can promote the absorption of nutrients such as nitrogen and phosphorus by plants through biological nitrogen fixation and phosphorus solubilization, and can also secrete antibacterial substances to inhibit the growth of pathogens, showing great application potential in promoting plant growth and maintaining plant health.

[0005] Therefore, the present invention provides a Burkholderia species for biocontrol of tobacco bacterial wilt and application thereof. Summary of the invention

[0006] The purpose of the present invention is to solve the above-mentioned problems and provide a Burkholderia biocontrol agent for tobacco bacterial wilt and its application. By exploring the specific growth-promoting and antagonistic pathogenic bacteria functions of Burkholderia, its growth-promoting effect on plants, its stimulation of plant immunity and its inhibitory effect on tobacco bacterial wilt are clarified, providing an important resource basis for the research and development of efficient disease-preventing and growth-promoting microbial preparations, and providing an important reference for exploring new green prevention and control strategies for plant diseases.

[0007] In order to achieve the above-mentioned purpose, the technical scheme of the present invention is as follows: a Burkholderia for biocontrol of tobacco bacterial wilt, wherein the Burkholderia S8288 has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration in October 2024, and its deposit number is: CGMCC NO.32293, and the 16SrRNA gene sequence of the Burkholderia S8288 strain is shown in SEQ ID No.1.

[0008] Another object of the present invention is to provide a use of the Burkholderia S8288 or its metabolites in preventing and / or treating tobacco bacterial wilt.

[0009] Another object of the present invention is to provide a use of the Burkholderia S8288 or its metabolites in inhibiting Ralstonia solanacearum and Phytophthora nicotianae.

[0010] Another object of the present invention is an application of the Burkholderia S8288 or its metabolites in improving soil nutrition and promoting crop growth.

[0011] Another object of the present invention is to provide a use of the Burkholderia S8288 or its metabolites in potassium solution.

[0012] Another object of the present invention is to provide a use of the Burkholderia S8288 or its metabolites in hydrolyzing organic phosphorus and inorganic phosphorus.

[0013] Another object of the present invention is a use of the above-mentioned Burkholderia S8288 or its metabolites in producing protease.

[0014] Another object of the present invention is to provide a use of the Burkholderia S8288 or its metabolites in producing ammonia.

[0015] Another object of the present invention is to provide a use of the Burkholderia S8288 or its metabolites in increasing tobacco biomass.

[0016] Another object of the present invention is a use of the Burkholderia S8288 or its metabolites in stimulating plant immunity.

[0017] Another object of the present invention is to provide a fermentation broth of the above-mentioned Burkholderia S8288, which contains Burkholderia S8288 bacteria and substances secreted into the culture medium. The preparation method of the fermentation broth is: picking a single colony of the freshly cultured strain Burkholderia S8288 and inoculating it into 2mL LB liquid culture medium, culturing it at 28°C and 200rpm for 16h to obtain a seed liquid, transferring it to the LB liquid culture medium at a ratio of 1:1000, and shaking and culturing it under the same conditions for 48h to finally obtain a fermentation broth of the strain S8288, and the fermentation broth has at least one of the above functions.

[0018] Another object of the present invention is a culture of the above-mentioned Burkholderia S8288, which refers to the material obtained by culturing Burkholderia S8288 in various microbial culture media, including the bacteria and secretions of Burkholderia, and the culture has at least one of the above-mentioned functions.

[0019] Compared with the prior art, this solution has the following beneficial effects:

[0020] The Burkholderia orbicola S8288 provided by the present invention has a good inhibitory effect on Ralstonia solanacearum, which causes tobacco bacterial wilt, and Phytophthoranicotianae, which causes tobacco black shank, and the prevention effect on tobacco bacterial wilt reaches 50%. This effect significantly reduces the occurrence and severity of tobacco bacterial wilt, reduces the economic losses caused by the disease, and provides a green and environmentally friendly biological control method, replaces or reduces the use of chemical pesticides, and is beneficial to environmental protection and ecological balance.

[0021] B.orbicola S8288 can induce plant cell death and stimulate the expression of plant-related immune genes, thereby enhancing the plant's own immunity. In addition, the strain can also dissolve potassium, hydrolyze inorganic phosphorus and organic phosphorus, produce protease and NH3, which help improve soil nutrition and promote crop growth. Greenhouse experiments have shown that the growth and development of tobacco using B.orbicola S8288 have been significantly promoted, indicating that the strain not only plays a role in disease prevention and control, but can also serve as a plant growth promoter to improve crop yield and quality.

[0022] This solution uses microbial agents for biological control, which is environmentally friendly, safe and non-toxic, and can delay the development of pest resistance. Compared with traditional chemical control methods, biological control strategies are more sustainable, help reduce soil degradation and nutrient loss, maintain soil health, reduce environmental pollution, ensure food safety, and promote green development of agriculture.

[0023] As a new type of biocontrol strain, the discovery and application of B.orbicola S8288 provides new strategies and methods for the prevention and control of tobacco bacterial wilt. The multiple functions of this strain, including disease inhibition, plant growth promotion and soil improvement, make it have a wide range of application potential in the field of agricultural microbial technology. The present invention not only provides an effective means of preventing and controlling tobacco bacterial wilt, but also provides a reference for disease prevention and control of other crops and soil improvement, and has important scientific research and practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The phylogenetic tree of B. orbicola S8288 and related Pseudomonas was constructed based on the 16S rRNA gene sequence in the embodiment of the present invention;

[0025] Figure 2 This is the result of the inhibition of B.orbicola S8288 on Ralstonia solanacearum and Phytophthora nicotianae in the embodiment of the present invention. Among them, A is Ralstonia solanacearum, B is Phytophthora nicotianae;

[0026] Figure 3 is the potassium dissolving test result of B.orbicola S8288 in the embodiment of the present invention;

[0027] Figure 4 is the test result of B.orbicola S8288 hydrolyzing inorganic phosphorus in the embodiment of the present invention;

[0028] Figure 5 This is the detection result of B.orbicola S8288 hydrolyzing organic phosphorus in the embodiment of the present invention;

[0029] Figure 6 is the result of protease detection of B.orbicola S8288 in the embodiment of the present invention;

[0030] Figure 7 This is the result of the detection of NH3 production by B.orbicola S8288 in the embodiment of the present invention. The first left in the upper row is the negative control of the culture medium, the second left in the upper row is the culture medium with Nessler's reagent, the third left in the upper row is Nessler's reagent, and the third in the lower row is 3 repetitions of B.orbicola S8288 treatment;

[0031] Figure 8The growth of tobacco seedlings after 30 days of treatment with B.orbicola S8288 and the control. A, is the growth effect diagram; B, is the statistical diagram of tobacco plant height;

[0032] Fig. 9 This is the detection result of plant cell death induced by B. orbicola S8288 in the embodiment of the present invention;

[0033] Fig.10 It is the gene related to plant immunity stimulated by B. orbicola S8288 in the embodiment of the present invention. DETAILED DESCRIPTION

[0034] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] The pathogens used in the following implementation examples can be collected from the wild by the public, or obtained from the Institute of Agricultural Resources and Agricultural Zoning of the Chinese Academy of Agricultural Sciences to repeat the experiments of this application.

[0037] 1) Rastonia solanacearum P380 (CongShen, Li Junzhou, XiongZhengzhong, Wei Hailei. Diverse interactions of five coretype III effectors from Ralstonia solanacearum with plants. Journal of Genetics and Genomics, 2023, 50(5): 341-352.), the pathogen that causes tobacco bacterial wilt, hereinafter referred to as Rastonia solanacearum.

[0038] 2) Phytophthora nicotianae, which causes tobacco black shank (provided by China Agricultural Microbiological Culture Collection Center), hereinafter referred to as Phytophthora nicotianae.

[0039] The culture medium preparation method used in the following examples is as follows:

[0040] LB liquid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, distilled water to 1000 mL, pH 7.0-7.2.

[0041] LB solid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 18 g agar, distilled water to 1000 mL, pH 7.0-7.2.

[0042] PDA medium: 200 g potato, 20 g glucose, 12 g agar, and distilled water to 1000 mL.

[0043] Inorganic phosphorus medium: 10 g glucose, 0.5 g (NH 4 ) 2 SO 4 , 0.2g NaCl, 0.2g KCl, 5.0g Ca 3 (PO 4 ) 2 , 0.03 g MgSO 4 7H 2 O, 0.03 g MnSO 4 , 0.003 g FeSO 4 , 0.5g yeast extract, 20g agar, distilled water to 1000mL, pH 6.8-7.0.

[0044] Montana organophosphate medium plate: glucose 10g, (NH 4 ) 2 SO 4 0.5 g, NaCl0.3g, KCl 0.3g, FeSO 4 7H 2 O 0.03g, MnSO 4 ·4H 2 O 0.03g, egg yolk lecithin 0.2g, CaCO 3 5 g, yeast extract 0.4 g, agar 15 g, distilled water to 1000 mL, pH 7.0.

[0045] Protease assay medium: peptone 10.0 g, NaCl 5.0 g, CaCl 2 0.1 g, skim milk 10.0 mL, 1.5% agar, distilled water to 1000 mL, pH 7.2-7.4.

[0046] Peptone ammoniation medium: peptone 5g, K 2 HPO 4 0.5 g, NaCl 0.25 g, MgSO 4 7H 2 O 0.5 g, FeSO 4 0.01 g, distilled water to 1000 mL.

[0047] Example 1: Isolation and identification of strain B. orbicola S8288

[0048] 1. Isolation of strain S8288

[0049] The strain S8288 was isolated from the rhizosphere soil of tobacco in Zunyi City, Guizhou Province. The collected soil was ground and sieved, and 5 g was weighed and added to a conical flask containing 45 mL of sterile water. The mixture was shaken at 28°C and 200 rpm for 1 hour. Then 1 mL of the supernatant was diluted to 10 by 10-fold gradient. -5 100 μL of each concentration was spread on the LB plate and placed in a 28°C constant temperature incubator. After 48 hours of culture, a single colony was picked and streaked on the LB plate, and the strain S8288 was obtained after purification.

[0050] 3. Identification of strain B. orbicola S8288

[0051] The strain S8288 isolated above was subjected to morphological observation and genetic evolution analysis and identification as follows:

[0052] The colony morphology was observed and reference was made to the Manual of Identification of Common Bacteria. The results showed that the colonies of B.orbicola S8288 on LB medium were beige, round, with neat edges, opaque and smooth surface. The most suitable growth temperature was 28-35℃.

[0053] Identification process: The strain S8288 was inoculated on LB solid medium and cultured at 28°C for 2 days. A small amount of monoclonal colonies were picked as templates and the 16S rRNA gene was amplified according to the 16S PCR amplification system.

[0054] 16S PCR reaction system: 30 μL, as follows:

[0055]

[0056] The total PCR reaction system was 30 μL.

[0057] PCR amplification procedure: step 1: pre-denaturation at 94°C for 5 min; step 2: denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min, 35 cycles; step 3: full extension at 72°C for 5 min; storage at 4°C.

[0058] According to the 16S rRNA (Seq ID No. 1) of strain S8288 obtained in EZBioCloud, the results showed that strain S8288 was similar to Burkholderia orbicola TAtl-371. TThe similarity reached 99.93%. Based on the 16S rRNA sequence of S8288 (Seq ID No.1), the phylogenetic tree was constructed by comparison analysis in EZBioCloud. Figure 1 As shown, strain S8288 was found to be similar to Burkholderia orbicola TAtl-371 T The strains were clustered into one branch and were closely related, so strain S8288 was identified as Burkholderia orbicola. The strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration (CGMCC) in October 2024, and its registration number is CGMCC NO.32293. Hereinafter referred to as B.orbicolaS8288.

[0059] Example 2: Antibacterial ability of strain B. orbicola S8288

[0060] Plant pathogens tested: Ralstonia solanacearum and Phytophthora nicotianae.

[0061] The plate confrontation method was used to conduct antagonism experiments on the above plant pathogens.

[0062] The method of the confrontation experiment with plant pathogenic bacteria Ralstonia solanacearum was as follows: NA medium was melted and cooled to 45°C, and then the concentration of pathogenic bacteria freshly cultured in NB medium was adjusted to 1×10 8 cfu / mL, mixed into NA medium at a ratio of 1:100, shake well and pour into plates. After drying, inoculate 5μL of B.orbicola S8288 fermentation liquid on the plate. Then place it at 28℃ and invert for culture. After 48h, observe and measure the diameter of the inhibition zone. Repeat 3 times for each treatment.

[0063] The method of the tobacco phytophthora confrontation experiment is as follows: use a 7mm diameter puncher to punch the freshly cultured tobacco phytophthora cake on the PDA plate, pick up the cake with an inoculation needle and inoculate it upside down in the center of a new PDA plate, then inoculate the S8288 fermentation liquid (5μL) freshly shaken in LB liquid to about 2.5cm on both sides of the cake, dry it and invert it at 25℃. After culturing for 2-3 days, observe and measure the width of the inhibition zone. Each treatment is repeated 3 times

[0064] The results showed that B.orbicola S8288 showed good antagonistic effects against plant pathogens such as Ralstonia solanacearum and Phytophthora nicotianae. Figure 2 This indicates that the strain has the potential for biological control of tobacco diseases and has development and application value.

[0065] Example 3: B. orbicola S8288 has the ability to dissolve potassium

[0066] The activated strain S8288 was inoculated into LB liquid culture medium and cultured overnight at 28°C and 220rpm. 10μL of the culture solution was spotted on a potassium-dissolving medium plate, and 10μL of LB liquid culture medium was spotted as a control treatment. Each treatment was repeated 3 times. After drying, the plate was inverted and cultured in a 28°C incubator for 7 days to observe whether oil droplets were formed. The results showed that on the plate inoculated with the culture solution of strain S8288, obvious oil droplets appeared around the inoculated colonies, such as Figure 3 As shown, it indicates that strain S8288 has the ability to dissolve potassium.

[0067] Example 4: Hydrolysis of Inorganic Phosphorus by B. orbicola S8288

[0068] Take 2μL of LB.orbicola S8288 culture solution and spot-spread it on the inorganic phosphate medium plate. Use 2μL of LB liquid as the control treatment. Repeat each treatment 3 times. After drying, invert and culture at 28℃ for 5-7 days to observe whether hydrolysis halos appear. The results show that there is no change in the control plate, while the plate inoculated with S8288 culture solution has obvious hydrolysis halos around the inoculated colonies, such as Figure 4 The results showed that B.orbicola S8288 could hydrolyze organic phosphorus and could be used to improve soil nutrients.

[0069] Example 5: Hydrolysis of organic phosphorus by strain B. orbicola S8288

[0070] Take 2 μL of LB.orbicola S8288 culture solution and spot-inoculate it on a plate with organophosphate medium of Montana. Use 2 μL of LB liquid as the control treatment. Repeat each treatment 3 times. After drying, invert and culture at 28℃ for 5-7 days to observe whether hydrolysis halos appear. The results show that there is no change on the control plate, while the plate inoculated with S8288 culture solution has obvious hydrolysis halos around the inoculated colonies, such as Figure 5 The results showed that B.orbicola S8288 could hydrolyze organic phosphorus and could be used to improve soil nutrients.

[0071] Example 6. Protease-producing ability of strain B. orbicola S8288

[0072] Take 2μL of LB.orbicola S8288 culture solution and spot it on the protease test medium plate, and spot it with 2μL of LB liquid as the control treatment. Repeat each treatment 3 times. After drying, invert and culture at 28℃ for 2 days to observe whether a transparent circle appears. The results showed that there was no change in the control plate, while the plate inoculated with S8288 culture solution had an obvious hydrolysis halo around the inoculated colony, such as Figure 6As shown, the protein in the plate was decomposed, proving that B.orbicola S8288 can produce protease to hydrolyze the protein in the environment.

[0073] Example 7: B. orbicola S8288 has the ability to produce ammonia

[0074] Take 50 μL of B.orbicola S8288 culture medium and transfer it to 5 mL of peptone ammoniation medium. Shake and culture at 28°C and 200 rpm for 48 hours. Take 100 μL of culture medium and drop it on a white ceramic plate. Use an equal volume of peptone ammoniation medium as a control. Add 3 drops of Nessler's reagent to the culture medium and peptone ammoniation medium respectively. The appearance of yellow or brownish red precipitate indicates that the strain has the ability to produce NH. 3 The results showed that no yellow or brownish red precipitate appeared in the control after adding Nessler's reagent, while obvious brownish red precipitate appeared in the culture medium of strain S8288 after adding Nessler's reagent. Figure 7 As shown, it was proved that the strain had the ability to produce ammonia.

[0075] Example 8: B. orbicola S8288 promotes tobacco growth

[0076] Four-week-old tobacco plants with uniform growth were selected for potted growth promotion experiments. A biocontrol bacteria treatment group and a control group were set up, with 6 plants in each group and 3 replicates. 2 The freshly shaken S8288 bacterial solution was prepared to a concentration of 1×10 8 CFU·mL -1 Each tobacco seedling was irrigated with 50 mL of the bacterial suspension at the root. 2 The height of tobacco plants was measured on the 30th day after root irrigation. Figure 8 As shown, the tobacco treated with the culture solution of strain S8288 after root irrigation had excellent growth compared with the control, with an average plant height of 23.03±3.47cm, which was significantly higher than the control group's plant height of 14.9±1.33cm.

[0077] Example 9: B. orbicola S8288 can induce plant cell death

[0078] The triggering of plant immunity is often accompanied by cell death and expression of immune-related genes. First, the ability of strain S8288 to induce cell death was tested. 2 Prepare the freshly shaken S8288 bacterial suspension into 5 × 10 8 CFU·mL -1 , 5×10 7 CFU·mL -1 , 5×106 CFU·mL -1 Then, the corresponding bacterial suspension was inoculated into tobacco leaves using a 1 ml sterile syringe at an inoculation concentration of 5 × 10 8 CFU·mL -1 The Pseudomonas mediterranea S58 suspension was used as the positive control (CK+) (GuY, Wang J, Xia Z, Wei HL. Characterization of a versatile plant growth-promoting rhizobacterium Pseudomonas mediterranea strain S58. Microorganisms, 2020, 8(3), 334; doi: 10.3390 / microorganisms8030334). 2 As negative control. Each treatment was repeated 6 times. 8 CFU·mL -1 , 5×10 7 CFU·mL -1 At the inoculum concentration, strain S8288 was able to induce significant cell death. 6 CFU·mL -1 No cell death was observed after Fig. 9 As shown. This indicates that the strain B.orbicola S8288 has the ability to induce cell death.

[0079] Example 10: B. orbicola S8288 can stimulate the expression of plant immunity-related genes

[0080] We further tested whether strain S8288 could stimulate the expression of plant immunity-related genes. 2 The freshly shaken S8288 bacterial solution was prepared into 1×10 5 CFU·mL -1 The bacterial suspension was then inoculated into tobacco leaves with a 1 ml syringe. Samples were taken 6 h after inoculation, and RNA was extracted using an RNA extraction kit (R6827-02, OMEGA, USA). RNA was then reverse transcribed into cDNA, and real-time fluorescence quantitative PCR was used to detect the expression of plant immunity-related genes NbPTI5 and NbWRKY22. 2The primers for detecting NbPTI5 were qNbPTI5-F (CCTCCAAGTTTGAGCTCG GATAGT) and qNbPTI5-R (CCAAGAAATTCTCCATGCACTCTGTC); the primers for detecting NbWRKY22 were qNbWRKY22-F (GCTCCATTTCCATCGT CTTAAC) and qNbWRKY22-R (GAAGTTGTGGTTCAAGCAATCT); the primers for detecting the internal reference gene NbEF1a were qNbEF1a-F (TGGACACAGGGACTTC ATCA) and qNbEF1a-R (CAAGGGTGAAAGCAAGCAAT). Fig.10 As shown, strain S8288 can significantly induce the expression of plant immunity-related genes such as NbPTI5 and NbWRKY22, indicating that strain S8288 has the ability to stimulate plant immunity.

[0081] Example 11: Experiment on the efficacy of strain B. orbicola S8288 against tobacco bacterial wilt

[0082] Four-week-old tobacco seedlings with uniform growth were selected for the prevention effect experiment. A healthy control group, a diseased control group, and a biocontrol bacteria treatment group were set up, with 12 plants in each group and repeated three times. 2 Root irrigation treatment: 3 days after treatment, the roots were wounded with a sharp tool and then irrigated with 50 mL of LB liquid medium. Disease control group: 50 mL of 10 mM MgCl 2 Tobacco was treated with root irrigation. 3 days after treatment, the roots were wounded with a sharp tool and irrigated with 50 mL 1×10 8 CFU·mL-1 suspension of Ralstonia solanacearum; treatment method of biocontrol bacteria treatment group: 50mL 1×10 8 CFU·mL -1 The roots were treated with S8288 suspension and irrigated with 50 mL 1×10 8 CFU·mL-1 suspension of Ralstonia solanacearum; then the tobacco in each treatment group was placed in a greenhouse environment for cultivation, and the disease situation was observed and recorded every day. On the 17th day after the pathogen was inoculated, the disease index and control effect were calculated, as shown in Table 1 below. The results showed that compared with the control, root irrigation pretreatment with the suspension of strain S8288 could significantly reduce the occurrence and severity of tobacco bacterial wilt, and the disease index was reduced to 48.15, and the greenhouse control efficiency reached 50%.

[0083] Incidence rate (%) = number of diseased plants / total number of treated plants × 100%;

[0084] Disease index = [∑(number of diseased plants at each level × corresponding disease level)] / (total number of plants surveyed × highest disease level) × 100;

[0085] Preventive and therapeutic effect (%) = (disease index of control group - disease index of treatment group) / disease index of control group × 100%.

[0086] The classification standards and investigation methods for tobacco bacterial wilt disease refer to "GB / T 23222-2008 Grading and Investigation Methods for Tobacco Pests and Diseases".

[0087] Table 1 Control effect of B.orbicola S8288 on tobacco bacterial wilt

[0088]

[0089] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A tobacco bacterial wilt biocontrol Burkholderia S8288, characterized in that: The Burkholderia S8288 was deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration in October 2024, and its deposit number is: CGMCC NO.32293. The 16S rRNA gene sequence of the Burkholderia S8288 strain is as SEQ ID No.

1.

2. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in preventing and / or treating tobacco bacterial wilt.

3. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in inhibiting Ralstonia solanacearum and Phytophthora nicotianae.

4. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in improving soil nutrition and promoting crop growth.

5. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in potassium solution.

6. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in hydrolyzing organic phosphorus and inorganic phosphorus.

7. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in producing protease.

8. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in producing ammonia.

9. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in increasing tobacco biomass.

10. Use of Burkholderia S8288 or its metabolites as claimed in claim 1 in stimulating plant immunity.

11. A fermentation broth of Burkholderia S8288 as claimed in claim 1, characterized in that: The fermentation broth contains Burkholderia S8288 bacteria and substances secreted into the culture medium. The preparation method of the fermentation broth is as follows: a single colony of freshly cultured strain Burkholderia S8288 is picked and inoculated into 2 mL LB liquid culture medium, and cultured at 28° C. and 200 rpm for 16 hours to obtain seed liquid, which is transferred to LB liquid culture medium at a ratio of 1:1000, and shake-cultured for 48 hours under the same conditions to finally obtain the fermentation broth of strain S8288, wherein the fermentation broth has at least one function of claims 2 to 10.

12. A culture of Burkholderia S8288 as claimed in claim 1, characterized in that The culture refers to the substance obtained by culturing Burkholderia S8288 in various microbial culture media, including the bacteria and secretions of Burkholderia, and the culture has at least one function of claims 2 to claim 10.

Images