Construction of engineering bacteria for improving formaldehyde tolerance and utilization capacity of monocarbon compound

Abstract

The invention discloses construction of an engineering bacterium for improving formaldehyde tolerance and utilization capacity of a one-carbon compound. Over-expressing a protein having the ability to reduce DNA damage on the genome of the recipient microorganism; and / or over-expressing a protein that reduces the protein damage ability on the genome of the recipient microorganism. On the basis, the utilization efficiency of the methylotrophic cells taking formaldehyde as a metabolic intermediate on the monocarbon compound is improved. The protein with DNA and protein damage reduced is co-expressed, the tolerance of the bacterial strain to formaldehyde and the utilization efficiency of a one-carbon compound are further improved, and the bacterial strain is applied to a synthetic route of a high-added-value biological product.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to the field of microbial synthetic biology, and specifically relates to the construction of an engineering bacterium capable of improving formaldehyde tolerance and one-carbon compound utilization ability. Background Art

[0002] By constructing microbial cell factories, high-value-added biomass products can be synthesized using cheap substrates, which is more efficient, green and sustainable than the current production method using petroleum as raw materials. Among the various available substrates, one-carbon compounds (such as methane, methanol, formic acid, formaldehyde and carbon dioxide) have attracted much attention due to their low cost and high abundance. Among them, methanol is considered to be an ideal one-carbon substrate in the chemical industry and biomanufacturing because it can be produced from carbon dioxide by photocatalysis or electrocatalysis. The cheap source and flexible production process reduce the production cost of methanol, thereby improving the competitiveness of biomanufacturing using methanol as a substrate. In addition, methanol is easy to store and transport, and is considered to be an excellent energy carrier and the cornerstone of the synthesis of complex chemicals. To date, methanol with high reducing power has been successfully used in the synthesis pathways of various alcohols, acids, fatty acids and hydrocarbons.

[0003] The core of methanol-based biomanufacturing lies in the construction of efficient microbial cell factories, so as to use methanol as a starting point to synthesize target compounds. There are methylotrophic bacteria in nature that can naturally utilize methanol, such as Bacillus methanolicus and Methylorubrum extorquens. However, there are still problems such as unclear genetic background and lack of genetic manipulation tools. In addition, the electron transport chain of natural methylotrophic bacteria has utilization of electron carriers for redox reactions, such as NAD(P)H, which is usually used to support cell growth rather than accumulation, which leads to a decrease in the availability of these reduction carriers in the synthesis of bioproducts. In order to achieve industrial-scale methanol biomanufacturing, it is necessary to develop a microbial platform that can efficiently convert methanol into valuable chemicals. Research on the improvement of artificial methylotrophic bacteria in synthetic biology has attracted much attention, mainly by converting classic chassis microorganisms such as Escherichia coli, Corynebacterium glutamicum and Saccharomyces cerevisiae into microorganisms that can utilize methanol to achieve this goal. Among them, the strategy of introducing natural methanol assimilation pathways into Escherichia coli is particularly favored by researchers, such as RuMP and XuMP pathways. As a key intermediate in one-carbon nutritional metabolism, formaldehyde directly participates in the oxidation reaction of one-carbon compounds, but its own toxicity will increase the growth and metabolic pressure of microorganisms. In the one-carbon utilization pathway, formaldehyde is catalyzed by formaldehyde dehydrogenase and formate dehydrogenase to produce CO 2, thus effectively preventing the accumulation of formaldehyde. However, this also leads to the direct loss of this key intermediate, which is undesirable from both an economic and energy perspective. Therefore, in the process of constructing an engineered E. coli for one-carbon substrates, the researchers addressed this problem by genetically inactivating the gene frmA encoding the enzyme responsible for catalyzing the conversion of formaldehyde to formate. This still leaves a pressing question: How can we effectively deal with the challenge of formaldehyde toxicity?

[0004] Formaldehyde causes severe cytotoxicity by producing chromosomal DNA damage, including DNA chain crosslinks, DNA-protein exchanges (DPCs), DNA chain breaks, and protein crosslinks. Due to the large size of DPCs, the binding of polymerases and repair proteins to DNA is hindered. Several studies have shown that proteases play a role in the hydrolysis of DPCs. In addition, formaldehyde reacts spontaneously with the amino and sulfur groups of proteins to generate thioproline, N- 6 -Toxic compounds such as formyl lysine and Schiff base. Therefore, obtaining strains with high formaldehyde tolerance by reducing the damage of formaldehyde to DNA and proteins has important scientific significance and application prospects. Summary of the invention

[0005] In order to solve the above problems, the present invention proposes a construction of an Escherichia coli with improved formaldehyde tolerance and one-carbon compound utilization ability; by constructing a strain with one-carbon compound utilization ability, a variety of high value-added products are synthesized. The present invention introduces genes with potential to alleviate DNA and protein damage by classification, and performs screening tests to obtain strains with improved formaldehyde tolerance. Subsequently, by introducing the transformation of methanol assimilation pathways and metabolic pathways, the ability of the engineered Escherichia coli to utilize one-carbon compounds is enhanced.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] <First aspect>:

[0008] The present invention provides an application of a recombinant microorganism in improving formaldehyde tolerance and one-carbon compound assimilation ability; the recombinant microorganism is achieved by overexpressing a protein with the ability to reduce DNA damage on the genome of a recipient microorganism; and / or, overexpressing a protein with the ability to reduce protein damage on the genome of the recipient microorganism.

[0009] The recombinant microorganism is used to improve formaldehyde tolerance and one-carbon compound assimilation ability by reducing DNA and protein damage in the recombinant microorganism.

[0010] The recipient microorganisms include Escherichia coli, Corynebacterium glutamicum, and yeast cells.

[0011] Application of DNA and protein damage in recipient microorganisms to improve formaldehyde tolerance and one-carbon compound assimilation capacity.

[0012] The amino acid sequence of the protein capable of reducing DNA damage is shown in any one of SEQ ID NO.1 to SEQ ID NO.8.

[0013] Proteins that have the ability to reduce DNA damage include ScWss1, SpWss1, Ddi1, SPRTN, GCNA1, TDP1, RAD4, and RAD52.

[0014] The amino acid sequence of ScWss1 is shown in SEQ ID NO.1; the amino acid sequence of SpWss1 is shown in SEQ ID NO.2; the amino acid sequence of Ddi1 is shown in SEQ ID NO.3; the amino acid sequence of SPRTN is shown in SEQ ID NO.4; the amino acid sequence of GCNA1 is shown in SEQ ID NO.5; the amino acid sequence of TDP1 is shown in SEQ ID NO.6; the amino acid sequence of RAD4 is shown in SEQ ID NO.7; and the amino acid sequence of RAD52 is shown in SEQ ID NO.8.

[0015] The protein that reduces protein damage ability includes detoxifying thioproline or N 6 -Formyl-lysine protein.

[0016] The amino acid sequence of the protein capable of reducing protein damage is shown in any one of SEQ ID NO.9 to SEQ ID NO.18.

[0017] Proteins that reduce the ability to damage proteins include PepP, PepQ, XPNPEP1, YpdF, Q9RUY4, SrtN, SirA, CobB, SIRT1, and SIRT2.

[0018] The amino acid sequence of PepP is shown in SEQ ID NO.9; the amino acid sequence of PepQ is shown in SEQ ID NO.10; the amino acid sequence of XPNPEP1 is shown in SEQ ID NO.11; the amino acid sequence of YpdF is shown in SEQ ID NO.12; the amino acid sequence of Q9RUY4 is shown in SEQ ID NO.13; the amino acid sequence of SrtN is shown in SEQ ID NO.14; the amino acid sequence of SirA is shown in SEQ ID NO.15; the amino acid sequence of CobB is shown in SEQ ID NO.16; the amino acid sequence of SIRT1 is shown in SEQ ID NO.17; and the amino acid sequence of SIRT2 is shown in SEQ ID NO.18.

[0019] By introducing detoxifying proline or N 6 The amino acid sequence encoded by the protein is shown in any one of SEQ ID NO.9 to SEQ ID NO.18.

[0020] <Second Aspect>:

[0021] This study provides a recombinant Escherichia coli with improved formaldehyde tolerance, wherein the gene encoding methylglyoxal synthase mgsA in the Escherichia coli is replaced with a gene encoding a protein that reduces DNA damage, and the protein that reduces DNA damage is overexpressed to obtain the recombinant Escherichia coli;

[0022] And / or, the amino acid sequence of the protein that reduces DNA damage is shown in any one of SEQ ID NO.1 to SEQ ID NO.8;

[0023] The nucleotide sequence of the gene encoding methylglyoxal synthase, mgsA, is shown in SEQ ID NO.28;

[0024] The Escherichia coli is selected from E. coli MG1655.

[0025] A protein that reduces DNA damage is overexpressed by an artificial promoter element; the artificial promoter element is M1-93, and the nucleotide sequence of M1-93 is shown in SEQ ID NO.29.

[0026] <Third Aspect>:

[0027] This study provides a recombinant Escherichia coli with improved formaldehyde tolerance, wherein the gene encoding methylglyoxal synthase mgsA in the Escherichia coli is replaced with a gene encoding a protein that reduces protein damage, and the protein with the ability to reduce protein damage is overexpressed to obtain the resulting recombinant Escherichia coli; the amino acid sequence encoding the protein that reduces protein damage is shown in any one of SEQ ID NO.9-SEQ ID NO.18.

[0028] The nucleotide sequence of the gene encoding methylglyoxal synthase, mgsA, is shown in SEQ ID NO.28.

[0029] The Escherichia coli is selected from E. coli MG1655.

[0030] A protein that reduces protein damage ability is overexpressed by an artificial promoter element; the artificial promoter element is M1-93, and the nucleotide sequence of M1-93 is shown in SEQ ID NO.29.

[0031] <Fourth Aspect>:

[0032] This study provides a recombinant Escherichia coli with improved formaldehyde tolerance, wherein the gene encoding methylglyoxal synthase, mgsA, in the Escherichia coli is replaced with a combination of genes encoding two proteins, PepP and GCNA1, and the combination of PepP and GCNA1 is overexpressed; PepP and GCNA1 are connected by an RBS region, and the nucleotide sequence of the RBS region is shown in any one of SEQ ID NO.19-SEQ ID NO.27.

[0033] The amino acid sequence of PepP is shown in SEQ ID NO.9.

[0034] The amino acid sequence of GCNA1 is shown in SEQ ID NO.5.

[0035] The Escherichia coli is selected from E. coli MG1655.

[0036] The overexpression of the introduced protein is achieved by upregulating an artificial promoter element, wherein the artificial promoter element is M1-93; the nucleotide sequence of M1-93 is shown in SEQ ID NO.29.

[0037] <Fifth Aspect>:

[0038] The invention provides a chassis cell precursor for improving the utilization efficiency of one-carbon compounds. The frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A are knocked out on the basis of E.coliMG1655 (DE3).

[0039] The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31.

[0040] <Sixth Aspect>:

[0041] The present invention provides a chassis cell with improved one-carbon compound utilization ability. The chassis cell precursor is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A in E. coli MG1655 (DE3). The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31.

[0042] The method is obtained by replacing the gene encoding methylglyoxal synthase mgsA with a gene encoding a protein that reduces DNA damage in a chassis cell precursor, and by knocking out at least one of the following genes:

[0043] rpiB gene encoding ribose phosphate isomerase B;

[0044] The cyaA gene encodes adenylate cyclase.

[0045] The amino acid sequence of the protein that reduces DNA damage is shown in any one of SEQ ID NO.1-SEQ ID NO.8, and the nucleotide sequence encoding mgsA is shown in SEQ ID NO.28. The rpiB gene encoding ribose phosphate isomerase B is shown in SEQ ID NO.32, and the cyaA gene encoding adenylate cyclase is shown in SEQ ID NO.33.

[0046] <Seventh Aspect>:

[0047] The present invention provides a chassis cell for improving the utilization capacity of one-carbon compounds. The chassis cell precursor is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A in E. coli MG1655 (DE3). The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31.

[0048] The present invention is obtained by replacing the gene encoding methylglyoxal synthase mgsA with a gene encoding a protein that reduces protein damage in a chassis cell precursor, and knocking out at least one of the following genes:

[0049] rpiB gene encoding ribose phosphate isomerase B;

[0050] The cyaA gene encodes adenylate cyclase.

[0051] The protein sequence encoding the ability to reduce protein damage is shown in any one of SEQ ID NO.9 to SEQ ID NO.18. The rpiB gene encoding ribose phosphate isomerase B is shown in SEQ ID NO.32, and the cyaA gene encoding adenylate cyclase is shown in SEQ ID NO.33.

[0052] <Eighth Aspect>:

[0053] The present invention provides a chassis cell with improved one-carbon compound utilization ability. The chassis cell precursor is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A in E. coli MG1655 (DE3). The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31.

[0054] The method is obtained by replacing the gene encoding methylglyoxal synthase mgsA with a combination of genes encoding two proteins PepP and GCNA1 in the chassis cell precursor, and knocking out at least one of the following genes:

[0055] rpiB gene encoding ribose phosphate isomerase B;

[0056] The cyaA gene encodes adenylate cyclase.

[0057] Among them, PepP and GCNA1 are connected by a RBS region, the nucleotide sequence of the RBS region is shown in any one of SEQ ID NO.19-SEQ ID NO.27, and the nucleotide sequence encoding mgsA is shown in SEQ ID NO.28. The rpiB gene encoding ribose phosphate isomerase B is shown in SEQ ID NO.32, and the cyaA gene encoding adenylate cyclase is shown in SEQ ID NO.33.

[0058] <Ninth Aspect>:

[0059] The present invention provides a microbial cell factory for improving the one-carbon compound utilization ability of Escherichia coli, and introduces the RuMP pathway into the constructed chassis cells, including introducing the mdh gene from Copperobacterium necrotum, the hps gene and the phi gene from Bacillus methanolicus.

[0060] The nucleotide sequence of the mdh gene is shown in SEQ ID NO.34; the nucleotide sequence of the hps gene is shown in SEQ ID NO.35; the nucleotide sequence of the phi gene is shown in SEQ ID NO.36;

[0061] <Tenth Aspect>:

[0062] The present invention provides the application of microbial cell factories in synthesizing high value-added products using one-carbon compounds, including but not limited to synthesizing 3-hydroxypropionic acid, triacetic acid lactone, flavonoids, long-chain fatty acids, and the like.

[0063] The amino acid sequence of the protein capable of reducing DNA damage is shown in any one of SEQ ID NO.1 to SEQ ID NO.8.

[0064] Proteases with the ability to reduce DNA damage include ScWss1, SpWss1, Ddi1, SPRTN, GCNA1, TDP1, RAD4, and RAD52.

[0065] The amino acid sequence of ScWss1 is shown in SEQ ID NO.1; the amino acid sequence of SpWss1 is shown in SEQ ID NO.2; the amino acid sequence of Ddi1 is shown in SEQ ID NO.3; the amino acid sequence of SPRTN is shown in SEQ ID NO.4; the amino acid sequence of GCNA1 is shown in SEQ ID NO.5; the amino acid sequence of TDP1 is shown in SEQ ID NO.6; the amino acid sequence of RAD4 is shown in SEQ ID NO.7; and the amino acid sequence of RAD52 is shown in SEQ ID NO.8.

[0066] The protein that reduces protein damage ability includes detoxifying thioproline or N 6 -Formyl-lysine protein.

[0067] The amino acid sequence of the protein capable of reducing protein damage is shown in any one of SEQ ID NO.9 to SEQ ID NO.18.

[0068] Proteins that reduce the ability to damage proteins include PepP, PepQ, XPNPEP1, YpdF, Q9RUY4, SrtN, SirA, CobB, SIRT1, and SIRT2.

[0069] The amino acid sequence of PepP is shown in SEQ ID NO.9; the amino acid sequence of PepQ is shown in SEQ ID NO.10; the amino acid sequence of XPNPEP1 is shown in SEQ ID NO.11; the amino acid sequence of YpdF is shown in SEQ ID NO.12; the amino acid sequence of Q9RUY4 is shown in SEQ ID NO.13; the amino acid sequence of SrtN is shown in SEQ ID NO.14; the amino acid sequence of SirA is shown in SEQ ID NO.15; the amino acid sequence of CobB is shown in SEQ ID NO.16; the amino acid sequence of SIRT1 is shown in SEQ ID NO.17; and the amino acid sequence of SIRT2 is shown in SEQ ID NO.18.

[0070] Compared with the prior art, the present invention has the following beneficial effects:

[0071] 1. The present invention uses CRISPR gene editing technology to overexpress GCAN1 and PepP proteins at the mgsA site of Escherichia coli MG1655, alleviates the DNA and protein damage caused by formaldehyde, and effectively improves the formaldehyde tolerance of Escherichia coli.

[0072] 2. The D5 strain (MG1655ΔmgsA::M1-93-gcna1) and P1 strain (MG1655

[0073] ΔmgsA::M1-93-pepP) and PD4 strain (MG1655ΔmgsA::M1-93-pepP-RBS4-gcna1)

[0074] Improved tolerance to formaldehyde.

[0075] 3. The MD5 strain (MG1655 (DE3) ΔmgsA::M1-93-gcna1 ΔfrmA ΔrpiA ΔrpiB ΔcyaA (pCDF-RuMP)), MP1 strain (MG1655 (DE3) ΔmgsA::M1-93-pepP ΔfrmA ΔrpiA ΔrpiB ΔcyaA (pCDF-RuMP)) and MPD4 strain (MG1655 (DE3)

[0076] ΔmgsA::M1-93-pepP-RBS4-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP)) improved the ability to utilize one-carbon compounds.

[0077] The present invention adopts CRISPR gene editing technology to replace the coding gene mgsA encoding methylglyoxal synthase with the coding gene of protease GCNA1 and the coding gene of proline aminopeptidase PepP, and uses artificial promoter M1-93 to upregulate the expression of the above genes, and these operations significantly improve the strain's tolerance to formaldehyde. The frmA and rpiA genes are knocked out on the MG1655 (DE3) gene by CRISPR gene editing technology, and the rpiB and cyaA genes are continued to be knocked out after overexpressing GCAN1 and / or PepP proteins, and the RuMP pathway is introduced into the chassis cells, thereby constructing an Escherichia coli chassis cell with methanol assimilation ability. Next, through the coordinated combination of the two genes, the methanol utilization efficiency of the chassis cells is further improved, and the products of various high value-added biological products are finally realized. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0079] Figure 1 Schematic diagram of the damage reaction caused by formaldehyde, an important intermediate in one-carbon metabolism.

[0080] Figure 2 Effects of different concentrations of methanol, formic acid, and formaldehyde on the growth of Escherichia coli MG1655. (A) Methanol; (B) Formic acid; (C) Formaldehyde.

[0081] Figure 3Formaldehyde-induced protein damage, DPC coefficient, and ROS level in E. coli. (A) Protein concentration in the supernatant of E. coli MG1655 after exposure to 1–10 mM formaldehyde for 10 hours; (B) Protein gel of the supernatant of MG1655 after treatment with 1-10 mM formaldehyde for 10 hours; (C) DPC coefficient of MG1655 after treatment with 0, 1, 3, and 10 mM formaldehyde for 10 hours; (D) ROS level of MG1655 after treatment with 0, 1, 2, and 5 mM formaldehyde for 10 hours.

[0082] Figure 4 The percentage increase in specific growth rate after different genes with the potential to alleviate DPC were inserted into the mgsA site of MG1655 was detected using a microplate reader under the addition of 1 mM formaldehyde.

[0083] Figure 5 OD of the control bacteria CK0 and the engineered bacteria D5 after culturing in 0mM / 1.2mM formaldehyde for 35 hours in a 50mL centrifuge tube 550 value.

[0084] Figure 6 Detoxification of proline and N 6 -Two classes of genes with potential for formyl-lysine.

[0085] Figure 7 The percentage increase of specific growth rate after different genes with the potential to alleviate protein damage were inserted into the mgsA site of MG1655 was detected using a microplate reader under the addition of 1 mM formaldehyde.

[0086] Figure 8 OD of the control bacteria CK0 and the engineered bacteria P1 after culturing in 0mM / 1.2mM formaldehyde for 35 hours in a 50mL centrifuge tube 550 value.

[0087] Fig. 9 DPC coefficients of CK0 and D5 strains after treatment with 0 mM / 5 mM formaldehyde for 10 hours.

[0088] Fig.10 Growth curves of CK0 and P1 strains under 0 mM / 3 mM thioproline addition conditions. (A) 0 mM thioproline; (B) 3 mM thioproline.

[0089] Fig.11 Schematic diagram of genetic manipulations for the construction of methanol-utilizing Escherichia coli chassis cells.

[0090] Fig.12 The growth curves of MCK0, MD5 and MP1 strains in 50 mL centrifuge tubes in medium containing different concentrations of methanol. (A) MCK0 strain; (B) MD5 strain; (C) MP1 strain.

[0091] Fig.13 Growth curves of MCK0 and MD5 strains in MOPS medium containing 600 mM methanol and 50 mM xylose, and the consumption of methanol and xylose for the shake flask test. (A) MCK0 strain; (B) MD5 strain; (C) Shake flask photos of the growth of MCK0 and MD5 strains.

[0092] Fig.14 Growth curves of MCK0 and MP1 strains in MOPS medium containing 600 mM methanol and 50 mM xylose, and the consumption of methanol and xylose for the shake flask test. (A) MCK0 strain; (B) MP1 strain; (C) Shake flask photos of the growth of MCK0 and MP1 strains.

[0093] Fig.15 The growth comparison of strains corresponding to different RBS regions in MOPS medium supplemented with 600 mM methanol and 50 mM xylose in a 50 mL centrifuge tube.

[0094] Fig.16 is the specific growth rate growth rate of P1, D5 and PD4 strains at 1 mM formaldehyde concentration.

[0095] Fig.17 OD of the control bacteria CK0 and the engineered bacteria PD4 after culturing in 0mM / 1.2mM formaldehyde for 35 hours in a centrifuge tube 550 value.

[0096] Fig.18 Figure 2 shows the growth curves of CK0 and PD4 strains under the conditions of 0 mM / 3 mM thioproline addition.

[0097] Fig.19 DPC damage coefficient of CK0 and PD4 strains after treatment with 0mM / 5mM formaldehyde for 10 hours.

[0098] Fig. 20 The figure shows the growth curve of the MPD4 strain in a 50 mL centrifuge tube in medium containing different concentrations of methanol.

[0099] Fig.21 Growth curve of MPD4 strain in MOPS medium containing 600 mM methanol and 50 mM xylose, and the consumption of methanol and xylose for the shake flask test.

[0100] Fig. 22 It is the intracellular formaldehyde concentration of MCK0, MD5, MP1 and MPD4 strains after 2 days of fermentation.

[0101] Fig.23is the DPC damage coefficient of MCK0, MD5, MP1 and MPD4 strains after 2 days of fermentation.

[0102] Fig.24 ROS accumulation levels of MCK0, MD5, MP1 and MPD4 strains after 2 and 3 days of fermentation.

[0103] Fig.25 The growth of engineered strain MPD4 in different culture media. (A) Fed-batch fermentation of MPD4 strain in MOPS medium containing 500mM methanol and 50mM xylose, the growth curve, methanol and xylose consumption were measured; (B) The growth of MPD4 strain without methanol addition, only xylose addition. (C) The growth of MPD4 strain with xylose and glucose addition.

[0104] Fig.26 Methanol metabolic flux 13 C marker. (A) Derived from 13 C is a marker of the abundance of intracellular metabolites of methanol; (B) 13 C Methanol is a marker for amino acid abundance.

[0105] Fig. 27 The product display of 3-HP synthesis using methanol and xylose as substrates. (A) Schematic diagram of 3-HP biosynthesis; (B) Photos of shake flask fermentation of MCK0+pET-3-HP (left) and MPD4+pET-3-HP (right) in MOPS medium containing 500mM methanol and 50mM xylose; (C) and (D) are the growth curves, methanol and xylose consumption, and 3-HP production of MCK0+pET-3-HP (left) and MPD4+pET-3-HP (right).

[0106] Fig.28 The product display of TAL synthesis using methanol and xylose as substrates. (A) Schematic diagram of TAL biosynthesis; (B) Photos of shake flask fermentation of MCK0+pTrc99a-TAL (left) and MPD4+pTrc99a-TAL (right) in MOPS medium containing 500mM methanol and 50mM xylose; (C) and (D) are the growth curves, methanol and xylose consumption, and TAL production of MCK0+pTrc99a-TAL (left) and MPD4+pTrc99a-TAL (right).

[0107] Fig.29The product display of the synthesis of flaviolin using methanol and xylose as substrates. (A) Schematic diagram of the biosynthesis plasmid of RuMP and flaviolin in the ribulose monophosphate pathway; (B) Photos of shake flask fermentation of MCK0+pCum-rppA (left) and MPD4+pCum-rppA (right) in MOPS medium containing 500mM methanol and 50mM xylose; (C) and (D) are the growth curves, methanol and xylose consumption, and flaviolin yield of MCK0+pCum-rppA (left) and MPD4+pCum-rppA (right).

[0108] Fig.30 The product display of long-chain fatty acids synthesized using methanol and xylose as substrates. (A) Schematic diagram of RuMP and long-chain fatty acid biosynthesis plasmids; (B) Photos of shake flask fermentation of MCK0+pTrc99a-pXZ18Z (left) and MPD4+pTrc99a-pXZ18Z (right) in MOPS medium containing 500mM methanol and 50mM xylose; (C) and (D) are the growth curves, methanol and xylose consumption, and long-chain fatty acid production of MCK0+pTrc99a-pXZ18Z (left) and MPD4+pTrc99a-pXZ18Z (right).

[0109] Fig.31 Schematic diagram of the strategy of overexpressing PepP and GCNA1 proteins to improve formaldehyde tolerance and methanol assimilation efficiency and achieve the synthesis of high value-added products. DETAILED DESCRIPTION

[0110] The specific embodiments of the present invention are described in further detail below in conjunction with examples. The following examples are used to illustrate the present invention and will help those skilled in the art to further understand the present invention, but are not intended to limit the scope of the present invention. It should be noted that, for those of ordinary skill in the art, some changes and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0111] The present invention provides the construction and product display of an engineered bacterium, aiming to improve the tolerance of Escherichia coli to formaldehyde and the ability to utilize one-carbon compounds. By overexpressing protease and proline aminopeptidase on the Escherichia coli genome, the degree of damage to DNA and protein was successfully reduced, and the tolerance of the strain to formaldehyde was effectively enhanced. On this basis, the introduction of the RuMP pathway improved the utilization efficiency of Escherichia coli to one-carbon compounds, and the combined expression of GCNA1 and PepP proteins further significantly optimized the growth and utilization efficiency of the strain. The main characteristics of the recombinant bacteria include: A. Overexpression of the protease encoding gene gcna1; B. Overexpression of the proline aminopeptidase encoding gene pepP; C. Introduction of the RuMP pathway; D. Combined expression of gcna1 and pepP genes, and the strain with the highest growth rate was obtained by optimizing the connection region, further improving the tolerance to formaldehyde and the ability to utilize one-carbon compounds.

[0112] Table 1 Plasmids used in the present invention

[0113] name source PcqI Purchased from addgene pEcgRNA Purchased from addgene pEcgRNA-mgsA The present invention constructs (SEQ ID NO.37) pEcgRNA-frmA The present invention constructs (SEQ ID NO.38) pEcgRNA-rpiA The present invention constructs (SEQ ID NO.39) pEcgRNA-rpiB The present invention constructs (SEQ ID NO.40) pKD46 Purchased from BioVector pCDF-Duet Purchased from Novagen pCDF-RuMP The present invention constructs (SEQ ID NO.41) pKD4 plasmid Beijing Huayueyang Biotechnology

[0114] Table 2 Strains used for tolerance testing of the present invention

[0115]

[0116]

[0117] Table 3 The strains used for methanol utilization test of the present invention

[0118]

[0119]

[0120] Table 4 Nucleotide sequence of the RBS region between genes pepP and gcna1

[0121]

[0122]

[0123] Table 5 Related amino acid and nucleotide sequences in the present invention

[0124]

[0125]

[0126] Example 1 Construction of CRISPR gene editing system of E. coli MG1655

[0127] 1. Prepare the electroporation competent cells of E. coli MG1655. The specific steps are as follows:

[0128] a. Inoculate E. coli MG1655 strain into LB liquid medium and culture overnight at 37°C and 220 rpm.

[0129] b. The next morning, inoculate 20 mL of LB medium at a 1% (v / v) inoculum and culture at 37°C and 220 rpm until OD 550 When the concentration reaches 0.3-0.5, transfer into a sterile centrifuge tube and incubate on ice for 30 min.

[0130] c. Centrifuge at 4°C, 6000 rpm for 5 min, pour off the supernatant in a clean bench, and add 2 mL of pre-cooled sterile ddH 2 O to resuspend the cells, and then continue to add ddHO 2 0 to about 30 mL. Centrifuge at 4°C, 6000 rpm for 5 min, then use sterile ddH 2 Wash the cells again.

[0131] d. Add 2 mL of pre-cooled sterile 10% glycerol to the centrifuge tube, resuspend the cells and continue to add to about 30 mL. Centrifuge at 4°C, 6000 rpm for 5 min, discard the supernatant, add 0.5 mL of 10% glycerol to resuspend, and dispense into pre-cooled sterile 1.5 mL EP tubes at a volume of 50 μL per tube. Electroporation competent cells are generally prepared and used immediately.

[0132] 2. Construction of MG1655 (pEcCas)

[0133] Transform the pEcCas plasmid into MG1655 competent cells. The specific steps are as follows:

[0134] a. Add 100 ng of pEcCas plasmid to the prepared MG1655 competent cells, mix gently, and place on ice for 5 min;

[0135] b. Transfer the mixture from step a to a pre-cooled 2 mm electroporation cup and place on ice for 2 min; at the same time, set the voltage parameter of the electroporator to 2.5 kV;

[0136] c. Take out the electroporation cup from the ice, wipe the surface with a paper towel, and put it into the electroporator for electroporation. Immediately after the electroporation, add 600 μL of LB liquid culture medium, resuspend the cells, and place them at 37°C, 220rpm for 2 hours. Centrifuge briefly and remove most of the supernatant, then resuspend the remaining cells and spread them all on the LB plate containing 50 μg / mL kanamycin, invert and place in a 37°C incubator for overnight culture.

[0137] d. The next day, a single colony was picked from the plate for extended culture and strain preservation. The resulting strain was named MG1655 (pEcCas).

[0138] 3. Prepare the electroporation competent state of MG1655 (pEcCas). This process requires the addition of L-arabinose to induce the pEcCas plasmid. The specific steps are as follows:

[0139] a. The MG1655 (pEcCas) strain was inoculated into LB liquid medium containing 50 μg / mL of kanamycin resistance and cultured overnight at 37°C and 220 rpm.

[0140] b. The next morning, inoculate 20 mL of LB (50 μg / mL kanamycin, 10 mM L-arabinose) medium at a 1% (v / v) inoculum and culture at 37°C and 220 rpm until OD 550 When the concentration reaches 0.3-0.5, transfer into a sterile centrifuge tube and incubate on ice for 30 min.

[0141] c. Centrifuge at 6000 rpm for 5 min at 4°C. Pour off the supernatant in a clean bench and add 2 mL of pre-cooled sterile ddH 2 O to resuspend the cells, and then continue to add ddHO 2 Centrifuge at 4°C, 6000 rpm for 5 min, and then use sterile ddH 2 Wash the cells again.

[0142] d. Add 2 mL of pre-cooled sterile 10% glycerol to the centrifuge tube, resuspend the cells and continue to add to about 30 mL. Centrifuge at 4°C, 6000 rpm for 5 min, discard the supernatant, add 0.5 mL of 10% glycerol to resuspend, and then dispense 50 μL per tube into pre-cooled sterile 1.5 mL EP tubes to obtain the electroporation competent state of MG1655 (pEcCas). The electroporation competent state is generally used immediately.

[0143] 4. Construction of strain MG1655ΔmgsA (containing pEcgRNA-mgsA and pEcCas)

[0144] Taking the knockout of mgsA gene in the Escherichia coli MG1655 genome as an example, pEcgRNA-mgsA and Donor DNA-mgsA were transferred into the electroporation competent state of MG1655 (pEcCas).

[0145] 4.1. First, the pEcgRNA-mgsA plasmid was constructed. The steps are as follows:

[0146] Primers were designed based on the upstream and downstream sequences of the Escherichia coli mgsA gene. According to the Escherichia coli genome sequence published on NCBI, the methylglyoxal synthase mgsA (Accession IDs: G6497 (EcoCyc)) sequence was found, the cleavage site N20 (AACGTCAACGCGATGTTGAG) was selected at the mgsA site, and the reverse primers (SEQ ID NO.42 and SEQ ID NO.43) of the pEcgRNA full plasmid PCR were designed and amplified to obtain the pEcgRNA-mgsA (sequence see SEQ ID NO.37) plasmid. The primer sequences are as follows:

[0147] SEQ ID NO.42:AACGTCAACGCGATGTTGAGGTTTTAGAGCTAGAAATAGC

[0148] SEQ ID NO. 43: CTCAACATCGCGTTGACGTTACTAGTATTATACCTAGGAC.

[0149] 4.2. Then, obtain the Donor DNA-mgsA fragment. The operation steps are as follows:

[0150] a. First, amplify the upstream homology arm of mgsA knockout, the template is Escherichia coli K-12substr.MG1655(DE3) genome (NCBI accession number: ASM584v2), and the primer sequences used are as follows:

[0151] SEQ ID NO.44:TCACATGAGGCCTGCCAG

[0152] SEQ ID NO. 45: ATCCAGTCGCCGCATTTCAA.

[0153] b. Re-amplify the downstream homology arm of mgsA knockout, the template is Escherichia coli K-12substr.MG1655(DE3), and the primer sequences used are as follows:

[0154] SEQ ID NO.46:TTGAAATGCGGCGACTGGATCGTCCACCCAGCTCATCAG

[0155] SEQ ID NO. 47:GATTCCGGTAAAGCTGGATA.

[0156] c. Amplify the mgsA knockout Donor DNA-mgsA fragment, the template is the upstream homology arm of mgsA knockout in a and the downstream homology arm fragment of mgsA knockout in b, the primer sequences used are as follows:

[0157] SEQ ID NO.48:CAACACGCTGGCCGAAGT

[0158] SEQ ID NO. 49: CTCGCCATTACCTCAACGG.

[0159] 4.3. The detailed steps of electroporation are as follows:

[0160] a. Add 100 ng of pEcgRNA-ΔmgsA plasmid and 400 ng of Donor DNA-mgsA fragment to the pre-prepared competent MG1655 (pEcCas), mix gently and incubate on ice for 5 min;

[0161] b. Transfer the mixture to a pre-cooled 2 mm electroporation cup and place on ice for 2 min. Set the voltage parameter of the electroporator to 2.5 kV.

[0162] c. Take out the electroporation cup from the ice, wipe the surface with a paper towel, and put it into the electroporator for electroporation. Immediately after the electroporation, add 600 μL of LB liquid culture medium, resuspend the cells, and place them at 37°C, 220rpm for 2 hours of recovery. Centrifuge briefly and remove most of the supernatant, resuspend the remaining cells, and spread them all on the LB plate containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin, and invert and place them in a 37°C incubator for overnight culture.

[0163] d. The next day, single colonies on the plate were picked for colony PCR verification. The verification primers were (SEQ ID NO.44 and SEQ ID NO.47), thereby obtaining the correct gene-edited strain MG1655ΔmgsA (containing pEcgRNA-mgsA and pEcCas).

[0164] SEQ ID NO.44:TCACATGAGGCCTGCCAG

[0165] SEQ ID NO. 47: GATTCCGGTAAAGCTGGATA.

[0166] 5. Elimination of pEcgRNA plasmid

[0167] After obtaining the correct gene editing strain MG1655ΔmgsA (containing pEcgRNA-mgsA and pEcCas), since it carries pEcgRNA-mgsA and pEcCas plasmids, plasmid elimination steps need to be performed in sequence. First, eliminate the pEcgRNA-mgsA plasmid, the steps are as follows:

[0168] a. Inoculate the verified correct gene editing strain MG1655ΔmgsA (containing pEcgRNA-mgsA and pEcCas) into 5 mL of LB liquid medium (containing 50 μg / mL kanamycin and 10 mM rhamnose), culture overnight at 37°C, 220 rpm. The next day, use an inoculation loop to dip an appropriate amount of bacterial liquid and streak it onto a solid LB plate containing 50 μg / mL kanamycin.

[0169] b. Pick about 10 single colonies, streak them one by one on a double-resistance plate containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin, and a single-resistance plate containing 50 μg / mL kanamycin, and culture them at 37°C. Pick a single colony that cannot grow on a double-resistance plate but can only grow on a kanamycin-resistant plate, which is a colony that has successfully eliminated the pEcgRNA plasmid, expand the culture and preserve the strain, named MG1655ΔmgsA (containing pEcgRNA-mgsA), and you can continue to perform gene editing operations on this strain. If no gene editing operations are performed in the future, the pEcCas plasmid needs to be knocked out.

[0170] 6. Elimination of pEcCas plasmid

[0171] The strain MG1655ΔmgsA (containing pEcgRNA-mgsA) was inoculated into LB medium without antibiotics, cultured overnight at 37°C and 220rpm, and streaked onto an LB plate containing 10 g / L sucrose the next day, inverted and cultured at 37°C for 12 hours to isolate single colonies. Then about 10 single colonies were picked, streaked onto plates containing 50 μg / mL kanamycin and no antibiotics, and cultured statically at 37°C. Pick a single colony that cannot grow on kanamycin but can only grow on a plate without antibiotics, that is, a colony that has successfully eliminated the pEcCas plasmid, and obtain the strain MG1655ΔmgsA, named strain CK0.

[0172] Example 2: Construction of the mgsA locus gene of MG1655 inserted into strains D1-D8 and strains P1-P10

[0173] 1. Use PCR method to amplify the upstream and downstream homologous arms of mgsA and the inserted gene respectively.

[0174] a. Amplify the upstream homology arm of mgsA. The template is the MG1655 M1-93-SMO strain reported in the literature (Sun, WJ et al. Integration of (S)-2,3-oxidosqualene enables to become Iron Man with improved overall tolerance. Biotechnol Biof Biop 16, doi: ARTN 19110.1186 / s13068-023-02444-7(2023).). The strain is characterized by containing an M1-93 constitutive promoter at the mgsA site. The primers for amplifying the upstream homology arm use SEQ ID NO.44 and SEQ ID NO.45. The primer sequences are as follows:

[0175] SEQ ID NO.44:TCACATGAGGCCTGCCAG

[0176] SEQ ID NO.45:ATCCAGTCGCCGCATTTCAA

[0177] b. The primers for amplifying the downstream homology arm of mgsA use SEQ ID NO.50 and SEQ ID NO.47, the template is MG1655M1-93-SMO bacteria, and the primer sequences are as follows:

[0178] SEQ ID NO.50:CGTTCCACCCAGCTCATCAG

[0179] SEQ ID NO.47:GATTCCGGTAAAGCTGGATA

[0180] c. Amplify and insert gene fragments, including 8 genes that reduce DNA damage and 10 genes that reduce protein damage. The detailed information and operation steps are as follows:

[0181] 1) Amplification of ScWss1 gene fragment: The amino acid sequence encoded by ScWss1 is SEQ ID NO.1. The template used for PCR amplification is the genome of Saccharomyces cerevisiae (NCBI accession number: ASM2117220v1). The designed primers retain 20 bp of homologous sequences with the upstream and downstream homologous arms of mgsA. The specific primer sequences are shown in SEQ ID NO.51 and SEQ ID NO.52.

[0182] SEQ ID NO.51:

[0183] GTTTAAACCAGGAAACAGCTATGAAGACAGAAGGAATAAAAAGC

[0184] SEQ ID NO.52:

[0185] CTGATGAGCTGGTGGAACGTTAAGTGAGATCAATAACTTCGATAAG

[0186] 2) Amplification of SpWss1 gene fragment: The amino acid sequence encoded by SpWss1 is SEQ ID NO.2. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.53 and SEQ ID NO.54 to obtain the SpWss1 gene fragment.

[0187] SEQ ID NO.53:

[0188] GTTAAACCAGGAAACAGCTATGATTGCGATTCTGTATCTG

[0189] SEQ ID NO.54:

[0190] CTGATGAGCTGGGTGGAACGTTATTCCACCACAAAATAGTTTTC

[0191] 3) Amplification of Ddi1 gene fragment: The amino acid sequence encoded by the Ddi1 gene is SEQ ID NO.3, the template used for PCR amplification is the genome of Saccharomyces cerevisiae (NCBI accession number: ASM2117220v1), and the primer sequences used for PCR amplification are shown in SEQ ID NO.55 and SEQ ID NO.56.

[0192] SEQ ID NO.55:

[0193] GTTTAAACCAGGAAACAGCTATGGATTTAACAATTTCAAACGAAC

[0194] SEQ ID NO.56:

[0195] CTGATGAGCTGGGTGGAACGTCATTGGAAAAGGAGGGATG

[0196] 4) Amplification of SPRTN gene fragment: The amino acid sequence encoded by the SPRTN gene is SEQ ID NO.4. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.57 and SEQ ID NO.58 to obtain the SPRTN gene fragment.

[0197] SEQ ID NO.57:

[0198] GTTAAACCAGGAAACAGCTATGGATGACGATCTGAT

[0199] SEQ ID NO.58:

[0200] CTGATGAGCTGGGTGGAACGTTACAGGCTTTCTTCACTCTT

[0201] 5) Amplification of GCNA1 gene fragment: The amino acid sequence encoded by the GCNA1 gene is SEQ ID NO.5. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.59 and SEQ ID NO.60 to obtain the GCNA1 gene fragment.

[0202] SEQ ID NO.59:

[0203] GTTTAAACCAGGAAACAGCTATGCCGACCCCGTTTCGCGA

[0204] SEQ ID NO.60:

[0205] CTGATGAGCTGGGTGGAACGTTACAGCTGTTTCAGTTCTTTAAAT

[0206] 6) Amplification of TDP1 gene fragment: The amino acid sequence encoded by the TDP1 gene is SEQ ID NO.6. The template used for PCR amplification is the genome of Saccharomyces cerevisiae (NCBI accession number: ASM2117220v1). The primer sequences used for PCR amplification are shown in SEQ ID NO.61 and SEQ ID NO.62.

[0207] SEQ ID NO.61:

[0208] GTTAAACCAGGAAACAGCTATGTCACGAGAAACAAATTTCA

[0209] SEQ ID NO.62:

[0210] CTGATGAGCTGGTGGAACGTTAGTCGTTCTCATGACGAGC

[0211] 7) Amplification of RAD4 gene fragment: The amino acid sequence encoded by the RAD4 gene is SEQ ID NO.7. The template used for PCR amplification is the genome of Saccharomyces cerevisiae (NCBI accession number: ASM2117220v1). The primer sequences used for PCR amplification are shown in SEQ ID NO.63 and SEQ ID NO.64.

[0212] SEQ ID NO.63:

[0213] GTTTAAACCAGGAAACAGCTATGAATGAAGACCTGCCCAA

[0214] SEQ ID NO.64:

[0215] CTGATGAGCTGGGTGGAACGTCAGTCTGATTCCTCTGACAT.

[0216] 8) Amplification of RAD52 gene fragment: The amino acid sequence encoded by the RAD52 gene is SEQ ID NO.8. The template used for PCR amplification is the genome of Saccharomyces cerevisiae (NCBI accession number: ASM2117220v1). The primer sequences used for PCR amplification are shown in SEQ ID NO.65 and SEQ ID NO.66.

[0217] SEQ ID NO.65:

[0218] GTTTAAACCAGGAAACAGCTATGAATGAAATTATGGATATGGATG

[0219] SEQ ID NO.66:

[0220] CTGATGAGCTGGTGGAACGTCAAGTAGGCTTGCGTGCAT.

[0221] 9) Amplification of pepP gene fragment: The amino acid sequence encoded by the pepP gene is SEQ ID NO.9. The template used for PCR amplification is the E. coli MG1655 genome (NCBI accession number: ASM584v2). The primer sequences used for PCR amplification are shown in SEQ ID NO.67 and SEQ ID NO.68.

[0222] SEQ ID NO.67:

[0223] GTTAAACCAGGAAACAGCTATGAGTGAGATATCCCGGCA

[0224] SEQ ID NO.68:

[0225] CTGATGAGCTGGGTGGAACGTCATTGCTTTCTCGCAGCAA.

[0226] 10) Amplification of pepQ gene fragment: The amino acid sequence encoded by the pepQ gene is SEQ ID NO.10. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.69 and SEQ ID NO.70 to obtain the pepQ gene fragment.

[0227] SEQ ID NO.69:

[0228] GTTTAAACCAGGAAACAGCTATGAAAGAACGCCTGGAAAA

[0229] SEQ ID NO.70:

[0230] CTGATGAGCTGGGTGGAACGTTACAGCAGTTCGCGTTC.

[0231] 11) Amplification of XPNPEP1 gene fragment: The amino acid sequence encoded by the XPNPEP1 gene is SEQ ID NO.11. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.71 and SEQ ID NO.72 to obtain the XPNPEP1 gene fragment.

[0232] SEQ ID NO.71:

[0233] GTTTAAACCAGGAAACAGCTATGCCGCCGAAAGTGAC

[0234] SEQ ID NO.72:

[0235] CTGATGAGCTGGTGGAACGTTAATGCTGTTTGCTAATCGG.

[0236] 12) Amplification of ypdF gene fragment: The amino acid sequence encoded by the ypdF gene is SEQ ID NO.12. The template used for PCR amplification is the E. coli MG1655 genome (NCBI accession number: ASM584v2). The primer sequences used for PCR amplification are shown in SEQ ID NO.73 and SEQ ID NO.74.

[0237] SEQ ID NO.73:

[0238] GTTTAAACCAGGAAACAGCTATGACATTACTCGCTTCGC

[0239] SEQ ID NO.74:

[0240] CTGATGAGCTGGGTGGAACGTTATGCCTCTCCCGTGAGC.

[0241] 13) Amplification of Q9RUY4 gene fragment: The amino acid sequence encoded by the Q9RUY4 gene is SEQ ID NO.13. The gene was synthesized by GENEWIZ, and then PCR amplified using primers SEQ ID NO.75 and SEQ ID NO.76 to obtain the Q9RUY4 gene.

[0242] SEQ ID NO.75:

[0243] GTTAAACCAGGAAACAGCTATGAGTAAGATGGATCAGCT

[0244] SEQ ID NO.76:

[0245] CTGATGAGCTGGGTGGAACGTTACACGCTTTCTTTCGCG.

[0246] 14) Amplification of srtN gene fragment: The amino acid sequence encoded by the srtN gene is SEQ ID NO.14. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.77 and SEQ ID NO.78 to obtain the srtN gene fragment.

[0247] SEQ ID NO.77:

[0248] GTTAAAACCAGGAAACAGCTATGGAAACCTTTAAAAGCATTCTG

[0249] SEQ ID NO.78:

[0250] CTGATGAGCTGGGTGGAACGTTACTTTTTCATGCCCAGGC.

[0251] 15) Amplification of Sir2A gene fragment: The amino acid sequence encoded by Sir2A gene is SEQ ID NO.15. The gene was synthesized by GENEWIZ, and then PCR amplification was performed using primers SEQ ID NO.79 and SEQ ID NO.80 to obtain the Sir2A gene fragment.

[0252] SEQ ID NO.79:

[0253] GTTTAAACCAGGAAACAGCTATGGGCAACCTGATGATTAG

[0254] SEQ ID NO.80:

[0255] CTGATGAGCTGGGTGGAACGTTACATAATTTTTTTGTTTTTTTCGCTG.

[0256] 16) Amplification of cobB gene fragment: The amino acid sequence encoded by the cobB gene is SEQ ID NO.16. The template used for PCR amplification is the E. coli MG1655 genome (NCBI accession number: ASM584v2). The primer sequences used for PCR amplification are shown in SEQ ID NO.81 and SEQ ID NO.82.

[0257] SEQ ID NO.81:

[0258] GTTTAAACCAGGAAACAGCTATGCTGTCGCGTCGGGGTCA

[0259] SEQ ID NO.82:

[0260] CTGATGAGCTGGTGGAACGTCAGGCAATGCTTCCCGCTT.

[0261] 17) SIRT1 gene fragment amplification: The amino acid sequence encoded by the SIRT1 gene is SEQ ID NO.17. The gene was synthesized by GENEWISE, and then PCR amplification was performed using primers SEQ ID NO.83 and SEQ ID NO.84 to obtain the SIRT1 gene fragment.

[0262] SEQ ID NO.83:

[0263] GTTAAACCAGGAAACAGCTATGGCCGACGAAGCCGCCTTA

[0264] SEQ ID NO.84:

[0265] CTGATGAGCTGGGTGGAACGTTAGCTTTTGTTGCTCGGATAGTTC.

[0266] 18) SIRT2 gene fragment amplification: The amino acid sequence encoded by the SIRT1 gene is SEQ ID NO.18, which was synthesized by GENEWISE, and then PCR amplified using primers SEQ ID NO.85 and SEQ ID NO.86 to obtain the SIRT2 gene fragment.

[0267] SEQ ID NO.85:

[0268] GTTTAAACCAGGAAACAGCTATGGCGGAACCGGACC

[0269] SEQ ID NO.86:

[0270] CTGATGAGCTGGGTGGAACGTTACTGCGGTTTTTCGCGTT

[0271] (2) Amplification and preparation of donor DNA.

[0272] Amplify the Donor DNA fragments inserted into each gene: Mix the upstream homology arm of mgsA amplified in step a, the downstream homology arm of mgsA amplified in step b, and each gene fragment amplified in step c at a molar ratio of 1:1:1, with a total volume of 5 μL, then add 5 μL of 2×Seanless Cloning Mix ligase, mix well, incubate at 50°C for 30 minutes, then transfer to ice and use as a template for PCR. Use SEQ ID NO.48 and SEQ ID NO.49 primers to amplify the Donor DNA of each gene, and the primer sequences are as follows: SEQ ID NO.48: CAACACGCTGGCCGAAGT SEQ ID NO.49: CTCGCCATTACCTCAACGG.

[0273] (3) Transform into competent state to obtain target strain.

[0274] The pEcgRNA-mgsA plasmid (see step 4.1 of Example 1) and the DonorDNA of each gene obtained in the above steps were transformed into E. coli MG1655 (pEcCas) competent cells at an addition amount of 100ng / 400ng, and gene insertion was achieved using CRISPR gene editing technology, followed by screening and sequencing to obtain strains in which each gene was correctly inserted at the mgsA site. Then, according to the method of step 5 of Actual Example 1, pEcgRNA-mgsA was eliminated from the strain. According to the method of step 6 of Example 1, after eliminating the pEcCas plasmid in the strain, strains D1 to D8, and strains P1 to P10 were obtained.

[0275] Example 3: Construction of MG1655(DE3)ΔfrmAΔrpiA(pEcCas) strain.

[0276] (1) Construction of pEcgRNA-frmA knockout plasmid.

[0277] First, the formaldehyde dehydrogenase (Accession IDs: EG50010) sequence was found from the Escherichia coli genome sequence published by NCBI, and the cleavage site N20 (CGTAGTCGCGGAAGTGTCTC) was selected. The reverse amplification primers were designed for whole plasmid PCR. After DPNI digestion, transformation and sequencing verification, the pEcgRNA-frmA knockout plasmid (plasmid sequence see SEQ ID NO.38) was obtained. The primer sequences used are as follows:

[0278] SEQ ID NO. 87: CGTAGTCGCGGAAGTGTCTCGTTTTAGAGCTAGAAATAGCAA SEQ ID NO. 88: GAGACACTTCCGCGACTACGACTAGTATTATACCTAGGACTG.

[0279] (2) PCR amplified the upstream and downstream homologous arms of the frmA knockout gene.

[0280] a. Amplify the upstream homology arm of frmA knockout, the template is MG1655 (DE3) genome, and the primer sequences used are as follows:

[0281] SEQ ID NO.89:AGCTCGTTGCGGATATAGT

[0282] SEQ ID NO.90:ATATTGAGGAAGAGCGAGAGTTTCCCGCAGGTTTACCCC

[0283] b. Amplify the downstream homology arm of frmA knockout, the template is MG1655 (DE3) genome, and the primer sequences used are as follows:

[0284] SEQ ID NO.91:CTCTCGCTCTTCCTCAATATG

[0285] SEQ ID NO.92:CCCTTTCCTCTTTGTTTTCCG

[0286] c. Amplify the frmA knockout Donor DNA-frmA fragment. The template is the two fragments of the upstream and downstream homology arms of the frmA knockout. The primer sequences used are as follows:

[0287] SEQ ID NO.89:AGCTCGTTGCGGATATAGT

[0288] SEQ ID NO.92:CCCTTTCCTCTTTGTTTTCCG

[0289] First, MG1655 (DE3) competent cells were prepared, and the pEcCas plasmid was transferred into the MG1655 (DE3) competent cells to obtain the MG1655 (DE3) (pEcCas) strain, named strain M1, and competent cells of strain M1 were prepared. The specific operation steps are shown in Example 1.

[0290] The pEcgRNA-frmA knockout plasmid and the Donor DNA-frmA fragment were co-transformed into the competent cells of the strain M1 at an addition amount of 100 ng / 400 ng, and knocked out by CRISPR gene editing technology. After bacterial liquid PCR and sequencing verification, the strain MG1655 (DE3) ΔfrmA (containing pEcgRNA-frmA and pEcCas) with successful knockout of the frmA gene was obtained, and then the pEcgRNA-frmA plasmid was eliminated to obtain the strain MG1655 (DE3) ΔfrmA (pEcCas), named strain M2, and the specific transformation steps were the same as in Example 1.

[0291] (3) Construction of pEcgRNA-rpiA knockout plasmid.

[0292] First, we found the ribose-5-phosphate isomerase A (AccessionIDs: EG111443) sequence from the Escherichia coli genome sequence published by NCBI, selected the cleavage site N20 (CGCGTCAATAAAGTGTGCGG), designed reverse amplification primers for whole plasmid PCR, and obtained the pEcgRNA-rpiA knockout plasmid (plasmid sequence see SEQ ID NO.39) after DPNI digestion, transformation and sequencing verification. The primer sequences used are as follows:

[0293] SEQ ID NO.93: CGCGTCAATAAAGTGTGCGGGTTTTAGAGCTAGAAATAGCAAG SEQ ID NO.94: CCGCACACTTTATTGACGCGACTAGTATTATACCTAGGACTGAG. (4) PCR amplification of the upstream and downstream homology arms of the rpiA knockout gene.

[0294] a. Amplify the upstream homology arm of rpiA knockout, the template is MG1655 (DE3) genome, and the primer sequences used are as follows:

[0295] SEQ ID NO.95:CTGCCCGAACATATTTTCCAG

[0296] SEQ ID NO.96:CGGGGGGAGGTTCCCCCGTCAGAGATCGTTTCGCCTGTGGTAT

[0297] b. Amplify the downstream homology arm of rpiA knockout, the template is MG1655 (DE3) genome, and the primer sequences used are as follows:

[0298] SEQ ID NO. 97: TCTGACGGGGGAACCTCCCCGTTASEQ ID NO. 98: GCCGATGATACCCAGCTTTTTG.

[0299] c. Amplify the rpiA knockout Donor DNA-rpiA fragment, the template is the two fragments of the upstream and downstream homology arms of the rpiA knockout, and the primer sequences used are as follows:

[0300] SEQ ID NO.95:CTGCCCGAACATATTTTCCAG

[0301] SEQ ID NO. 98: GCCGATGATACCCAGCTTTTTG.

[0302] First, competent cells of strain M2 were prepared, and then the pEcgRNA-rpiA knockout plasmid and Donor DNA-rpiA fragment were co-transformed into competent cells of strain M2 at an addition amount of 100 ng / 400 ng, and knocked out by CRISPR gene editing technology. After bacterial liquid PCR and sequencing verification, the strain MG1655 (DE3) ΔfrmAΔrpiA (containing pEcgRNA-rpiA and pEcCas) with successful knockout of the rpiA gene was obtained, and then the pEcgRNA-rpiA plasmid was eliminated to obtain the strain MG1655 (DE3) ΔfrmAΔrpiA (pEcCas), which was named strain M3. The specific transformation and pEcCas plasmid elimination steps are the same as in Example 1.

[0303] Example 4: Strain construction of MG1655(DE3)ΔmgsAΔfrmAΔrpiA (pEcCas), MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiA (pEcCas), and MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiA (pEcCas).

[0304] a. Construction of MG1655(DE3)ΔmgsAΔfrmAΔrpiA(pEcCas) (i.e., strain M4).

[0305] First, prepare electroporation competent cells of MG1655 (DE3) ΔfrmAΔrpiA (pEcCas) (i.e., strain M3), and the specific operation steps are the same as in Example 1. The pEcgRNA-mgsA plasmid obtained in step 4.1 of Example 1 and the Donor DNA-mgsA (step 4.2 of Example 1) fragment were co-transformed into M3 competent cells, and the strain MG1655 (DE3) ΔmgsAΔfrmAΔrpiA (containing pEcgRNA-mgsA and pEcCas) with successful knockout of the mgsA site was obtained after colony PCR and sequencing verification. After eliminating the pEcgRNA-mgsA plasmid, the strain MG1655 (DE3) ΔmgsAΔfrmAΔrpiA (pEcCas) was obtained, and was named strain M4. Colony PCR used SEQ ID NO.44 and SEQ ID NO.47 as primers, and the sequence is as follows:

[0306] SEQ ID NO.44:TCACATGAGGCCTGCCAG

[0307] SEQ ID NO. 47:GATTCCGGTAAAGCTGGATA.

[0308] b. Strain construction of MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiA(pEcCas) (i.e., strain M5).

[0309] First, prepare MG1655 (DE3) ΔfrmA ΔrpiA (pEcCas) (strain M3) electroporation competent cells, and the specific operation steps are the same as in Example 1. The pEcgRNA-mgsA plasmid and the Donor DNA-gcna1 fragment obtained in Example 2 were co-transformed into M3 competent cells. After colony PCR and sequencing verification, the strain MG1655 (DE3) ΔmgsA:: M1-93-gcna1 ΔfrmA ΔrpiA (containing pEcgRNA-mgsA and pEcCas) with the gcna1 gene successfully inserted into the mgsA site was obtained. After eliminating the pEcgRNA-mgsA plasmid, the strain MG1655 (DE3) ΔmgsA:: M1-93-gcna1 ΔfrmA ΔrpiA (pEcCas) was obtained and named as strain M5. Colony PCR used SEQ ID NO.44 and SEQ ID NO.99 as primers, and the sequence is as follows:

[0310] SEQ ID NO.44:TCACATGAGGCCTGCCAG

[0311] SEQ ID NO. 99: CTTTTTTCACTTCTTTCGGT.

[0312] c. Strain construction of MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiA(pEcCas) (strain M6).

[0313] First, prepare MG1655 (DE3) ΔfrmA ΔrpiA (pEcCas) (strain M3) electroporation competent cells, and the specific operation steps are the same as in Example 1. The pEcgRNA-mgsA plasmid of Example 1 and the Donor DNA-pepP fragment obtained in Example 2 were co-transformed into M3 competent cells, and the strain MG1655 (DE3) ΔmgsA:: M1-93-pepP ΔfrmA ΔrpiA (containing pEcgRNA-mgsA and pEcCas) with successful insertion of pepP at the mgsA site was obtained after colony PCR and sequencing verification. After eliminating the pEcgRNA-mgsA plasmid, the strain MG1655 (DE3) ΔmgsA:: M1-93-pepP ΔfrmA ΔrpiA (pEcCas) was obtained, and was named strain M6. Colony PCR used SEQ ID NO.44 and SEQ ID NO.100 as primers, and the sequence is as follows:

[0314] SEQ ID NO.44:TCACATGAGGCCTGCCAG

[0315] SEQ ID NO.100:GTAGTTGATAAAGTTGCTGA

[0316] Embodiment 5:

[0317] M7: MG1655(DE3)ΔmgsAΔfrmAΔrpiAΔrpiB;

[0318] M8: MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiB;

[0319] M9: Strain construction of MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiB.

[0320] (1) Construction of pEcgRNA-rpiB plasmid

[0321] First, the gene sequence of Escherichia coli rpiB (Accession IDs: EG11827) was found on the EcoCyc website, and the cleavage site N20 (AAGTGATTGATAAAGGAACC) was selected from the sequence. Then, primers were designed, and the original N20 of pEcgRNA was replaced with the above N20 sequence by the whole plasmid PCR method to obtain the pEcgRNA-rpiB plasmid (sequence see SEQ ID NO.40). The primer sequences used are as follows:

[0322] SEQ ID NO.101:

[0323] AAGTGATTGATAAAGGAACCGTTTTAGAGCTAGAAATAGCAAGT

[0324] SEQ ID NO.102:

[0325] GGTTCCTTTATCAATCACTTACTAGTATTATACCTAGGACTGAG

[0326] (2) PCR amplification of the upstream homology arm and downstream homology arm of rpiB knockout.

[0327] a. Use the Escherichia coli K-12 substr.MG1655 (DE3) genome as a template to amplify the upstream homology arm of rpiB knockout. The primers used are as follows:

[0328] SEQ ID NO.103:GGGTGCACAACTCAGGTTAC

[0329] SEQ ID NO.104:CCGTCCGTGCAAAACTTCAC

[0330] b. Use the Escherichia coli K-12 substr.MG1655 (DE3) genome as a template to amplify the downstream homology arm of rpiB knockout. The primers used are as follows:

[0331] SEQ ID NO.105:

[0332] GTTTTGCACGGACGGGGAAGATGAGATTCATCCACTACTTGCAT

[0333] SEQ ID NO.106:

[0334] CCTAACCCTCTCCCCAGAGG

[0335] c. Using the upstream and downstream homology arm fragments obtained in steps a and b above as templates, use primers to amplify the rpiB knockout Donor DNA-rpiB fragment.

[0336] SEQ ID NO.103:GGGTGCACAACTCAGGTTAC

[0337] SEQ ID NO.106:CCTAACCCTCTCCCCAGAGG

[0338] Using CRISPR technology, the pEcgRNA-rpiB knockout plasmid and the Donor DNA-rpiB fragment were co-transformed into MG1655(DE3)ΔmgsAΔfrmAΔrpiA(pEcCas) (i.e., strain M4), E. coli MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiA(pEcCas) (i.e., strain M5), E. coli In competent cells of MG1655 (DE3) ΔmgsA::M1-93-pepP ΔfrmA ΔrpiA (pEcCas) (i.e., strain M6), the rpiB gene was correctly knocked out by bacterial liquid PCR screening and sequencing verification, and then pEcgRNA-rpiB and pEcCas were eliminated to obtain the corresponding strains MG1655 (DE3) ΔmgsA ΔfrmA ΔrpiA ΔrpiB (named strain M7), MG1655 (DE3) ΔmgsA::M1-93-gcna1 ΔfrmA ΔrpiA ΔrpiB (named strain M8), and MG1655 (DE3) ΔmgsA::M1-93-pepP ΔfrmA ΔrpiA ΔrpiB (named strain M9). The detailed transformation and plasmid elimination steps are the same as in Example 1.

[0339] Embodiment 6:

[0340] MCK0: MG1655(DE3)ΔmgsAΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP), MD5: MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP),

[0341] MP1: Construction of MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) strain.

[0342] The cyaA gene was knocked out by the λ-Red homology method. The specific steps are as follows:

[0343] a. First, the pKD46 plasmid was introduced into MG1655(DE3)ΔmgsAΔfrmAΔrpiAΔrpiB (strain M7), MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiB (strain M8), and MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiB (strain M9) by electroporation, and a single colony was picked and transferred to LB liquid medium containing carboxybenzyl resistance, and cultured at 30°C and 220 rpm until OD550 The concentration is about 0.3. Place on ice for 30 minutes and use to prepare the corresponding competent cells.

[0344] b. Construction of the recombinant fragment FKF::cyaA

[0345] Using pKD4 plasmid as a template (purchased from Beijing Huayueyang Biological), the FKF::cyaA fragment was obtained by PCR amplification. The primer sequences are as follows:

[0346] SEQ ID NO.107:

[0347] CAGGCGATACGTCTTGTACCTCTATATTGAGACTCTGAAACAGAGACTGGATG

[0348] CCATAAATCAAGGAACACTTAACGGCTGAC

[0349] SEQ ID NO.108:

[0350] CTTTCCGGCACGTTCATCACGAAAAATATTGCTGTAATAGCGGCGTATCGTGA

[0351] TCCTGATTGGCAGGTCTTGAGCGATTGTGTAGG

[0352] c. The prepared recombinant fragment FKF::cyaA was electroporated into the three competent cells obtained in step a, and then spread onto the plate and cultured at 37°C overnight. The next day, a single colony was picked from the plate for verification to obtain a strain with successful knockout of the cyaA gene. The following primers were used for colony PCR:

[0353] SEQ ID NO.109: CGTGTTCCGCTTCCTTTAGCA

[0354] SEQ ID NO.110:GGGTACAGAAACTGACTTTTAG

[0355] d. Inoculate into LB liquid culture medium containing kanamycin resistance and incubate at 40°C, 220 rpm overnight to eliminate the temperature-sensitive plasmid pKD46, thereby obtaining MG1655(DE3)ΔmgsAΔfrmAΔrpiAΔrpiBΔcyaA, MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA and MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiBΔcyaA strains in which the cyaA gene was successfully knocked out and which did not contain the pKD46 plasmid.

[0356] e. Construction of plasmid pCDF-RuMP.

[0357] The CT4-1 mdh gene on the pCDF-RuMP vector is derived from Cupriavidus necator (NCBI accession number ASM21921v1), and the hps-phi gene is derived from Bacillus methanolicus (NCBI accession number GCF_000262755.1); the CT4-1 mdh gene was optimized and routinely synthesized in the multiple cloning restriction site (MCS1 site) of the pCDF-Duet plasmid by GENEWIZ (Suzhou Jinweizhi Biotechnology Co., Ltd.) to obtain the pCDF-CT4-1 mdh plasmid, and then the hps-phi operon was cloned into another multiple cloning restriction site (MCS2 site) of the vector pCDF-CT4-1 mdh plasmid. Specifically: by designing primers containing homologous sequences on the left and right sides of the insertion site of the pCDF-CT4-1 mdh plasmid, the vector backbone primers are used as follows:

[0358] SEQ ID NO.111:GCAGATCTCAATTGGATATCGG

[0359] SEQ ID NO.112: CCATATGTATATCTCCTTCTTATACTT

[0360] The primers used for the hps-phi operon are as follows:

[0361] SEQ ID NO.113: GTATAAGAAGGAGATATACATATGGAACTGCAACTGGCTC

[0362] SEQ ID NO.114: GATATCCAATTGAGATCTGCTTATTCCAGGTTAGCGTGACG

[0363] The vector backbone and gene fragment were cloned separately by PCR, and the PCR products were purified and recovered for seamless cloning of the vector backbone and gene fragment. The assembled products were used for heat shock transformation to screen single clones for sequencing verification to obtain the target plasmid pCDF-RuMP. The plasmid sequence is shown in SEQ ID NO.41.

[0364] f. Prepare MG1655(DE3)ΔmgsAΔfrmAΔrpiAΔrpiBΔcyaA, MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA and MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiBΔcyaA competent cells respectively, and transform the plasmid pCDF-RuMP into each competent cell to obtain the strain MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA. gsAΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) (named strain MCK0), MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) (named strain MD5), MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) (named strain MP1).

[0365] Example 7: Formaldehyde tolerance test of strains with potential detoxification genes inserted into the mgsA site

[0366] The strains D1-D8 and strains P1-P10 constructed in Example 2 were selected for formaldehyde tolerance testing. The specific operation steps are as follows:

[0367] Pick a single colony activated by streaking on the plate and inoculate it into 5 mL of MOPS + 2% glucose medium. Cultivate at 37°C, 220 rpm until the logarithmic growth phase, i.e., OD 550 Then prepare MOPS+2% glucose medium with final concentrations of 0mM, 0.75mM and 1mM formaldehyde, and add appropriate volume to the medium to ensure the initial OD 550 0.1. Take 200 μL of sample into a sterile 96-well cell culture plate, and set up three replicates for each reaction. Use sealing film to seal the plate and lid around, and place it in the microplate reader for growth measurement. Set the temperature of the microplate reader to 37°C, use the continuous vibration mode, and measure the OD every 10 minutes. 550 The readings were taken and the growth curves of each strain were drawn. Finally, the tolerance of the engineered bacteria to formaldehyde was evaluated by fitting the specific growth rate μ value in the logarithmic phase.

[0368] The formula of "40×MOPS" culture medium is as follows. It is diluted to "1×" for use in bacterial culture.

[0369] First, prepare the micronutrient solution by adding the following reagents and appropriate amount of ddH 2After O is dissolved, the final volume is adjusted to 100 mL.

[0370] Reagents Addition amount <![CDATA[FeCl 2 ·4H 2 O]]> 5g <![CDATA[CaCl 2 ·2H 2 Or]]> 184mg <![CDATA[H 3 BO 3 ]]> 62mg <![CDATA[MnCl 2 ·4H 2 O]]> 40mg <![CDATA[CoCl 2 ·6H 2 O]]> 18mg <![CDATA[CuCl 2 ·2H 2 Or]]> 4mg

[0371] Then prepare ZnCl 2 , Na 2 SeO 3 and Na 2 MoO 4 Three solutions.

[0372] Solution formula <![CDATA[ZnCl 2 Solution]]> <![CDATA[430mgNa 2 SeO 3 Dissolve in 10 ml ddH 2 O]]> <![CDATA[Na 2 SeO 3 Solution]]> <![CDATA[605mgNa 2 MoO 4 ·2H 2 O was dissolved in 10 ml ddHO 2 O]]> <![CDATA[Na 2 MoO 4 Solution]]> <![CDATA[340mgZnCl 2 Dissolve in 10 ml ddH 2 O]]>

[0373] Then prepare "40×MOPS" medium, add according to the culture in the table below, and then add ddH 2 O to a volume of about 900 mL and stir evenly, adjust the pH to about 7.0 with high concentration HCl or KOH, and continue to add ddH 2 O to 1 L, filter and sterilize, and store at 4°C away from light.

[0374] Reagents Addition amount MOPSpowder 334.8g Tricine 28.8g NaCl 116.8g <![CDATA[NH 4 Cl]]> 20.4g KOH 64g micronutrient solution 2mL <![CDATA[ZnCl 2 Solution]]> 0.2mL <![CDATA[Na 2 SeO 3 Solution]]> 0.2mL <![CDATA[Na 2 MoO 4 ]]> 0.2mL

[0375] The results of the formaldehyde tolerance test after the introduction of potential DPC-related genes are as follows Figure 4 As shown in the figure, under the condition of 1mM formaldehyde addition, after inserting the TDP1 (strain D6) and RAD52 (strain D8) genes into the mgsA site of Escherichia coli MG1655, the specific growth rate of the engineered bacteria was reduced by 14% and 4% respectively compared with the control bacteria. Relatively speaking, the introduction of SpWss1 (strain D2) and SPRTN (strain D4) had little effect on the growth rate. Interestingly, after the introduction of ScWss1 (strain D1), Ddi1 (strain D3), RAD4 (strain D7) and gcna1 (strain D5), the specific growth rate of the engineered bacteria under 1mM formaldehyde was improved. It is worth noting that the strain introduced with gcna1 (strain D5) had the most significant effect on improving formaldehyde tolerance, with a specific growth rate increased by 21% compared with the control bacteria.

[0376] We transferred the culture system from the 96-well plate to a 50 mL centrifuge tube to further verify the anti-formaldehyde effect of the gcna1-inserted strain (MG1655ΔmgsA::M1-93-gcna1, strain D5). Figure 5 The results show that after 35 h of cultivation without the addition of formaldehyde, the OD values ​​of the control bacteria CK0 (MG1655ΔmgsA) and the engineered bacteria D5 were 550 The values ​​were similar, both around 2.4. At a formaldehyde concentration of about 1.2 mM, the OD of the CK0 strain 550In 35 h, the OD of strain D5 increased from 0.10 to 0.14, but the biomass increased by only 0.04. 550 The OD of strain D5 increased from 0.10 to 0.86 within 35 h. 550 The increase was 19 times that of the CK0 strain. Therefore, based on the data from the 96-well plate and 50 mL centrifuge tube, it can be concluded that the D5 strain has enhanced tolerance to formaldehyde.

[0377] like Figure 6 As shown, the introduction of detoxified thioproline and N 6 -formyl lysine, a total of 10 genes, were transferred to the mgsA locus of MG1655. The results of their formaldehyde tolerance tests are shown in Figure 7 As shown in the figure, under the condition of 1mM formaldehyde addition, after SirA was introduced into the mgsA site of Escherichia coli MG1655, the specific growth rate of the engineered bacteria was reduced by 15% compared with CK0. The introduction of other enzymes has enhanced formaldehyde tolerance to varying degrees. It is worth noting that the three candidate proteins ypdF, pepQ and pepP, all of which are related enzymes for detoxifying thioproline, show the most significant improvement in formaldehyde tolerance. Among them, the pepP gene-inserted bacteria (MG1655ΔmgsA::M1-93-pepP, strain P1) has the most prominent effect, and its specific growth rate is about 15% higher than that of the control bacteria CK0.

[0378] In order to further verify the anti-formaldehyde effect of the P1 strain, we transferred the culture system from the 96-well plate to a 50 mL centrifuge tube for testing. Figure 8 The results show that after 35 h of cultivation without the addition of formaldehyde, the OD values ​​of CK0 and P1 strains were 550 When 1.2 mM formaldehyde was added, the OD of the P1 strain was 550 The OD of strain P1 increased from 0.10 to 0.91 within 35 h. 550 The increase is about 20 times that of CK0 (about 0.04). It can be concluded that the tolerance of P1 strain to formaldehyde is enhanced.

[0379] Example 8: DPC damage analysis of CK0 strain and D5 strain

[0380] The E. coli MG1655ΔmgsA::M1-93-gcna1 (strain D5) constructed in Example 2 was selected for DPC damage test.

[0381] In addition, as a control, the control strain E. coli MG1655ΔmgsA (strain CK0) was used to perform the test in the same manner.

[0382] The specific steps are as follows:

[0383] DPC is detected using the KCl-SDS precipitation method. The principle is that SDS has the ability to bind to DPC and other proteins, but cannot bind to free DNA. Therefore, KCl is added to the sample solution to precipitate DPC and proteins, while free DNA remains in the supernatant. Subsequently, the supernatant is transferred, and proteinase K is added to the precipitate to remove proteins, freeing the DNA in DPC. The DNA content and the DNA content in the original supernatant are determined by fluorescence, and the ratio of cross-linked DNA to total DNA is calculated to obtain the cross-linking data of DPC. The specific steps are as follows:

[0384] Pick a single colony activated by streaking on the plate, inoculate it into 5mL of MOPS + 2% glucose medium, and culture it overnight at 37°C and 220rpm. The next day, sample 0.5mL of the bacterial solution and collect the cells by centrifugation. Resuspend the cells with 0.5mL of PBS (pH = 7.5) buffer. Add 0.5mL of 2% SDS solution to the suspension, shake it slightly, and heat it at 65°C for 10min. Take out the lysed cells from the water bath, add 100μL of 1M KCl (pH = 7.5) dissolved in 20mM / L Tris-HCl, and pass the mixture through a 1mL pipette tip 6 times to make the DNA length uniform, and then incubate on ice for 5min to form SDS-K + Precipitation. Centrifuge the mixture at 4°C, collect the precipitate and transfer the supernatant to another clean 5mL centrifuge tube. Add 1mL of washing buffer (0.1M KCl, 0.1mM EDTA, 50mM Tris-HCl, pH=7.5) to the precipitate and resuspend it. Heat at 65°C for 10min, chill on ice for 5min, repeat the centrifugation and washing steps 3 times, and transfer the supernatant each time to a 5mL centrifuge tube. The final precipitate is resuspended in 0.5mL of washing buffer, and then 0.5mL of proteinase K (0.4mg / mL) is added. Digest in a 50°C water bath for 3h, chill on ice for 5min, centrifuge at 4°C for 10min, and collect the supernatant, which is the DNA from DPC. Calf thymus DNA was used to prepare DNA standard curves of different concentrations, and then freshly prepared fluorescent dye Hoechst33258 was added at a final concentration of 200 ng / mL. The reaction was protected from light for 30 minutes, and the fluorescence value of the standard sample under 350 nm excitation light and 450 nm emission light was measured using an ELISA instrument to prepare a standard curve. At the same time, the stained samples were measured using an ELISA instrument, and the cross-linked DNA and free DNA were quantitatively analyzed using the standard curve. The calculated DPC coefficient is the ratio of the cross-linked DNA content to the total DNA content.

[0385] according to Fig. 9The DPC test results shown in the figure show that when not treated with formaldehyde, the DPC coefficients of the CK0 strain and the D5 strain were comparable, both around 5%. However, after treatment with 5mM formaldehyde, the DPC coefficient of the CK0 strain rose to 65%, while the DPC coefficient of the D5 strain was 46%, a decrease of 29% compared to the CK0 strain. This observation suggests that the D5 strain mitigated the DPC coefficient caused by formaldehyde, thereby enhancing its formaldehyde tolerance.

[0386] Example 9: Thioproline tolerance test of CK0 strain and P1 strain

[0387] In order to verify the relationship between the enhanced formaldehyde tolerance of the P1 strain and the detoxification effect of thioproline in Escherichia coli, we tested the thioproline tolerance of the CK0 strain and the P1 strain. After preliminary experimental optimization, we selected 0mM and 3mM thioproline addition concentrations. The test operation steps are the same as Example 7.

[0388] according to Fig.10 As shown in the results, without the addition of thioproline, the growth rates of the CK0 strain and the P1 strain were similar. However, after adding 3mM thioproline, the growth rate of the P1 strain was significantly faster than that of the CK0 strain. Specifically, the specific growth rate of the P1 strain (μ = 0.188) was 41% higher than that of the CK0 strain (μ = 0.133). This result shows that the introduction of the pepP gene can reduce the toxicity of thioproline, thereby improving the strain's tolerance to formaldehyde.

[0389] Example 10: Growth test of recombinant strains MG1655(DE3)ΔmgsAΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) (i.e. strain MCK0), MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) (i.e. strain MD5), and MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP) (i.e. strain MP1) under the addition of methanol and xylose.

[0390] For the co-utilization of methanol and xylose, the metabolic pathways in Escherichia coli are as follows Fig.11 As shown, MOPS (see Example 7) + 2% (wt / v) casein acid hydrolyzate + 50 mM xylose + different concentrations of methanol were used for cultivation in the experiment. The detailed operation steps are as follows:

[0391] a. Pick a single colony after plate activation and inoculate it into LB medium containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin. Cultivate at 37°C and 220 rpm until OD550 Then, the bacterial solution was centrifuged and collected, washed twice with MOPS medium and resuspended to obtain an initial OD of 1.5-2.0. 550 The strain was inoculated with 0.1% in MOPS + 2% (wt / v) casein acid hydrolyzate + 50mM xylose + different concentrations of methanol, and kanamycin with a final concentration of 50μg / mL and 0.1mM IPTG were added to the medium. The culture experiment was carried out in a 50mL centrifuge tube. The culture was carried out at 37°C and 220rpm, and the growth of the strain was measured every 24h.

[0392] according to Fig.12 The results shown in the figure show that when the methanol concentration ranged from 300 mM to 1200 mM, the control strain MG1655 (DE3) ΔmgsA ΔfrmA ΔrpiA ΔrpiB ΔcyaA (pCDF-RuMP), i.e., the MCK0 strain, grew very slowly, with a maximum OD of 550 In contrast, MG1655(DE3)ΔmgsA::M1-93-gcna1ΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP), the MD5 strain, grew rapidly under 300 mM methanol conditions, with an OD of 550 That is, it reached 3.2. As the methanol concentration increased, the growth rate of the MD5 strain gradually slowed down. At 600mM methanol concentration, OD 550 Reached 3.2, OD in 5 days at 900mM methanol concentration 550 When the methanol concentration in the culture medium was increased to 1200 mM, the MD5 strain experienced a growth lag period of about 7 days and then began to grow. 550 Reached maximum value.

[0393] Under the condition of methanol concentration ranging from 300mM to 1200mM, MG1655(DE3)ΔmgsA::M1-93-pepPΔfrmAΔrpiAΔrpiBΔcyaA(pCDF-RuMP), i.e., MP1 strain, also showed strong growth ability. Within one day, the OD of MP1 strain grown under 300mM and 600mM methanol concentrations was 550 The values ​​reached 1.7 and 0.76, respectively. As the methanol concentration increased to 900 mM, the MP1 strain showed a growth retardation phenomenon, growing slowly in the first 4 days, but then accelerating until the OD 550 In addition, under 1200 mM methanol conditions, the MP1 strain began to grow after a 7-day lag phase and finally reached a maximum OD on the 12th day. 550 is 4.2.

[0394] Example 11: Characterization of methanol assimilation ability of recombinant strains MCK0, MD5 and MP1.

[0395] Pick a single colony activated by streaking on the plate and inoculate it into LB medium containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin. Cultivate at 37°C and 220 rpm until OD 550 When the OD reaches 1.5-2.0, centrifuge and collect the bacteria, wash twice with MOPS medium and resuspend to obtain the starting OD 550 The strain was inoculated with 0.1% of MOPS + 2% (wt / v) casein acid hydrolyzate + 50mM xylose + 600mM methanol in 50mL medium, and kanamycin with a final concentration of 50μg / mL and 0.1mM IPTG were added. The experimental test was carried out using a shake flask with a baffle. The strain was cultured at 37°C and 220rpm, and samples were taken every 24h to detect the growth of the strain and the consumption of methanol and xylose. Methanol and xylose were detected using liquid phase. The specific steps are as follows:

[0396] The fermentation broth was centrifuged at 12000rpm for 5min, and the supernatant was filtered through a 0.22μm filter membrane as a test sample. Agilent Hi-Plex column was used for detection, with 5mM sulfuric acid as the mobile phase, a flow rate of 0.6mL / min, a column temperature of 65°C, and a differential detector for measurement. The time for each reaction was set to 30min.

[0397] like Fig.13 As shown in Figure 2, compared with the control strain MCK0, the growth and methanol assimilation ability of the MD5 strain were significantly enhanced. The MD5 strain grew rapidly, with an OD of 550 Reaching 10.6, it is the MCK0 strain (OD 550 =0.36). During the 6-day fermentation, the MD5 strain consumed a total of 156 mM (~5.0 g / L) methanol and 47 mM (~7.0 g / L) xylose, which were 8 times and 13 times that of the MCK0 strain, respectively.

[0398] At the same time, Fig.14 The comparison between the MP1 strain and the control strain MCK0 showed that the growth and methanol assimilation ability of the MP1 strain were also significantly improved. The OD of the MP1 strain on the 4th day 550 The value reached 8.6, which is the MCK0 strain (OD 550 =0.45). The MP1 strain consumed a total of 164 mM (~5.2 g / L) methanol and 44 mM (~6.6 g / L) xylose in 6 days, which were 9 and 12 times of those of the MCK0 strain, respectively.

[0399] Example 12: Combination of detoxifying DNA and protein damaging genes

[0400] The gcna1 and pepP genes reduce the damage of formaldehyde to DNA and proteins respectively, thereby improving formaldehyde tolerance and methanol utilization efficiency. In order to explore whether there is a synergistic effect between the two, consider inserting these two coding genes into the mgsA site of Escherichia coli at the same time and connecting them with different RNS sequences. The specific steps are as follows:

[0401] MG1655(DE3)ΔfrmAΔrpiA(pEcCas) (i.e., strain M3) was used as the starting strain, and the RBS of T7 and M1-93 were used as the linker sequence of pepP and gcna1. Their nucleotide sequences are shown in Table 4. The construction process of the strain is as follows:

[0402] a. Construction of MG1655(DE3)ΔmgsA::M1-93-pepP-RBS(T7)-gcna1ΔfrmAΔrpiA(pEcCas) strain. First, amplify the pepP gene using the constructed P1 strain as a template. The primer sequences used are as follows:

[0403] SEQ ID NO.115:

[0404] TCACATGAGGCCTGCCAG

[0405] SEQ ID NO.116:

[0406] TCATTGCTTTCTCGCAGCAG

[0407] Then the gcna1 gene segment was amplified, using the constructed D5 strain as a template, and the primer sequences used were as follows:

[0408] SEQ ID NO.117:

[0409] CTGCTGCGAGAAAGCAATGACTTTAATAAGGAGATATACCATGCCGACCCCGTTTC

[0410] GCGA

[0411] SEQ ID NO.118:

[0412] GATTCCGGTAAAGCTGGATA

[0413] Then, the Donor DNA fragment with T7 RBS as the connection region of pepP and gcna1 was amplified. The two fragments obtained in the above steps were added in a molar ratio of 1:1, with a total volume of 5 μL, and then 5 μL of 2×Seanless CloningMix ligase was added. The mixture was incubated at 50°C for 30 minutes and placed on ice as a template for PCR. The primers SEQ ID NO.48 and SEQ ID NO.49 were used to amplify Donor DNA-RBS (T7). The primer sequences are as follows:

[0414] SEQ ID NO.48:CAACACGCTGGCCGAAGT

[0415] SEQ ID NO.49:CTCGCCATTACCTCAACGG

[0416] The pEcgRNA-mgsA plasmid and the Donor DNA-RBS (T7) obtained in the above steps were transformed into the MG1655ΔfrmAΔrpiA (pEcCas) competent state according to the addition amount of 100ng / 400ng, and the gene insertion was achieved using CRISPR gene editing technology. After subsequent screening and sequencing, a strain with the gene correctly inserted into the mgsA site was obtained, namely the strain MG1655 (DE3) ΔmgsA:: M1-93-pepP-RBS (T7) -gcna1ΔfrmAΔrpiA (containing pEcgRNA-mgsA and pEcCas). After eliminating the pEcgRNA-mgsA plasmid, the strain MG1655 (DE3) ΔmgsA:: M1-93-pepP-RBS (T7) -gcna1ΔfrmAΔrpiA (pEcCas) was obtained, and the specific transformation steps were the same as in Example 1.

[0417] b. Construction of MG1655(DE3)ΔmgsA::M1-93-pepP-RBS(M1-93)-gcna1ΔfrmAΔrpiA(pEcCas) strain. First, the pepP segment gene was amplified, using the constructed P1 strain as a template, and the primers used were the same as in step a, namely SEQ ID NO.115 and SEQ ID NO.116.

[0418] Then the gcna1 gene segment was amplified, using the constructed D5 strain as a template, and the primer sequences used were as follows:

[0419] SEQ ID NO.119:

[0420] CTGCTGCGAGAAAGCAATGAGTTTTAAACCAGGAAACAGCTATGCCGACCCCGTTT

[0421] CGCGA

[0422] SEQ ID NO.120:

[0423] GATTCCGGTAAAGCTGGATA

[0424] Then, the Donor DNA fragment with the RBS of M1-93 as the connection region between pepP and gcna1 was amplified, and the operation and primers were the same as step a to obtain the fragment Donor DNA-RBS (M1-93). The pEcgRNA-mgsA plasmid and the Donor DNA-RBS (M1-93) obtained in this step were transformed into the MG1655ΔfrmAΔrpiA (pEcCas) competent state according to the addition amount of 100ng / 400ng, and the gene insertion was achieved using CRISPR gene editing technology. After subsequent screening and sequencing, a strain with a correct gene insertion at the mgsA site was obtained, namely, the strain MG1655 (DE3) ΔmgsA:: M1-93-pepP-RBS (M1-93) -gcna1ΔfrmAΔrpiA (containing pEcgRNA-mgsA and pEcCas), and after eliminating the pEcgRNA-mgsA plasmid, the strain MG1655 (DE3) ΔmgsA:: M1-93-pepP-RBS (M1-93) -gcna1ΔfrmAΔrpiA (pEcCas) was obtained. The specific transformation steps are the same as in Example 1.

[0425] c. Construction of MG1655 (DE3) ΔmgsA::M1-93-pepP-RBS (1-7)-gcna1 ΔfrmA ΔrpiA (pEcCas) strain. First, the pepP segment gene was amplified, using the constructed P1 strain as a template, and the primers used were the same as in step a, namely SEQ ID NO.121 and SEQ ID NO.122.

[0426] Then the gcna1 gene segment was amplified, using the constructed D5 strain as a template, and the primer sequences used were as follows:

[0427] SEQ ID NO.121:

[0428] CTGCTGCGAGAAAGCAATGAGTTTTAAACCAGGAGRNNNNNNATGCCGACCCCGTT

[0429] TCGCGA

[0430] SEQ ID NO.122:

[0431] GATTCCGGTAAAGCTGGATA

[0432] Subsequently, the Donor DNA fragment with the random sequence M1-93 RBS as the connection region of pepP and gcna1 was amplified to obtain Donor DNA-RBSL, and the operation and primers were the same as step a. The pEcgRNA-mgsA plasmid and the Donor DNA-RBSL obtained in this step were transformed into MG1655ΔfrmAΔrpiA (pEcCas) competent state according to the addition amount of 100ng / 400ng, and the gene insertion was achieved using CRISPR gene editing technology. After screening and sequencing, 7 strains MG1655 (DE3) ΔmgsA:: M1-93-pepP-RBS (1-7)-gcna1ΔfrmAΔrpiA with different combinations at the mgsA site were obtained. The specific transformation steps are the same as in Example 1.

[0433] d. Subsequently, based on the 9 strains obtained through the above steps a, b, and c, the rpiB and cyaA genes were knocked out respectively according to the operation method of Examples 5-6, and the plasmid pCDF-RuMP was transferred to obtain MG1655 (DE3) ΔmgsA::M1-93-pepP-RBS (T7)-gcna1 ΔfrmA ΔrpiA ΔrpiB ΔcyaA (pCDF-RuMP), which was named strain MPD-T7. MG1655 (DE3) ΔmgsA::M1-93-pepP-RBS (M1-93)-gcna1 ΔfrmA ΔrpiA ΔrpiB ΔcyaA (pCDF-RuMP), which was named strain MPD-M1-93. Seven strains MG1655 (DE3) ΔmgsA::M1-93-pepP-RBS (1-7)-gcna1 ΔfrmA ΔrpiA ΔrpiB ΔcyaA (pCDF-RuMP) containing different RBS regions were named MPD1 to MPD7 (Table 3), wherein the nucleotide sequence of the RBS region between the genes pepP and gcna1 is shown in Table 4. The culture test was carried out using a 50 mL centrifuge tube according to the method of Example 10. The starting OD 550 The strain was inoculated with 0.1% of MOPS + 2% (wt / v) casein acid hydrolyzate + 50mM xylose + different concentrations of methanol, and kanamycin with a final concentration of 50μg / mL and 0.1mM IPTG were added. The strain was cultured at 37°C and 220rpm. The growth of the strain was measured every 24h. The experimental results are shown in Fig.15 As shown in the figure, no obvious growth was observed in the control bacteria within three days, while the double-gene combination strains showed different degrees of growth trends. Among all the strains screened, the MPD4 strain had the highest growth rate, with an OD of 0.04 on the second day. 550 The value can reach 2.3, which is the MD5 strain (OD550 =1.6) and 1.4 times that of the MP1 strain (OD 550 =0.52) is 4.4 times.

[0434] Example 13: Formaldehyde tolerance test of gene combination bacteria PD4

[0435] In order to explore the mechanism of the pepP and gcna1 double gene combination strain in enhancing the methanol assimilation efficiency, we amplified the combined gene region of the mgsA site. Using strain MPD4 as a template, using the primers SEQ ID NO.78 and SEQ ID NO.79 to amplify Donor DNA, according to the operation method of Example 2, the Donor DNA was integrated into the mgsA site of the Escherichia coli MG1655 genome, thereby obtaining strain MG1655ΔmgsA::M1-93-pepP-RBS4-gcna1 (i.e., strain PD4). The formaldehyde tolerance experiment was tested by an ELISA instrument, and the experimental results are shown in Fig.16 As shown in the figure, under the condition of adding 1mM formaldehyde, the specific growth rate of the PD4 strain increased by 30% compared with the control strain CK0, which was 2 times and 1.4 times that of the P1 and D5 strains, respectively. Subsequently, the formaldehyde concentration was increased to about 1.2mM in a 50mL centrifuge tube for growth test, and the results were shown in the figure. Fig.17 As shown, the OD of PD4 strain 550 The value increased from 0.1 to 2.1 within 35 h. The OD 550 The increase was 50 times that of the control strain CK0 (~0.04), indicating that the synergistic effect between the two genes led to a significant enhancement of formaldehyde tolerance.

[0436] Example 14: Exploration of the formaldehyde tolerance mechanism of PD4

[0437] In order to explore the mechanism of improved formaldehyde tolerance of PD4 strain, we conducted experimental analysis from two aspects: the strain's tolerance to thioproline and the DPC damage coefficient. First, the CK0 and PD4 strains were tested for thioproline tolerance, and the experimental operation was the same as in Example 9. The results are shown in Figure 9. Fig.18 As shown, under the condition of adding 3 mM thioproline, the PD4 strain exhibited better growth ability, and its specific growth rate was increased by 63% compared with that of the CK0 strain.

[0438] Subsequently, the DPC damage caused by formaldehyde induction in CK0 and PD4 strains was measured, and the experimental operation was the same as in Example 8. The results are shown in Fig.19As shown, under the condition of no formaldehyde addition, the DPC damage coefficients of CK0 and PD4 strains were similar. However, when exposed to 5mM formaldehyde, the DPC damage coefficient of CK0 strain was 65%, while the DPC coefficient of PD4 strain was only 47%. In contrast, the DPC damage coefficient of the engineered bacteria PD4 was reduced by about 28%. These results indicate that the PD4 strain effectively alleviates the DNA and protein damage caused by formaldehyde, which may be due to its coordinated expression of the gcna1 and pepP genes.

[0439] Example 15: Characterization of Methanol Utilization Capacity of MPD4

[0440] First, the growth curve of the MPD4 strain under different methanol concentrations was tested in a 50 mL centrifuge tube, and the experimental steps were the same as in Example 10. The results are shown in FIG. Fig. 20 As shown, at 300 mM and 600 mM methanol concentrations, the MPD4 strain grew rapidly, with an OD of 550 The values ​​reached 4.1 and 3.2 respectively. However, at 900 mM methanol concentration, the growth rate of the strain decreased significantly. When the methanol concentration in the culture medium was increased to 1200 mM, the MPD4 strain began to grow after a 7-day growth lag phase and reached the maximum biomass (OD 550 =4.9).

[0441] Subsequently, we evaluated the growth and methanol assimilation ability of the engineered strain in baffled shake flasks. The experimental procedures were the same as in Example 11. The results are shown in Fig.21 As shown, under the condition of adding 600 mM methanol, the biomass of MPD4 strain reached 11.7 on the second day, which was higher than that of the control strain MCK0 (OD 550 =0.36). At the end of the second day, the xylose in the medium had been completely consumed, while the methanol concentration gradually decreased throughout the fermentation process. Over a period of 6 days, the MPD4 strain consumed a total of 208.7 mM (~6.7 g / L) of methanol and 48.2 mM (~7.2 g / L) of xylose, which were 11 and 13 times that of the control strain, respectively. It is worth noting that the methanol utilization efficiency of MPD4 was 34% higher than that of MD5 and 28% higher than that of MP1.

[0442] Example 16: Determination of relevant damage parameters in fermentation of MCK0, MD5, MP1 and MPD4 strains

[0443] First, after two days of fermentation in MOPS medium containing 600 mM methanol (see Example 7), we measured the intracellular formaldehyde levels of four strains, MCK0, MD5, MP1 and MPD4. When measuring the intracellular formaldehyde concentration, the following steps were followed: After two days of fermentation, take an appropriate amount of bacterial solution and measure its OD 550, washed twice with 0.9% NaCl and resuspended with 1 mL of 0.9% NaCl. Then, 125 μL of Nash buffer (5 mM ammonium acetate, 50 mM acetylacetone) was added to each well on ice, incubated at 37°C for 1 h, and the absorbance of the supernatant at 412 nm was measured after centrifugation. A formaldehyde standard curve from 0 to 1 mM was prepared, and the intracellular formaldehyde concentration was calculated based on it.

[0444] according to Fig. 22 The results showed that after 2 days of fermentation, the intracellular formaldehyde concentration of the control strain MCK0 was 29.9 μM / OD, while the intracellular formaldehyde concentrations of the engineered bacteria MD5, MP1 and MPD5 were 15.3 μM / OD, 17.3 μM / OD and 19.4 μM / OD, respectively.

[0445] Then the DPC coefficients of the four strains MCK0, MD5, MP1 and MPD4 were determined, and the experimental operation steps were the same as in Example 8. Fig.23 The results shown show that the DPC coefficient of the control bacteria MCK0 was 33.6% after 2 days of fermentation, while the DCP coefficients of the engineered bacteria MD5, MP1 and MPD5 were 24.8%, 14.6% and 13.7%, respectively, which were 26.2%, 56.5% and 59.2% lower than those of the control bacteria MCK0, respectively. This indicates that each engineered bacteria alleviated DPC damage to varying degrees.

[0446] In addition, reactive oxygen species (ROS) are oxidative molecules produced under external environmental stress, which can cause redox balance disorders and damage to cell components in cells. Therefore, we also tested the ROS of these four strains after two days of fermentation. The specific steps of ROS detection are as follows:

[0447] Pick a single colony activated by streaking on the plate and inoculate it into LB medium containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin. Cultivate at 37°C and 220 rpm until OD 550 When the OD value reaches 1.5-2.0, the bacteria are collected by centrifugation, then washed twice with MOPS medium and resuspended to obtain the starting OD value. 550Inoculate 0.1 into 50mL of culture medium containing MOPS + 2% (wt / v) casein acid hydrolysate + 50mM xylose + 600mM methanol, add kanamycin at a final concentration of 50μg / mL and 0.1mM IPTG, and culture at 37°C, 220rpm for two days. Take 0.3mL of the cultured bacterial sample, add 5μ of 25mM DCFDA reagent, and oscillate the reaction at 37°C, 220rpm in the dark for 1h. Afterwards, wash the bacteria twice with 0.9% NaCl and resuspend them, then use an enzyme reader to measure the fluorescence readings under the conditions of an excitation wavelength of 485nm and an emission wavelength of 528nm. At the same time, measure the OD of the bacterial solution. 550 The RFU value reflecting the level of ROS damage was obtained by calculating the ratio of fluorescence reading to absorbance.

[0448] according to Fig.24 As shown in the figure, after 2 days of fermentation, the MD5, MP1 and MPD4 strains all showed a significant reduction in ROS-induced damage. The ROS value of the control bacteria MCK0 was 14215, while the ROS values ​​of the engineered bacteria MD5, MP1 and MPD4 were 920, 3607 and 778, respectively. The ROS value of the MP1 strain was 75% lower than that of the control bacteria, while the ROS values ​​of the MD5 and MPD4 strains were 94% and 95% lower than that of the control bacteria MCK0, respectively. After 3 days of fermentation, the ROS value of MCK0 decreased, while the ROS values ​​of the engineered bacteria MD5, MP1 and MPD4 increased to varying degrees, but were still significantly lower than the level of the control bacteria.

[0449] Example 17: Fermentation test of MPD4 strain in different culture media

[0450] In order to test the growth and fermentation of MPD4 in different culture media, we conducted three sets of shake flask experiments. Condition 1 was to add 500mM methanol and 50mM xylose to MOPS+2% (wt / v) casein acid hydrolysate, and methanol and xylose were supplemented during the fermentation process. Condition 2 was to add only 50mM xylose to MOPS+2% (wt / v) casein acid hydrolysate, and condition 3 was to add 50mM xylose and 2% (wt / v) glucose to MOPS+2% (wt / v) casein acid hydrolysate. The specific experimental operation was the same as Example 11.

[0451] according to Fig.25 The results showed that in the medium supplemented with methanol and xylose, the MPD4 strain showed rapid growth, with an OD of 550 The maximum OD of MPD4 strain was 11.3 in 8 days. 550The value was 18.6, and a total of 455mM methanol (~14.6g / L) was consumed. Its ability to efficiently utilize methanol exceeded the level previously reported in Escherichia coli. It is worth noting that in a medium without methanol (0mM) and only with 50mM xylose, the MPD4 strain could not grow, and even the additional addition of 2% (wt / v) glucose could not promote its growth. In contrast, in the presence of methanol, the strain showed strong growth ability, indicating that it has successfully achieved the transition from traditional sugar metabolism to methanol as a growth support.

[0452] Example 18: MPD4 strain 13 C methanol metabolic flux analysis

[0453] In order to verify the methanol assimilation ability of the engineered strain MPD4, we cultured the cells in the presence of 50 mM xylose and 100 mM 13 C-methanol MOPS medium 13 C-methanol labeling experiment. After 8 days of fermentation, cell samples were collected for 13 The detection and analysis of C methanol metabolic flow was commissioned to Shanghai Puling Biotechnology Co., Ltd. The experimental results showed that key metabolites involved in carbon metabolism were detected, including the EMP pathway, tricarboxylic acid cycle and pentose phosphate pathway 16 .like Fig.26 As shown, most of the methanol 13 C labeling appeared in various metabolites in the EMP pathway, such as 70% of fructose-6-phosphate, 9% of fructose-1,6-bisphosphate, 32% of 2-phosphoglycerate, 33% of 3-phosphoglycerate, 32% of phosphoenolpyruvate, 37% of pyruvate, and 45% of dihydroxyacetone phosphate. In addition, a large amount of labeling was also observed in key compounds of the tricarboxylic acid cycle, among which 63% of citric acid, 61% of cis-acrylic acid, 57% of succinate, 60% of furanoic acid, 60% of malate, and 53% of α-ketoglutarate contained labeled carbon. Meanwhile, ribose-5-phosphate and sedoheptulose-7-phosphate in PPP showed 38% and 65% of labeled carbon, respectively. These labeling results indicate that methanol is effectively integrated into the central carbon metabolism of the MPD4 strain.

[0454] For amino acids 13C labeling was also evaluated, and 13 amino acids (Gln, Glu, Tyr, Val, Met, Ile, Thr, Gly, Lys, Ser, Leu, Asp, Asn) were found to be labeled. Among these labeled amino acids, Tyr, Val, Ile, Gly, Ser, and Leu can be traced back to the intermediates of the EMP pathway, while Gln, Glu, Met, Thr, Lys, Asp, and Asn are associated with amino acids derived from tricarboxylic acid cycle intermediates. It is worth noting that the main labeled amino acids are associated with the intermediates of TCA and occupy a considerable proportion, such as 53% for Glu, 37% for Gln, 25% for Asn, 21% for Asp, and 20% for Thr. In addition, the labeling levels of the remaining amino acids were all less than 10%. These findings suggest that the labeled carbon from methanol enters the central carbon metabolic pathway after assimilation and is subsequently involved in the synthesis of important cellular components.

[0455] Example 19: Product synthesis analysis of control bacteria MCK0 and MPD4

[0456] The engineered bacteria MPD4 with improved methanol assimilation efficiency constructed by the present invention can be used as a chassis cell to synthesize various high value-added products using a variety of one-carbon compounds such as methanol.

[0457] a. 3-Hydroxypropionic acid (3-HP), as an important compound, is an important precursor of a variety of chemicals including acrylates and acrylamides, and is also one of the monomers for the production of biodegradable plastics (Yu, W., Cao, X., Gao, JQ & Zhou, YJ Overproduction of 3-hydroxypropionate in a super yeast chassis. Bioresource Technol 361, doi: ARTN 12769010.1016 / j.biortech.2022.127690(2022).). In a significant recognition of its importance, 3-HP has been identified by the U.S. Department of Energy as one of the 12 best bio-based building blocks. Here, we used engineered Escherichia coli for the biosynthesis of 3-HP, where the 3-HP production plasmid pET-3-HP was derived from a reported literature (Li, J. et al. A non-carboxylative route for the efficient synthesis of central metabolite malonyl-CoA and its derived products. Nat Catal7, doi: 10.1038 / s41929-023-01103-2 (2024).).

[0458] The 3-HP production plasmid pET-3-HP was introduced into the control strain MCK0 and the engineered strain MPD4, and then fermented in a MOPS medium containing 500 mM methanol, 50 mM xylose, and 2% acid hydrolyzate using a baffled shake flask, with xylose fed in batches during the process. Samples were taken every 24 h to determine the OD 550 , methanol, xylose and 3-HP. 550 The detection methods of methanol and xylose are the same as those in Example 11. The quantitative analysis method of 3-HP is as follows: the fermentation broth is centrifuged at 12000rpm for 5min, and the supernatant is filtered through a 0.22μm filter membrane as a test sample. Agilent Hi-Plex column is used for detection, 5mM sulfuric acid is used as the mobile phase, the flow rate is 0.6mL / min, the column temperature is set to 65℃, and the DAD detector is used for determination, and the detection wavelength is set to 210nm.

[0459] according to Fig. 27 The results showed that no significant growth was observed in the control strain MCK0, and no 3-HP production was detected. In contrast, the engineered strain MPD4 showed the ability to produce up to 178 mM methanol (~5.7 g / L) and 45 mM xylose, and produced approximately 19 mM (1.7 g / L) 3-HP in 4 days.

[0460] b. In addition to 3-HP, triacetin (TAL) is another versatile platform chemical that can be used to synthesize a variety of molecules. The plasmid pTrc99a-bktB used to produce TAL is derived from a reported literature (Tan, ZG, Clomburg, JM, Cheong, S., Qian, S. & Gonzalez, RA polyketoacyl-CoA thiolase-dependent pathway for the synthesis of polyketide backbones. Nat Catal 3, doi: 10.1038 / s41929-020-0471-8 (2020).).

[0461] In the present invention, we use plasmid pTrc99a-bktB to produce TAL. The experimental process is the same as the above operation a. The detection method of TAL is as follows: measure the absorbance at 282nm in the supernatant of the fermentation broth, and establish a standard curve to calculate the content of TAL. Fig.28As shown, the control strain MCK0 had no obvious growth and no production of TAL products was detected, while the MPD4 strain carrying the pTrc99a-bktB plasmid consumed a cumulative amount of 427 mM methanol and 150 mM xylose within 10 days, and finally produced 155±1.7 mg / L of TAL products.

[0462] c. The present invention explores the ability of the engineered strain to produce malonyl-CoA. The pCum-rppA plasmid used to produce malonyl-CoA is derived from a reported literature (Li, J. et al. Anon-carboxylative route for the efficient synthesis of central metabolite malonyl-CoA and its derived products. Nat Catal 7, doi: 10.1038 / s41929-023-01103-2 (2024).). The experimental process is the same as the above operation step a. The yield of malonyl-CoA is evaluated by measuring the absorbance at 520 nm in the supernatant of the fermentation broth. Fig.29 As shown, no obvious growth was observed in the control strain MCK0 carrying the constructed plasmid pCum-rppA, and ΔA 520 The value did not change significantly. However, the fermentation broth of the MPD4 strain carrying pCum-rppA turned red during the fermentation process. The ΔA 520 The value increased to 0.1, which showed that the system could also be applied to the synthesis of flavonoids.

[0463] d. In the experiment of producing long-chain fatty acids, pTrc99a-pXZ18Z used to produce long-chain fatty acids was derived from the reported literature (Sun, WJ et al. Integration of (S)-2,3-oxidosqualene enables to become Iron Man with improved overall tolerance. Biotechnol Biof Biop 16, doi: ARTN19110.1186 / s13068-023-02444-7 (2023).), and the experimental process was the same as the above operation step a. The detection steps of long-chain fatty acids are as follows: Take 100 μL of fermentation broth and add 20 μL of 5 mg / mL internal standard (C7 / C15, final concentration 833 mg / L). Then add 2 mL of ethanol: sulfuric acid (98:2 v / v) mixture, mix and incubate at 65°C for 30 minutes. Add 2mL 0.9% (wt / v) NaCl solution and 1mL hexane, vortex, and centrifuge at 2000×g for 2min. The supernatant ethane layer is analyzed by GC-MS. The temperature of GC-MS analysis is initially maintained at 50°C for 2min, then increased to 200°C at a rate of 25°C / min, maintained for 1min, and then increased to 315°C at a rate of 25°C / min, maintained for 2min. Helium is used as the carrier gas at a flow rate of 1mL / min.

[0464] The results are as follows Fig.30 As shown in the figure, the MPD4 strain containing the pTrc99a-pXZ18Z plasmid produced 71±5.6 mg / L of LcFA in 9 days, while the control strain MCK0 containing the pTrc99a-pXZ18Z plasmid only produced 8.2±0.2 mg / L of LcFA. The LcFA production of the engineered strain MPD4 was 9 times that of the control strain. This shows that the MPD4 strain has the ability to produce long-chain fatty acids using one-carbon substrates.

[0465] Fig.31 Schematic diagram of the strategy of overexpressing PepP and GCNA1 proteins to improve formaldehyde tolerance and methanol assimilation efficiency and achieve the synthesis of high value-added products.

[0466] Taken together, these findings highlight that engineering E. coli MPD4 can serve as a solid foundation for the biosynthesis of high-value compounds.

[0467] It can be seen that the present invention adopts genetic engineering technology to improve formaldehyde tolerance by alleviating DNA and protein damage, effectively improving the utilization efficiency of methanol, and also showing the potential for synthesizing various high-value-added biological products.

[0468] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which does not affect the essence of the present invention. In the absence of conflict, the embodiments of the present application and the features in the embodiments can be combined with each other arbitrarily.

Claims

1. Use of a recombinant microorganism in improving formaldehyde tolerance and one-carbon compound assimilation capacity; characterized in that: The recombinant microorganism is achieved by overexpressing a protein capable of reducing DNA damage on the genome of the recipient microorganism; and / or overexpressing a protein capable of reducing protein damage on the genome of the recipient microorganism.

2. The use according to claim 1, characterized in that: The recipient microorganisms include Escherichia coli, Corynebacterium glutamicum, and yeast cells.

3. The use according to claim 1, characterized in that: The amino acid sequence of the protein capable of reducing DNA damage is shown in any one of SEQ ID NO.1 to SEQ ID NO.

8.

4. The use according to claim 1, characterized in that: The protein that reduces protein damage ability includes detoxifying thioproline or N 6 -Formyl-lysine protein; The amino acid sequence of the protein capable of reducing protein damage is shown in any one of SEQ ID NO.9 to SEQ ID NO.

18.

5. A recombinant Escherichia coli with improved formaldehyde tolerance, characterized in that: Replacing the encoding gene mgsA of methylglyoxal synthase in Escherichia coli with the encoding gene of the protein that reduces DNA damage, and overexpressing the protein that reduces DNA damage, to obtain the recombinant Escherichia coli; And / or, the amino acid sequence of the protein that reduces DNA damage is shown in any one of SEQ ID NO.1 to SEQ ID NO.8; The nucleotide sequence of the gene encoding methylglyoxal synthase, mgsA, is shown in SEQ ID NO.28; The Escherichia coli is selected from E. coli MG1655.

6. The recombinant Escherichia coli according to claim 5, characterized in that A protein that reduces DNA damage is overexpressed by an artificial promoter element; the artificial promoter element is M1-93, and the nucleotide sequence of M1-93 is shown in SEQ ID NO.

29.

7. A recombinant Escherichia coli with improved formaldehyde tolerance, characterized in that: The gene encoding methylglyoxal synthase mgsA in Escherichia coli is replaced with a gene encoding a protein that reduces protein damage, and the protein with the ability to reduce protein damage is overexpressed to obtain the recombinant Escherichia coli; the amino acid sequence encoding the protein that reduces protein damage is shown in any one of SEQ ID NO.9-SEQ ID NO.

18.

8. The recombinant Escherichia coli according to claim 7, characterized in that A protein that reduces protein damage ability is overexpressed by an artificial promoter element; the artificial promoter element is M1-93, and the nucleotide sequence of M1-93 is shown in SEQ ID NO.

29.

9. A recombinant Escherichia coli with improved formaldehyde tolerance, characterized in that: The encoding gene mgsA of methylglyoxal synthase in Escherichia coli is replaced with a combination of encoding genes of two proteins, PepP and GCNA1, and the combination of the two proteins, PepP and GCNA1, is overexpressed; the combination is carried out in the order of PepP first and then GCNA1, and PepP and GCNA1 are connected by an RBS region, and the nucleotide sequence of the RBS region is shown in any one of SEQ ID NO.19-SEQ ID NO.

27.

10. The recombinant Escherichia coli according to claim 9, characterized in that An artificial promoter element is used to overexpress a combination of PepP and GCNA1 proteins, wherein the artificial promoter element is M1-93, and the nucleotide sequence of M1-93 is shown in SEQ ID NO.

29.

11. A chassis cell precursor for improving the utilization efficiency of one-carbon compounds, characterized in that: Based on E. coli MG1655 (DE3), the frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A were knocked out; The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.

31.

12. A chassis cell for improving the utilization capacity of one-carbon compounds, characterized in that: The frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A were knocked out in E. coli MG1655 (DE3) to obtain chassis cell precursors, the nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31; The method is obtained by replacing the gene encoding methylglyoxal synthase mgsA with a gene encoding a protein that reduces DNA damage in a chassis cell precursor, and by knocking out at least one of the following genes: rpiB gene encoding ribose phosphate isomerase B; The cyaA gene encodes adenylate cyclase.

13. A chassis cell for improving the utilization capacity of one-carbon compounds, characterized in that: The frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A were knocked out in E. coli MG1655 (DE3) to obtain chassis cell precursors, the nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31; The present invention is obtained by replacing the gene encoding methylglyoxal synthase mgsA with a gene encoding a protein that reduces protein damage in a chassis cell precursor, and knocking out at least one of the following genes: rpiB gene encoding ribose phosphate isomerase B; The cyaA gene encodes adenylate cyclase.

14. A chassis cell for improving the utilization capacity of one-carbon compounds, characterized in that: The frmA gene encoding formaldehyde dehydrogenase and the rpiA gene encoding ribose phosphate isomerase A were knocked out in E. coli MG1655 (DE3) to obtain chassis cell precursors, the nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.30, and the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.31; The method is obtained by replacing the gene encoding methylglyoxal synthase mgsA with a combination of genes encoding two proteins PepP and GCNA1 in the chassis cell precursor, and knocking out at least one of the following genes: rpiB gene encoding ribose phosphate isomerase B; The cyaA gene encodes adenylate cyclase.

15. A microbial cell factory for improving the one-carbon compound utilization capacity of Escherichia coli, characterized in that: Introducing the RuMP pathway into the chassis cells of any one of claims 12-14 comprises introducing the mdh gene from Cupriavidus necrotus, the hps gene and the phi gene from Bacillus methanolicus.

16. The microbial cell factory according to claim 15, characterized in that: The nucleotide sequence of the mdh gene is shown in SEQ ID NO.34; the nucleotide sequence of the hps gene is shown in SEQ ID NO.35; and the nucleotide sequence of the phi gene is shown in SEQ ID NO.

36.

17. Use of the microbial cell factory as claimed in claim 16 in synthesizing high value-added products using one-carbon compounds.

Images