MiR-iab-8 capable of regulating and controlling diapause of ostrinia furnacalis and application of miR-iab-8

Abstract

The invention discloses miR-iab-8 capable of regulating and controlling diapause of ostrinia furnacalis and application of the miR-iab-8. Wherein the nucleotide sequence of the miR-iab-8 is as shown in SEQ ID NO: 1. The miR-iab-8 carries out targeted negative regulation and control on the Cycle gene, so that the expression of a biological clock signal channel related gene is regulated and controlled. The silence and overexpression of the Asiatic corn borer miR-iab-8 are realized through the inhibitor and agonist of the miR-iab-8, so that the expression of an important gene Cycle in the growth and development process of the Asiatic corn borer is regulated and controlled, and the metamorphosis development of larvae is hindered, and the larvae finally die. The invention further provides application of the miR-iab-8 capable of regulating and controlling the diapause of the ostrinia furnacalis to prevention and control of the ostrinia furnacalis or preparation of a medicament for preventing and controlling the ostrinia furnacalis. The nucleic acid can be used for preparing novel nucleic acid pesticides and has a huge application prospect in an Asiatic corn borer green prevention and control technology.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and particularly relates to miR-iab-8 capable of regulating the diapause of Asian corn borer and applications thereof. Background Art

[0002] In the field of agricultural biotechnology, gene regulation is a key research topic, especially in improving crop yields, pest and disease resistance and adaptability. Insects, as the most densely populated biological group in the world, have developed a unique way of survival during the long process of evolution. Most insects go through four developmental stages: egg, larva, pupa and adult. The transition between adjacent insect stages involves a complex regulatory network at the gene level. MicroRNA (miRNA) is a class of endogenous small non-coding RNA molecules that are widely present in animals and plants and have attracted widespread attention due to their key role in gene expression regulation. miRNA regulates gene expression at the transcriptional level by binding to the mRNA of the target gene of the target organism, causing mRNA degradation or inhibiting its translation. In insects, miRNA has been found to be involved in regulating insect biological processes such as molting, metamorphosis, neural development, immune response, behavior and oogenesis. Cycle (Cyc) gene, as the main response gene of the biological clock signaling pathway, is closely related to the transition process from larva to pupa and plays an important regulatory role in the development and metabolism of insects. At present, it has been found that a variety of miRNA-targeted target genes are involved in the normal life activities of insects. miR-iab-8 is a specific miRNA that can target and regulate the expression of Cycle genes.

[0003] The Asian corn borer (Ostrinia furnacalis) is an important pest on corn and other crops in my country. It belongs to the Lepidoptera, Pyralidae, and Ostrinia genus. The insect is widely distributed in corn-producing areas from Heilongjiang to Hainan in my country, posing a great threat to the production of corn and other crops in my country. The Asian corn borer is a holometabolous insect that goes through four stages: egg, larva, pupa, and adult. The larvae of the Asian corn borer mainly harm various parts of the corn plant above the ground. During the heart leaf stage of corn, the newly hatched larvae will crawl into the heart leaf to feed in groups, leaving a white film-like epidermis, forming a mosaic shape; as the larvae grow, they will bore into the stems and continue to cause damage, resulting in loss of function of the affected parts, affecting the growth and development of corn and reducing grain yield. Diapause is a state of growth and development cessation caused by insects in order to avoid adverse ecological environments to maintain individual survival and population size. It is regulated by the biological clock system and the endocrine system. The Asian corn borer enters the diapause state as a fifth-instar mature larvae. How to provide a miRNA that can regulate the diapause of Asian corn borer so as to release the diapause state of Asian corn borer, affect its normal development and cause its death is a problem that needs to be solved urgently by those skilled in the art. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a miR-iab-8 capable of regulating the diapause of Asian corn borer and its application.

[0005] The objective of the present invention is achieved through the following technical scheme: a miR-iab-8 capable of regulating the diapause of Asian corn borer, characterized in that the nucleotide sequence of the miR-iab-8 is as shown in SEQ ID NO:1.

[0006] Furthermore, the miR-iab-8 targets and negatively regulates the Cycle gene, thereby regulating the expression of genes related to the biological clock signaling pathway.

[0007] The nucleotide sequence of the Cycle gene is shown in SEQ ID NO:2.

[0008] The biological clock signaling pathway related gene is Tim, cry-1 or per.

[0009] The present invention also relates to the use of miR-iab-8 capable of regulating the diapause of Asian corn borer in preventing and controlling the Asian corn borer or in preparing an agent for preventing and controlling the Asian corn borer.

[0010] The present invention also relates to a method for controlling Asian corn borer, by promoting or inhibiting the expression of miR-iab-8 in the Asian corn borer that can regulate the diapause of the Asian corn borer, targeting the negative regulation of the Cycle gene, thereby regulating the diapause of the Asian corn borer, affecting the normal development of the Asian corn borer and causing its death; the nucleotide sequence of the miR-iab-8 is shown in SEQ ID NO: 1.

[0011] Furthermore, the substance that promotes the expression of miR-iab-8 in the Asian corn borer is as follows: miR-iab-8-sense strand: AGGAUACAUUCAGUAUACGUACA, SEQ ID NO: 3; miR-iab-8-antisense strand:UACGUAUACUGAAUGUAUCCUUU, SEQ ID NO:4.

[0012] Furthermore, the substance that inhibits the expression of miR-iab-8 in the body of Asian corn borer is as follows: miR-iab-8-antagomir:UGUACGUAUACUGAAUGUAUCCU, SEQ ID NO:5.

[0013] The beneficial effect of the present invention is that the present invention achieves silencing and overexpression of miR-iab-8 of the Asian corn borer through the inhibitor and agonist of miR-iab-8, thereby regulating the expression of the important gene Cycle in the growth and development process of the Asian corn borer, resulting in the larvae's metamorphosis and development being blocked and eventually dying. The present invention can be used to prepare a new type of nucleic acid pesticide, and has great application prospects in the green control technology of the Asian corn borer. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is the binding site of miR-iab-8 and Cyc target in Example 1 of the present invention, WT represents the wild-type binding region, and MT represents the mutation site; Figure 2 This is the in vitro activity assay of the dual luciferase in Example 2 of the present invention. In the figure, WT represents the wild type, which is a sequence without mutation constructed into the luciferase plasmid; MT represents the mutant type, which is a mutant sequence constructed into the luciferase plasmid; the empty vector is a blank control, and no vector is constructed in the luciferase plasmid; PC is a positive control, and the antisense complementary sequence of miR-iab-8 is constructed into the luciferase plasmid; Figure 3 The expression profile of miR-iab-8 and Cyc in the larval stage of Asian corn borer in Example 3 of the present invention; Figure 4 The effect of miR-iab-8 on Cyc in Example 4 of the present invention, wherein A is the expression level of miR-iab-8 after treatment with miR-iab-8 agomir under non-diapause (ND) and diapause (D) conditions (AgomiR-iab-8 is the experimental group, and Ago NC is the control group); B is the expression level of miR-iab-8 after treatment with miR-iab-8 antagomir under ND and D conditions (Ant miR-iab-8 is the experimental group, and Ant NC is the control group); C is the expression level of Cyc after treatment with miR-iab-8 agomir under ND and D conditions (Ago miR-iab-8 is the experimental group, and Ago NC is the control group); D is the expression level of Cyc after treatment with miR-iab-8 antagomir under ND and D conditions (Ant miR-iab-8 is the experimental group, and Ant NC is the control group); Figure 5The effects of miR-iab-8 on genes related to the biological clock signaling pathway in Example 4 of the present invention, wherein A is the effect of injection of Ago miR-iab-8 and Ago NC on related genes under D conditions (Ago miR-iab-8 is the experimental group, and Ago NC is the control group); B is the effect of injection of Ant miR-iab-8 and Ant NC on related genes under D conditions (Ant miR-iab-8 is the experimental group, and Ant NC is the control group); C is the effect of injection of Ago miR-iab-8 on related genes under ND conditions (Ago miR-iab-8 is the experimental group, and Ago NC is the control group); D is the effect of injection of Ant miR-iab-8 and Ant NC on related genes under ND conditions (Ant miR-iab-8 is the experimental group, and Ant NC is the control group); Figure 6 The effect of miR-iab-8 on pupation in Example 5 of the present invention, wherein A is the effect on the pupation state after injection of AgomiR-iab-8 and Ago NC into diapausing insects (Ago miR-iab-8 is the experimental group, and Ago NC is the control group), and B is the effect on the pupation state after injection of Ant miR-iab-8 and Ant NC into non-diapausing insects (Ant miR-iab-8 is the experimental group, and Ant NC is the control group).

[0015] Figure 7 The effect of miR-iab-8 on metamorphosis in Example 5 of the present invention, wherein (a), (b), (c), and (d) are the conditions in which the larvae in the treatment group are released from diapause and continue to develop to the next instar after Ago miR-iab-8 is injected into diapause insects; Figure 8 This is a statistical analysis of the data in Example 5 of the present invention, wherein A is a statistical analysis of the diapause rate of Asian corn borer after the diapause insects were injected with Ago miR-iab-8 and Ago NC (Ago miR-iab-8 was the experimental group, and Ago NC was the control group), and B is a statistical analysis of the pupation rate of Asian corn borer after the non-diapause insects were injected with Ant miR-iab-8 and Ant NC (Ant miR-iab-8 was the experimental group, and Ant NC was the control group). DETAILED DESCRIPTION

[0016] The present invention is described in detail below in conjunction with the accompanying drawings.

[0017] Example 1 Prediction of the binding site between miR-iab-8 and the target gene Cycle The Cycle gene sequence was obtained according to the Asian corn borer transcriptome database (the full-length cDNA sequence is shown in SEQ ID NO: 2, with a total length of 2897 bp, including 344 bp in the 5′ non-coding region and 450 bp in the 3′ non-coding region). On this basis, the middle fragment (ORF region fragment) of the Cyc gene was amplified. The ORF region fragment was 2103 bp in length and encoded a total of 700 amino acids. The amino acid sequence is shown in SEQ ID NO: 6.

[0018] Cycle gene cDNA full-length sequence: TGACGTTTATAAACTTTTTGAGACAAGACAAACAGGCAGCGATTAGATCGTACTTTATTCCTTCATAA TATTGTATAATTCAAACTGGTTTTTTGTGCGTGTGTGTTTATTTGACTCGGTATTTTCCATTAAAATGTGTTTTTG AAATCTTGTGGTTGAAAATTGTGTTTTCAAACTATTTTGTGTATTGTGATCACAAGTGTCTGGATATTTGATAACT GCTCAGTTCGTGGAGTTTCCATGCTTTTTACCGCAGGATGGACGATTTCCATAGCCGACCTAGTACATCAAAGAGT GGGCAGTAGACCCGGGGCCCGGCGCGGCAGCCGCAGCTGGCACGAGTCGCGAAAGAGGCTGCTTCATATAAGGAGGTGCGACCTAATCTACTTTGTTACTC GTGTACCATCCTTCTTTCTTACCTTACTTAACAGTTCAAAGTGACACCTTATTTTGAAACCTTATTTCTTTAAATT AAGATTACAATTGTATACTTGCTGTATCCGTCTCGTGGAATCGATCAACGTGGAAAGCATTAGGGGAGGCCTATGT TCAGCAGTGGACGTGCTATGGCTGAAATGATGATGATGATGGTGTATCCGTCTTAAAGTTCCGAATTTATTCGAGA TTGTGCTGTCTCCGATAACCGTTCAGAATGACACCTTATTTCTTTAAATTAACATTAGAAGTGTATACTTGCTGTA TCCGTCTTAAAGTTCCGAATGTATTCGAGATTGTGCTGTAATTTCTACAATACTTACATACTTCTATGCATGCTAA AGCACCTCCTTGAAAAA, SEQ ID NO:2.

[0019] In the above sequence, the underlined part is the 5' non-coding region, the wavy part is the 3' non-coding region, and the middle part is the open reading frame ORF.

[0020] ORF encoding amino acid sequence: , SEQ ID NO:6.

[0021] Online software was used to predict the target sites on miRNA and Cyc gene sequences. The target gene Cyc sequence and multiple miRNAs were placed in the prediction software (miRanda software) respectively. After software analysis, it was finally found that miR-iab-8 could bind to Cycle, and the target binding site was in the 3′ non-coding region (such as Figure 1 shown).

[0022] Example 2 Dual luciferase reporter system detection (1) Construction of dual luciferase vector The wild-type (WT) sequence (200 bp) and mutant (MT) sequence (200 bp) in the 3′UTR of the Cycle gene with the miR-iab-8 target site were synthesized by overlap extension PCR. The specific sequences are as follows: Wild-type (WT) sequence: ttcaaagtgacaccttattttgaaaccttatttctttaaattaagattacaattgtatacttgcTGTATCCgtctcgtggaatcgatcaacgtggaaagcgt ctccgataaccgttcagaatgacaccttatttctttaaattaacattagaagtgtatacttgcTGTATCCgtcttaaagttccgaatgtattcgagat, seq ID NO:7.

[0023] Mutant (MT) sequence; ttcaaagtgacaccttattttgaaaccttatttctttaaattaagattacaattgtatacttgcACATAGGgtctcgtggaatcgatcaacgtggaaagcgt ctccgataaccgttcagaatgacaccttatttctttaaattaacattagaagtgtatacttgcACATAGGgtcttaaagttccgaatgtattcgagat, seq ID NO:8.

[0024] The above sequences were recombined into GP-mirGLO vectors and sequenced for verification. The specific method is as follows: Oligo design was performed, and the forward and reverse primers of the Cycle gene were added with the SacI and XhoI homologous sequences of the GP-miRGLO vector, respectively, for vector subcloning. The vector construction primers are shown in Table 1. The first round of PCR reaction was performed after the oligo was diluted to 50 μM.

[0025] Table 1 Primers for vector construction Primer Name Sequence (5’-3’) Cyc 3′UTR-miR-iab-8-WT-1 TCTAGTTGTTTAAACGAGCTCTTCAAAGTGACACCTTATTTTGAAACC,SEQ ID NO:9 Cyc 3′UTR-miR-iab-8-WT-2 TACAGCAAGTATACAATTGTAATCTTAATTTAAAGAAATAAGGTTTCAAAATAAGGTGTCACTTT,SEQ ID NO:10 Cyc 3′UTR-miR-iab-8-WT-3 ATTAAGATTACAATTGTATACTTGCTGTATCCGTCTCGTGGAATCGATCAACGTGGAAAGCGTCT,SEQ ID NO:11 Cyc 3′UTR-miR-iab-8-WT-4 TAATGTTAATTTAAAGAAATAAGGTGTCATTCTGAACGGTTATCGGAGACGCTTTCCACGTTGAT,SEQ ID NO:12 Cyc 3′UTR-miR-iab-8-WT-5 TGACACCTTATTTCTTTAAATTAACATTAGAAGTGTATACTTGCTGTATCCGTCTTAAAGTTCCG,SEQ ID NO:13 Cyc 3′UTR-miR-iab-8-WT-6 CAGGTCGACTCTAGACTCGAGATCTCGAATACATTCGGAACTTTAAGACGGATACAG,SEQ ID NO:14 Cyc 3′UTR-miR-iab-8-MUT-1 TCTAGTTGTTTAAACGAGCTCTTCAAAGTGACACCTTATTTTGAAACC,SEQ ID NO:15 Cyc 3′UTR-miR-iab-8-MUT-2 TATGTGCAAGTATACAATTGTAATCTTAATTTAAAGAAATAAGGTTTCAAAATAAGGTGTCACTT,SEQ ID NO:16 Cyc 3′UTR-miR-iab-8-MUT-3 TTAAGATTACAATTGTATACTTGCACATAGGGTCTCGTGGAATCGATCAACGTGGAAAGCGTCTC,SEQ ID NO:17 Cyc 3′UTR-miR-iab-8-MUT-4 CTAATGTTAATTTAAAGAAATAAGGTGTCATTCTGAACGGTTATCGGAGACGCTTTCCACGTTGA,SEQ ID NO:18 Cyc 3′UTR-miR-iab-8-MUT-5 TGACACCTTATTTCTTTAAATTAACATTAGAAGTGTATACTTGCACATAGGGTCTTAAAGTTCCG,SEQ ID NO:19 Cyc 3′UTR-miR-iab-8-MUT-6 CAGGTCGACTCTAGACTCGAGATCTCGAATACATTCGGAACTTTAAGACCCTATGTG, SEQ ID NO:20 The reaction system is shown in Table 2.

[0026] Table 2 PCR reaction system <![CDATA[ Reagents ]]> volume oligo mix 6µL <![CDATA[10×Pfu Buffer (+Mg 2＋ )]]> 5µL dNTP 1µL Cycle3′UTR-miR-iab-8-WT-1 1µL Cycle 3′UTR-miR-iab-8-WT-6 1µL <![CDATA[ddH 2 The]]> 36µL Pfu DNA polymerase 0.3µL

[0027] The second round of PCR reaction was continued with Cycle 3′UTR-miR-iab-8-WT-1 and Cycle 3′UTR-miR-iab-8-WT-6, and the template was the product of the first round of PCR reaction.

[0028] Table 3 PCR reaction system Reagents volume First round PCR products 1µL <![CDATA[10×Pfu Buffer (+Mg 2＋ )]]> 5µL dNTP 1µL Cycle 3′UTR-miR-iab-8-WT-1 1µL Cycle 3′UTR-miR-iab-8-WT-6 1µL <![CDATA[ddH 2 The]]> 41µL Pfu DNA polymerase 0.3µL

[0029] The first round of PCR can obtain a non-single band PCR product mixture mixed with the target gene band, and then the first round of PCR product is used as a template to obtain a single target gene band through the second round of PCR. After the PCR reaction is completed, the Cycle-miR-iab-8-WT gene fragment is recovered by agarose electrophoresis and gel cutting.

[0030] The vector GP-mirGLO was digested with SacI and XhoI at 37°C for 2 h. The digestion system is shown in Table 4.

[0031] Table 4 Enzyme digestion system Reagents volume 10 × Buffer 5µL DNA 15µL SacI 1µL XOt 1µL <![CDATA[ddH 2 The]]> 28µL After electrophoresis, the Cycle 3′UTR-miR-iab-8-WT gene fragment and the vector pmirGLO were recovered using a DNA gel recovery kit. ® Entry One Step Cloning Kit, recombinant clone the amplified fragment into the linearized pmiRGLO vector, the connection system is shown in Table 5: Table 5 Connection system Reagents volume 5 × CE Entry buffer 4 µl GP-miRGLO 1µl Cycle 3′UTR-miR-iab-8-WT 2 µl Exnase Entry 2 µl <![CDATA[ddH 2 The]]> 11µl The components were gently mixed, incubated at 37°C for 30 min, and immediately placed in an ice water bath for 5 min after the reaction was completed.

[0032] Preparation of competent cells (calcium chloride method): 1) Pick a single colony from a fresh plate grown at 37°C for 16 hours and transfer it to a 1 L flask containing 100 ml LB medium. Grow vigorously at 37°C for 3 hours (rotating shaker, 300 rpm); 2) Aseptically transfer the bacteria to a sterile, disposable, ice-cold 50 ml polypropylene tube and place on ice for 10 minutes to cool the culture to 0°C. 3) Centrifuge at 4000 rpm for 10 min at 4°C to recover cells; 4) Pour out the culture medium and invert for 1 min to allow the last trace of culture medium to flow out; 5) Use 10 ml of ice-cold 0.1 mol / L CaCl 2 Resuspend each pellet and place on ice; 6) Centrifuge at 4000 rpm for 10 min at 4°C to recover the cells; 7) Pour out the culture medium and invert the tube for 1 min to allow the last trace of culture medium to flow out; 8) For every 50 ml of initial culture, add 2 ml of pre-cooled 0.1 mol / L CaCl 2 (containing 20% ​​glycerol) to resuspend the cell pellet; 9) Aliquot the cells into small aliquots (100 µl / vial) and freeze at -70°C.

[0033] Transform the recombinant ligation product into competent cells. The specific steps are as follows: 1) Take out the competent cells from -70℃ and place the centrifuge tube containing the competent cells on ice for 4 minutes. After the competent cells are thawed, add 10μl of the recombinant ligation product, gently mix the contents, and place it on ice for 30 minutes; 2) Place the centrifuge tube on a test tube rack in a water bath preheated to 42°C and leave it there for 90 seconds without shaking the centrifuge tube; 3) Quickly transfer the centrifuge tube to an ice bath and allow the cells to cool for 3 minutes; 4) Add 800 µl of LB medium (without antibiotics) to each centrifuge tube, then transfer the centrifuge tube to a 37°C shaker at 250 rpm for 45 minutes to allow the bacteria to recover; 5) Take 200µl of the cultured cells and spread them evenly on an LB plate containing 50µg / ml Ampicillin; 6) After the liquid on the plate is absorbed, place the plate upside down in a 37°C incubator and incubate for 16 hours.

[0034] Pick clones from the plate, extract plasmids and identify them, and pick out positive clones. The specific steps are as follows: 1) Pick 4 individual, full colonies from the cultured plate and place them in a test tube containing 5 ml of LB medium (containing 50 µg / ml Ampicillin); 2) Place the test tube in a bacterial shaker and culture at 37°C, 250 rpm for 16 hours; 3) Extract the plasmid from the cultured bacterial solution using a plasmid extraction kit (Tian Gen Biochemical, DP104-02) (see the instructions of the plasmid extraction kit for details of the plasmid extraction steps); 4) The extracted plasmid was subjected to double enzyme digestion identification. The reaction system of each tube is shown in Table 6; Table 6 Reaction system Reagents volume 10 × Buffer 1µL Plasmids 1µL SacI 0.5µL XOt 0.5µL ddH2O 7µL 5) Enzyme digestion at 37°C for 1 hour, followed by electrophoresis. The clone with the band obtained by enzyme digestion in the area corresponding to the target band size is the positive clone.

[0035] The construction method of Cycle-miR-iab-8-MT vector is the same as above.

[0036] (2) Cell culture and transfection 1) 293T cells were routinely cultured using DMEM medium containing 10% FBS (1.5 mg / L Glutamine, 100 U / ml Penicillin, 100 μg / ml Streptomycin) at 37°C in 5% CO 2 Culture in a saturated humidity incubator; 2) Digest and resuspend the cells in good condition, take an appropriate amount of cells and inoculate them into a 12-well plate, incubate them in a 37°C incubator overnight, at a density of 60%, and perform transfection according to the groups in Table 7; Table 7 Transfection groups

[0037] 3) Preparation of transfection complexes: TubeA: Add 4 μL GP-transfect-Mate to 50 μL serum-free medium, mix well, and leave at room temperature for 5 min; TubeB: Add 50 pmol of mimics and 1 ug of plasmid to 50 μL of serum-free medium, mix well, and place at room temperature for 5 min; Mix TubeA and TubeB and place at room temperature for 20 minutes; 4) Aspirate the original culture medium in the 12-well plate, add 400 μl serum-free culture medium, and then add the transfection complex dropwise to a total system of 500 μL, and culture in a 37°C incubator; 5) After 6 hours, replace the culture medium with fresh one and culture in a 37°C incubator until 48 hours after transfection. Samples should be collected for testing. The cells should be in normal condition when samples are collected.

[0038] (3) Dual luciferase system detection 1) removing the culture medium from the cultured cells; 2) Wash the cultured cells with 1× PBS and discard the washing solution; 3) Add 400 μL of 1× cell lysis buffer to the culture wells and lyse at room temperature for 1 h; 4) Take 50 μL of cell lysate and add it to a black 96-well plate. Set up 3-5 well replicates according to experimental needs; 5) Add 50 μL of firefly luciferase reaction solution, shake the plate to mix, and detect the activity of firefly luciferase. The detection process should be completed within 30 min; 6) Add 50 μL of Renilla luciferase reaction solution, immediately shake the plate to mix, and detect the activity of Renilla luciferase; 7) Analyze the data: The results show that Figure 2 As shown in the figure, the empty group and PC group were normal, which served as quality control standards, indicating that the experiment was stable and reliable. In the experimental group, miR-iab-8 was co-transfected with the Cycle wild-type plasmid for 48 hours. Compared with the negative control group (mimic NC), the relative luciferase expression was significantly downregulated, indicating that miR-iab-8 had a certain binding with Cycle. After the site in the Cycle sequence that binds to miR-iab-8 was mutated and co-transfected with miR-iab-8, the luciferase expression was not significantly different from that of the co-transfected mimic NC, indicating that the binding of this site with miR-iab-8 was specific. The experimental results show that miR-iab-8 can regulate the expression of Cycle by interacting with the Cycle 3′UTR region.

[0039] Example 3 Analysis of the expression pattern of miR-iab-8 and Cycle qPCR technology was used to detect the expression levels of miR-iab-8 and Cycle at five time points in five larval instars (1L, 2L, 3L, 4L, and 5L). The primers used for qPCR are shown in Table 8.

[0040] Table 8 Primers used for qPCR qmiR-iab-8-F ACATGCATATGACTTACATAGGA, SEQ ID NO:21 qU6-F GGAACGATACAGAGAAGATTAGC, SEQ ID NO:22 qU6-R TGGAACGCTTCACGAATTGCG, SEQ ID NO:23 qCycle-F CTACTTGAAGTCTTGGGCGC, SEQ ID NO:24 qCycle-R GTCACCCCCTCTGATCCACGAA, SEQ ID NO:25 qβ-actin-F CCGTCCTCCTGACCGAGGCTC, SEQ ID NO:26 qβ-actin-R GGTGTGGGAGACACCATTCCG, SEQ ID NO:27 The results show that if Figure 3As shown in the figure, Cyc showed a down-regulation trend from the 1st to the 2nd instar, then gradually increased, reached the highest expression level at the 3rd instar, then showed a downward trend, and then gradually increased, while the expression level of miR-iab-8 was opposite to that of Cyc. This expression trend indicates that miR-iab-8 has a negative regulatory relationship with Cyc.

[0041] Example 4 miR-iab-8 regulates the expression level of Cyc When the larvae of Ostrinia furnacalis developed to the fifth instar, 1 μL of miR-iab-8 agonist agomir (Ago miR-iab-8) or miR-iab-8 inhibitor antagomir (Ant miR-iab-8) was injected into the larvae of ND and D using a microinjector, and the control group was injected with an equal amount of agomirNC (Ago NC) or antagomirNC (AntNC). 48 hours after injection, total RNA was extracted for reverse transcription, and the overexpression and inhibition efficiency were detected using qPCR technology, and the expression changes of Cycle and circadian clock pathway-related genes Tim, Cry-1 and Per were detected. miR-iab-8 agomir, miR-iab-8 antagomir, agomir NC and antagomir NC were all synthesized by Shanghai Jima Company, and the sequences used are shown in Table 9.

[0042] Table 9 miR-iab-8 agonists and inhibitors Primer name Sequence (5'-3') agomir miR-iab-8-sense strand AGGAUACAUUCAGUAUACGUACA, SEQ ID NO:3 miR-iab-8-antisense strand UACGUAUACUGAAUGUAUCCUUU, SEQ ID NO:4 NC agomir-sense strand UUCUCCGAACGUGUCACGUTT, SEQ ID NO:28 NC agomir-antisense strand ACGUGACACGUUCGGAGAATT, SEQ ID NO:29 antagomir miR-iab-8antagomir UGUACGUAUACUGAAUGUAUCCU, SEQ ID NO:5 NC antagomir CAGUACUUUUGUGUAGUACAA, SEQ ID NO:30 The results showed that the expression level of miR-iab-8 was significantly increased 48 h after injection of Ago miR-iab-8 into ND and D larvae (see Figure 4 A), while the expression of Cycle was significantly downregulated (see Figure 4 C); After injection of Ant miR-iab-8 into ND and D larvae, the expression level of miR-iab-8 decreased significantly (see Figure 4 B), while the expression level of Cycle increased significantly (see Figure 4 D). This indicates that the expression of Cycle gene is negatively regulated by miR-iab-8.

[0043] At the same time, it was found that after injection of Ago miR-iab-8 into D larvae, Tim and Per were significantly upregulated compared with the control group Ago NC (see Figure 5 A), Tim and Per expression levels were downregulated after injection of Ant miR-iab-8 (see Figure 5 B), under ND conditions (see Figure 5C, 5D), indicating that miR-iab-8 has a positive regulatory effect on Tim and Per. After injection of Ago miR-iab-8 and Ant miR-iab-8 into D larvae, the expression of Cry-1 increased significantly (see Figure 5 A, 5B), while the expression levels of Cry-1 were significantly decreased after injection of AgomiR-iab-8 and Ant miR-iab-8 into ND larvae, indicating that the expression level of Cry-1 was not regulated by miR-iab-8 agonists and inhibitors.

[0044] Example 5 miR-iab-8 targets Cycle to regulate the metamorphosis of Asian corn borer When the larvae of the Asian corn borer developed to the fifth instar, the injection was performed, and the injection dose was 1 μL (the treatment method was the same as in Example 4). Under condition D, the larvae in the Ago miR-iab-8 treatment group showed significant growth and development differences compared with the control group. Figure 6 (A) As shown in the right figure, the larvae injected with Ago miR-iab-8 successfully escaped diapause and developed into pupae, while the larvae in the control group remained in diapause. Figure 6 (A) As shown in the left figure. Among the larvae that have been released from diapause, 40% develop into deformed pupae, see Figure 7 (a), (b), (C), these deformed pupae cannot develop into adults normally and eventually die. The other 60% develop into normal pupae, but eventually cannot survive due to their broken wings. Figure 7 (d). In contrast, under ND conditions, all larvae injected with Ant miR-iab-8 entered diapause, as shown in Figure 6 (B) As shown in the right figure, the control group developed normally to the pupal stage, as shown in Figure 6 (B) As shown in the left figure.

[0045] Larvae injected with Ago miR-iab-8 began to break out of diapause on the second day, and the diapause rate dropped to 10% on the 10th day (see Figure 8 A), the larvae released from diapause began to pupate gradually, and the pupation rate increased to 90% on the 10th day (see Figure 8 B) The experimental results show that AgomiR-iab-8 can induce larvae to exit diapause and continue to develop to the next instar, but this process is accompanied by high deformity and mortality. In addition, larvae injected with Ant miR-iab-8 began to enter diapause on the second day, and the diapause rate reached 100% on the 10th day (see Figure 8 C), all the test insects did not pupate (see Figure 8 D). This indicates that Ago miR-iab-8 and Ant miR-iab-8 can change the homeostasis of the Asian corn borer and affect the metamorphosis of the larvae.

[0046] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A miR-iab-8 capable of regulating diapause of Asian corn borer, characterized in that: The nucleotide sequence of miR-iab-8 is shown in SEQ ID NO:

1.

2. The miR-iab-8 capable of regulating diapause of Asian corn borer according to claim 1, characterized in that: The miR-iab-8 targets and negatively regulates the Cycle gene, thereby regulating the expression of genes related to the biological clock signaling pathway.

3. The miR-iab-8 capable of regulating diapause of Asian corn borer according to claim 2, characterized in that: The nucleotide sequence of the Cycle gene is shown in SEQ ID NO:

2.

4. The miR-iab-8 capable of regulating diapause of Asian corn borer according to claim 2, characterized in that: The biological clock signaling pathway related gene is Tim, cry-1 or per.

5. Use of miR-iab-8 capable of regulating diapause of Asian corn borer according to any one of claims 1 to 4 in controlling Asian corn borer or in preparing an agent for controlling Asian corn borer.

6. A method for controlling Asian corn borer, characterized in that: By promoting or inhibiting the expression of miR-iab-8 capable of regulating the diapause of Asian corn borer as claimed in claim 1 in the body of Asian corn borer, the Cycle gene is negatively regulated, thereby regulating the diapause of Asian corn borer, affecting the normal development of Asian corn borer and causing its death; the nucleotide sequence of the miR-iab-8 is shown in SEQ ID NO:

1.

7. The method for controlling the Asian corn borer according to claim 6, characterized in that: The substance that promotes the expression of miR-iab-8 in the Asian corn borer is as follows: miR-iab-8-sense strand: AGGAUACAUUCAGUAUACGUACA, SEQ ID NO: 3; miR-iab-8-antisense strand:UACGUAUACUGAAUGUAUCCUUU, SEQ ID NO:

4.

8. The method for controlling the Asian corn borer according to claim 6, characterized in that: The substance that inhibits the expression of miR-iab-8 in the body of Asian corn borer is as follows: miR-iab-8-antagomir:UGUACGUAUACUGAAUGUAUCCU, SEQ ID NO:5.

Images