Tbc1d24 gene mutants and uses thereof

Abstract

The present application relates to the technical field of genetic diagnosis, and specifically discloses a TBC1D24 gene mutant and application thereof. Specifically disclosed are any one of the following TBC1D24 gene mutants: a nucleic acid TBC1D24, which has a c.677_680delCCCG mutation and a c.731C>T mutation compared with a wild-type TBC1D24 gene with a sequence of SEQ ID NO:1; a polypeptide TBC1D24, which has a p.A226Gfs*28 mutation and a p.A244V mutation compared with a protein encoded by a wild-type TBC1D24 gene with a sequence of SEQ ID NO:2. The application also discloses application of the TBC1D24 gene mutant in screening of familial infantile myoclonic epilepsy. The present application widens the pathogenic gene spectrum of familial infantile myoclonic epilepsy, strengthens the understanding of the disease by clinicians, provides experience for screening and diagnosis of the disease in clinic, especially for pre-pregnancy screening, provides a research direction and a new theoretical basis for early diagnosis and effective treatment of the disease, and also provides a new molecular target for developing specific drugs for treating the disease in practice.

Description

[0001] This application is a divisional application of the parent application, Chinese Patent Application No. 202410635750.X, filed on May 22, 2024, which is about gene mutants and their applications. Technical Field

[0002] This invention relates to the field of gene diagnostic technology, and in particular to the TBC1D24 gene mutant and its applications. Background Technology

[0003] Familial infantile myoclonic epilepsy (OMIM: 605021), AR; Disease introduction: Myoclonic epilepsy, familial infantile type, also known as familial infantile myoclonic epilepsy, onset in early infancy, manifests as myoclonic epilepsy, febrile seizures, tonic-clonic seizures, good response to antiepileptic drug treatment, and normal intellectual and nervous system development; its clinical phenotypes include: dysarthria, generalized tonic-clonic seizures, generalized myoclonic seizures, febrile seizures, onset in infancy, varying degrees of manifestation, and focal epileptic seizures. An important gene associated with familial infantile myoclonic epilepsy is TBC1D24 (TBC1 domain family member 24). TBC1D24 encodes a protein with a conserved domain called the TBC domain, which is characteristic of proteins that interact with gtpases. TBC domain proteins act as gtpase activators of a specific group of gtpases, which are small gtpases of Rab (brain-associated ras protein) involved in regulating membrane transport. Abnormalities in the TBC domain are associated with myoclonic epilepsy. When all gtpase activators of a specific group of gtpases are abnormal, myoclonic epilepsy can be induced. Mucha BE et al. (PMID: 25719194) have also reported TBC1D24-related diseases, including familial infantile myoclonic epilepsy.

[0004] Furthermore, in the broad field of genetics, compound heterozygous mutations are a unique phenomenon, also known as bisalleotropic mutations. In these mutations, each chromosome is mutated, and none of them are wild-type chromosomes, but the types of alleles produced by the two chromosome mutations are different. Compound heterozygous mutations involve two distinct mutations in the same gene, one from the mother and one from the father, and both mutations affect the function of the protein encoded by the gene. This situation is frequently observed in genetics because a single mutation is usually insufficient to cause an obvious genetic disease, but when two mutations coexist, they can interact and lead to disease.

[0005] Currently, further research is needed to understand the link between the aforementioned diseases and specific genes, and screening methods for these diseases need to be improved to enable early screening of potential predisposing diseases and provide new ideas for subsequent treatment and early intervention. Summary of the Invention

[0006] This invention provides gene mutants and their applications, mainly to address the problems of incomplete pathogenic gene databases in the screening and diagnosis of familial infantile myoclonic epilepsy and autosomal dominant auditory neuropathy type 1, which prevent risk screening for some potential disease risks and require further improvement in treatment methods.

[0007] To solve the above problems, the present invention adopts the following technical solution:

[0008] This invention relates to TBC1D24 gene mutants and their applications.

[0009] One of them, the TBC1D24 gene mutant, is any one of the following, and as long as any one of them is satisfied, it should be within the scope of this invention:

[0010] The nucleic acid TBC1D24-1 contains a target fragment, and the target fragment has a c.677_680delCCCG mutation compared with the wild-type TBC1D24 gene with the sequence SEQ ID NO:1;

[0011] The nucleic acid TBC1D24-2 contains a target fragment, and the target fragment has a c.731C>T mutation compared with the wild-type TBC1D24 gene with the sequence SEQ ID NO:1;

[0012] The polypeptide TBC1D24-1, compared with the protein encoded by the wild-type TBC1D24 gene with the sequence SEQ ID NO:2, has the p.A226Gfs*28 mutation;

[0013] The polypeptide TBC1D24-2, compared with the protein encoded by the wild-type TBC1D24 gene with the sequence SEQ ID NO:2, has the p.A244V mutation.

[0014] In another scenario, the TBC1D24 gene complex mutant includes a complex heterozygous mutation, which simultaneously includes the c.677_680delCCCG mutation and the c.731C>T mutation; or,

[0015] Another possibility is that the TBC1D24 gene mutant is the TBC1D24 complex mutant protein encoded by the TBC1D24 gene complex, and the TBC1D24 complex mutant protein has both the p.A226Gfs*28 mutation and the p.A244V mutation.

[0016] The second of these is the application of reagents containing TBC1D24 gene mutants in the preparation of products for screening familial infantile myoclonic epilepsy; it includes at least the following aspects:

[0017] 1) When the product used to screen for familial infantile myoclonic epilepsy is also used to diagnose familial infantile myoclonic epilepsy: the reagents for detecting the aforementioned TBC1D24 gene mutants are nucleic acid TBC1D24-1 and nucleic acid TBC1D24-2 detection reagents. When the two chromosomes in the sample have TBC1D24 c.677_680delCCCG mutation and TBC1D24 c.731C>T mutation respectively, it is dominant. The sample source will inevitably show the familial infantile myoclonic epilepsy phenotype. Therefore, the sample must come from a patient with familial infantile myoclonic epilepsy (temporarily, both formed and unformed fetuses are considered patients).

[0018] 2) When the product used for screening familial infantile myoclonic epilepsy is a product for diagnosing autosomal recessive familial infantile myoclonic epilepsy: the reagent used to detect the aforementioned TBC1D24 gene mutant is a nucleic acid TBC1D24-1 or nucleic acid TBC1D24-2 test reagent. When the sample has only one of the TBC1D24 c.677_680delCCCG mutation and the TBC1D24 c.731C>T mutation, then the sample comes from a familial infantile myoclonic epilepsy carrier. However, the carrier himself does not exhibit the familial infantile myoclonic epilepsy phenotype. But when he / she has children with a carrier carrying the other mutation, the gene carrying the pathogenic mutation will be passed on to the next generation, and the next generation will have both chromosomes carrying the TBC1D24 c.677_680delCCCG mutation and the TBC1D24 gene mutation. The c.731C>T mutation can lead to a familial infantile myoclonic epilepsy phenotype, and in this case, having children with both parents may pose specific risks. Further analysis can be conducted based on the parents' testing results; for example, if both parents are carriers of two mutations, the offspring may exhibit a familial infantile myoclonic epilepsy phenotype.

[0019] The reagent for detecting the aforementioned TBC1D24 gene mutant is at least one of the probes and primers specifically targeting the TBC1D24 gene mutant, or other methods may be used; the primers are at least primer pairs: F-CATGACGTTTGGGGACCTGG, R-CCGGCGACCTACCTCTTCTG; the probes may be at least as shown in the examples below (the same applies below).

[0020] In the two parts mentioned above, it should be noted that:

[0021] The wild-type sequences listed above, SEQ ID NO:1 to SEQ ID NO:2, do not necessarily represent complete nucleotide or amino acid sequences; they may be fragments. Please refer to the specific full sequence version for details. The sequences cited in this disclosure are primarily for identifying specific mutation sites. However, wild-type nucleic acid and amino acid sequences are not limited to the listed examples. The location of the mutation and its variation are used as the basis for determining whether the schemes are the same or equivalent. The specific sequence of the mutation site can also be confirmed by combining various sequencing maps. In some cases, the site number in different versions of the sequence can be deduced from the sequence shown in the relevant sequencing map.

[0022] Disease screening mainly involves identifying the risk of disease to facilitate early intervention; diagnosis, on the other hand, is an auxiliary diagnostic tool for those who are already ill. Of course, whether someone is already ill is based on the actual changes in the patient's body and the corresponding standards and norms, not on the subjective perception of the individual.

[0023] When using the aforementioned mutants to construct biological models to study drug treatability, this should be considered as use of the present invention. For example, constructing animal models with specific mutants and then screening and verifying treatable drugs should be considered as manufacturing and using the aforementioned gene mutants. The constructs can also serve as models for verifying drug efficacy in the pharmaceutical process. For instance, introducing the construct into recipient cells causes the recipient cells to express proteins with the aforementioned mutations. One application of this cell model is for large-scale drug screening. Drugs can be used to act on the cell model to verify whether the drug has the effect of inhibiting the corresponding mutation, and further verify whether the drug can treat the corresponding disease by inhibiting the mutation. For example, this cell model can simulate the characteristics of the aforementioned related diseases, and then further verify the effects of some drugs in vitro using this model.

[0024] When mutations involve compound mutant genes, if neither mutation is dominant, then either mutation is recessive, or the two mutations are distributed on two chromosomes, they form a compound heterozygous (in trans) genotype. In this case, the phenotype will be manifested, leading to disease.

[0025] The reagents include at least one of antibodies, probes, primers, and mass spectrometry detection reagents specifically targeting the mutated nucleic acid or the mutated polypeptide. Specifically, the reagents include products for specifically detecting nucleic acids and products for specifically detecting polypeptides. These products can be at least any one of antibodies, probes, primers, and mass spectrometry detection reagents, and can also be other reagents with similar functions. Furthermore, the kit can be in the form of a kit similar to existing products, and the device can be a sequence detection device. Primers and probes can be either selected or combined as needed. The design of probes, primers, etc., when the mutation is known, is a conventional technique and is not subject to much limitation, as long as it can achieve the detection function.

[0026] The type of "nucleic acid" includes DNA, RNA or cDNA, and the type is not specifically limited. As long as it has a specific mutation compared with the wild-type gene, it should be identified as a nucleic acid within the scope of this invention.

[0027] It should be noted that the mutation sites and sequences given above are based on the content of sequencing platforms such as Burrows Wheeler. Those skilled in the art should understand that due to database updates or different databases, the mutation sites and sequences shown may be slightly different or varied. These differences or variations can all be found based on the content of the given database, and these differences or variations are also included within the protection scope of this invention.

[0028] This publication broadens the pathogenic gene spectrum of familial infantile myoclonic epilepsy and autosomal dominant auditory neuropathy type 1, enhancing clinicians' understanding of these diseases and providing experience for clinical screening and diagnosis. It also provides a basis for preconception and prenatal assessment of some diseases. Therefore, targeted genetic research on these diseases, clarifying the pathogenic genes and their pathogenic mechanisms, has potential clinical significance for genetic counseling and individualized prevention and treatment of these diseases. It provides research directions and new theoretical basis for the early diagnosis and effective treatment of these diseases, and will also provide new molecular targets for the development of effective drugs for these diseases in practice. Attached Figure Description

[0029] Figure 1 This is the pedigree chart for family lineage 1;

[0030] Figure 2 MRI image of the proband's brain;

[0031] Figure 3 The second-generation sequencing image of the proband 1;

[0032] Figure 4 This is a first-generation sequencing image of family 1;

[0033] Figure 5 This is the pedigree chart for family lineage 2;

[0034] Figure 6 MRI scan of the proband's brain;

[0035] Figures 7A-7B This is a second-generation sequencing image of Proband 2;

[0036] Figures 8A-8B This is a first-generation sequencing image of family 2;

[0037] Figure 9 This is the pedigree chart for family lineage 3;

[0038] Figure 10 The second-generation sequencing image of the proband 3;

[0039] Figure 11 This is a first-generation sequencing image of family 3;

[0040] Figure 12 This is the pedigree chart for family lineage 4;

[0041] Figures 13A-13B The second-generation sequencing image of the proband 4;

[0042] Figures 14A-14B This is a first-generation sequencing image of family 4. Detailed Implementation

[0043] The invention will now be described in detail with reference to specific research projects.

[0044] I. Introduction and Application Cases of Mutants

[0045] Here is a brief introduction to the clinical applications of this type of product. It can be used to analyze the obtained samples for testing. By analyzing whether the sample has specific mutations, it can determine whether the sample source has a certain disease or is a high-risk patient, thus providing a reference for clinical diagnosis and treatment. In particular, it provides better guidance in preconception screening, and can screen the fetus for potential serious diseases during pregnancy to provide accurate advice.

[0046] S1. Extracting nucleic acid samples from biological samples (the samples in this step can also be provided directly by the testing party): The type of biological sample is not particularly limited, as long as a nucleic acid sample reflecting whether there is a mutation in the genes of the biological sample can be extracted from it; the biological sample can be at least one selected from human blood, skin, and subcutaneous tissue, preferably peripheral blood. It should be noted that the term "nucleic acid sample" used in this section should be interpreted broadly, and it can be any sample that can reflect whether there is a mutation in the genes of the biological sample. For example, it can be whole-genome DNA directly extracted from the biological sample, or a part of the gene coding sequence contained in the whole genome, or total RNA extracted from the biological sample, or mRNA extracted from the biological sample. S2. After obtaining the nucleic acid sample, the nucleic acid sample is analyzed to determine the nucleic acid sequence of the obtained nucleic acid sample (mainly the target region where the mutation is located): The methods and equipment for determining the nucleic acid sequence of the obtained nucleic acid sample are not particularly limited. The nucleic acid sequence of the nucleic acid sample can be determined by sequencing. The methods and equipment used for sequencing are not particularly limited. Second-generation sequencing technology, as well as third-generation, fourth-generation, or more advanced sequencing technologies, can be used. At least one of the following devices—BGISEQ500, MGISEQ-200, MGISEQ-2000, MGISEQ-T7, HISEQ2000, SOLID, 454, ABI3730XL, and single-molecule sequencing devices—can be used to sequence nucleic acid sequences. It should be noted that the term "nucleic acid sequence" used in this section should be interpreted broadly. It can refer to the complete nucleic acid sequence information obtained after assembling the sequencing data obtained from sequencing nucleic acid samples, or it can refer to the sequencing data (reads) obtained directly from sequencing nucleic acid samples, as long as these nucleic acid sequences contain the coding sequence of the corresponding gene. S3. After determining the nucleic acid sequence of the nucleic acid sample, the obtained nucleic acid sequence is compared with the wild-type sequence: if the obtained nucleic acid sequence contains the specific mutation involved in this disclosure, it indicates that the biological sample is susceptible to the corresponding disease.

[0047] The methods and equipment for comparing the detected nucleic acid sequences with the wild type are not particularly limited, and any conventional software can be used. Unless otherwise specified, the techniques used in the examples are conventional methods familiar to those skilled in the art, and the reagents and products used are all commercially available. Various processes and methods not described in detail are conventional methods known in the art. The source, trade name, and components of the reagents used, if necessary, are indicated upon their first appearance. Subsequent use of the same reagents, unless otherwise specified, are identical to the initial indication.

[0048] II. Identifying the pathogenic gene and mutation site

[0049] 1. Sample collection subjects: The prior witnesses and their families in this study all signed informed consent forms.

[0050] Family pedigree 1: pedigrees of 12 susceptibility types to idiopathic generalized epilepsy were collected. □ indicates normal males, ○ indicates normal females, ● indicates affected females, and ■ indicates affected males (e.g., ...). Figure 1 Proband 1: At 58 days old, the child experienced one seizure, characterized by staring spells and unresponsiveness, lasting for several seconds before subsiding. This occurred 7-8 times a day. At that time, a cranial MRI and dynamic EEG were normal. In July 2020, a cranial MRI revealed white matter lesions. Developmental delay: The child could walk at 2.5 years old but could not walk independently, exhibiting abnormal posture. In April 2022, seizures occurred, characterized by altered consciousness, unilateral strabismus, and limb rigidity, lasting only briefly, occurring 4-5 times over two months. From August 2022 onwards, seizures occurred 1-2 times per month. The child's free development is delayed; currently, the child can only walk 2-3 steps independently. Regarding fine motor skills, the child can eat continuously but spills food; hands tremble easily when reaching for objects; can recognize familiar and unfamiliar people; can say "daddy," "mommy," etc., and a few verbs such as "want" and "eat," but pronunciation is slurred; occasionally can speak short sentences and occasionally engage in conversation; does not recognize numbers. The child feels recent regression in walking and posture. Physical examination: High muscle tone, especially in the lower extremities; knee reflex ++++; bilateral ankle clonus +. Abnormal posture: Walking with hands clasped, toe-walking, hip and knee flexion, intention tremor in both hands. Gene analysis report dated August 24, 2022: A heterozygous mutation (c389G>T) in SLC2A1 is suspected to be a pathogenic variant. Related diseases: 1. Susceptibility to idiopathic generalized epilepsy type 12, AD; Cranial MRI results in August 2022: Symmetrical bilateral cerebral hemispheres, good contrast between gray and white matter; small patchy T2-flair high signal shadows are seen in the posterior part of the bilateral semioval centrum and the posterior part of the ventricular body; DWI signal is not high, abnormal signal, poor myelination; Cranial MRI results in July 2023: Abnormal signal in the anterior part of the right external capsule, the anterior limb of the left internal capsule - the left corona radiata - the left frontal cortex, suggestive of encephalomalacia (mainly involving white matter, hemorrhage is highly likely based on signal characteristics).

[0051] Family pedigree 2: A familial pedigree of infantile myoclonic epilepsy was collected. □ indicates a normal male, ○ indicates a normal female, ■ indicates an affected male, ● indicates an affected female, ◧ indicates a male carrier, and ◐ indicates a female carrier (e.g., ...). Figure 5Proband 2: Proband 2 developed suspected seizures at 57 days old, several times a day, mainly manifested as clonic tremors of the left hand, sometimes tremors of both upper limbs or all four limbs, occurring once every few days, lasting from a few seconds to two hours; later the seizures changed to nodding, staring, raising both upper limbs or all four limbs, accompanied by facial flushing, unresponsiveness, and occurring in clusters, once or more than 20 times per episode, 1-6 times a day, followed by loud crying; at 2 months of age, diagnosed as "epilepsy (spastic seizures, focal seizures with status epilepticus)"; on November 26, 2021, a genetic test was completed and showed a complex heterozygous pathogenic variant of the TBC1D24 gene (carrier in both parents); at nine months of age, physical examination revealed epileptic encephalopathy, seizure status, manifested as limb tremors, decreased muscle tone, positive bilateral Babinski sign, and developmental delay. Head MRI: The examination showed a slight widening of the extracerebral space in the left temporal pole, and the right lateral ventricle was fuller than the contralateral side; multiple abnormal signals were observed in the bilateral basal ganglia, right thalamus, and bilateral occipital lobes. Three EEGs: 2-hour video EEG: high-level arrhythmia during wakefulness; 2-hour video EEG: multifocal spike waves, sharp waves, and spike-and-slow-wave discharges during wakefulness; 24-hour ambulatory EEG: abnormal ambulatory EEG and brain topography of the infant: mild asymmetry between the two hemispheres, with lower amplitude on the right side, and multifocal discharges predominantly in the left hemisphere during sleep. Head CT: The examination showed symmetrical bilateral cerebral hemispheres, normal gray-white matter contrast, no focal density abnormalities in either cerebral hemisphere, widening of the extracerebral space in the bilateral frontotemporal regions, with the widest point approximately 6.3 mm; the remaining ventricles and cisterns were normal in size and shape, the midline structures were in the center, no obvious abnormal density was seen in the infratentorial cerebellum, and the brainstem was normal, suggesting brain atrophy.

[0052] Family 3: Autosomal dominant auditory neuropathy type 1 was collected. □ represents a normal male, ○ represents a normal female, ■ represents an affected male, ● represents an affected female, ◧ represents a male carrier, and ◐ represents a female carrier (e.g., ...). Figure 9 Proband 3: Proband 3 has profound hearing loss in the left ear and severe hearing loss in the right ear. Clinical tests show that he / she is consistent with autosomal dominant auditory neuropathy type 1.

[0053] Family pedigree 4: Pedigrees of Dejerine-Sottas disease were collected. □ indicates a normal male, ○ indicates a normal female, ■ indicates an affected male, ● indicates an affected female, ◧ indicates a male carrier, and ◐ indicates a female carrier (e.g., ...). Figure 12 Proband 4: Proband 4 was born with weakness in all four limbs. He could lift his head and roll over at 6 months. His development was delayed after 6 months. He could sit independently at 10 months and could not walk at 1 year old. He was diagnosed with peripheral nerve damage in Jinan and has been in rehabilitation ever since. At 6 and a half years old, he could walk 5-6 steps barefoot and could stop on his own. He could not turn. His left fingers did not extend fully. His cognitive and language abilities were normal. He was conscious and had good mental responses. He had a weak gait, low distal muscle tone, muscle strength of 3-4, small muscle volume, and his knee tendon reflex was difficult to elicit. Babinski sign was negative. The preliminary diagnosis was peripheral neuropathy.

[0054] 2. Sample collection: Collect 5ml of peripheral blood from the venous tract of the patient, add EDTA for anticoagulation, and extract genomic DNA from 2ml of the blood using the Qiagen BloodDNA mini kit (Qiagen). After determining the concentration using Qubit (Qubit® dsDNA HS Assay Kit, Invitrogen), store at -20℃ for later use.

[0055] 3. Whole exome sequencing and result analysis

[0056] 3.1 Whole-exome sequencing: First, genomic DNA was fragmented using a Covaris ultrasonic disruptor. The fragmented products were then repaired at the ends, A-addition was performed, adapters were added, and amplification was carried out using a library construction kit to construct a pre-library. Next, the pre-library was processed using a human whole-exome sequence capture kit. Target regions were enriched using probe hybridization capture methods to obtain the final library. The library was analyzed for concentration and fragment distribution using the Qubit and QIAGEN QIAxcel Advanced fully automated nucleic acid analysis systems. Qualified libraries were quantified using a quantitative kit. Finally, sequencing was performed on a BGI MGISEQ-T7 gene sequencer.

[0057] The capture probe sequence used:

[0058] SLC2A1 c.389G>T: CGTCATGTGTGGCTACTACTT;

[0059] TBC1D24 c.677_680delCCCG:GGGGAGACGATGGAAGCGGAGCAAGTAAAGAA;

[0060] TBC1D24 c.731C>T:ATGGCGCACCACGACCGGTAG;

[0061] DIAPH3 c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA:TGACTGTCGGTACTACTGACCTAGATTCTC;

[0062] PRX c.3149G>A: TAGGGTCGGGGTCGGGAACGG;

[0063] PRX c.501dup:GCCGAAACTCCGGGGCTTGGGTCCCCCTTT.

[0064] 3.2 Data Processing: After sequencing, BWA software was used to align the quality-controlled sequences to the human genome reference sequence; GATK software was used to identify mutation sites in the target sequence, and Annovar annotation software was used to annotate the mutation sites to a public mutation database. Based on the frequency of the mutation sites in the normal population, sequence conservation, amino acid changes caused by the mutation, and their position in the protein structure, the extent of the mutation's impact on protein function was predicted; then, combined with the clinical phenotype of the samples, the pathogenicity of the mutations was interpreted according to the ACMG (The American College of Medical Genetics and Genomics) variant classification criteria and guidelines.

[0065] 3.3 Whole exome sequencing results:

[0066] First witness 1: Analysis of the sample revealed that the SLC2A1 gene has a heterozygous mutation: c.389G>T (exon4, NM_006516.4), a heterozygous mutation in which nucleotide 389 changes from guanine G to thymine T, ultimately leading to a missense mutation in which amino acid 130 changes from glycine to valine (p.Gly130Val).

[0067] Proband 2: Analysis of this sample revealed two heterozygous mutations in the TBC1D24 gene: c.677_680delCCCG (exon2, NM_001199107), a heterozygous mutation involving the deletion of nucleotides 677-680, resulting in a frameshift mutation of amino acids (p.A226Gfs*28); and c.731C>T (exon2, NM_001199107), a heterozygous mutation involving the change of nucleotide 731 from cytosine C to thymine T, resulting in the change of amino acid 244 from alanine to valine (p.A244V).

[0068] Proband 3: Analysis of this sample revealed a heterozygous mutation in the DIAPH3 gene: c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA (exon21, NM_001042517), a heterozygous mutation resulting in the deletion of nucleotides 2426-2456, TTGAAGAGCAGGTGAACAACATCAAACCTGA, leading to a frameshift mutation in amino acids (p.F809Sfs*12).

[0069] Proband 4: Analysis of this sample revealed two heterozygous mutations in the PRX gene: c.3149G>A (exon7, NM_181882.3), a heterozygous mutation in which nucleotide 3149 changes from guanine G to adenine A, resulting in amino acid 1050 changing from tryptophan to a terminator (p.Trp1050Ter); and c.501dup (exon7, NM_181882.3), a heterozygous mutation in which nucleotide 501 is directly copied downstream and inserted into nucleotide 501, resulting in a frameshift mutation in amino acid (p.Arg168SerfsTer55).

[0070] 3.4 Bioinformatics Predictive Analysis:

[0071] (1) Analysis of harmfulness and pathogenicity

[0072] Proband 1: SLC2A1 c.389G>T (p.Gly130Val). According to the ACMG variant classification guidelines, this variant is preliminarily identified as a likely pathogenic variant. PM1+PM5+PP3_Moderate+PM2_Supporting: PM1: This variant is located in a mutation hotspot region; PM5: Mutations at the same location have been reported in the literature database / Clinvar, but the amino acid changes are different; PP3_Moderate: The bioinformatics protein function comprehensive prediction software REVEL predicts it as harmful; PM2_Supporting: SIFT, PolyPhen_2, MutationTaster, and GERP+ predict the results as harmful, harmful, harmful, and harmful, respectively; Through family verification analysis, the father of the subject has no variant at this site, while the mother of the subject has a heterozygous variant at this site.

[0073] Proband 2: (a) TBC1D24 c.677_680delCCCG (p.A226Gfs*28), according to the ACMG guidelines, this variant is preliminarily identified as a likely pathogenic variant. PVS1+PM2: PVS1: This variant is a zero-effect variant (frameshift mutation), which can lead to loss of gene function; PM2: The frequency in the normal population database is -, which is a low-frequency variant; there are no reports of the correlation of this site in the literature database, and the ClinVar database has no pathogenicity analysis results for this site; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; through family verification analysis, the father of proband 2 has no variant at this site, and the mother of proband 2 has a heterozygous variant at this site. (ii) TBC1D24 c.731C>T (p.A244V), according to the ACMG guidelines, this variant is preliminarily identified as a likely pathogenic variant PM2+PM3(Trans)+PM5: PM2: The frequency in the normal population database is 0.000079, which is a low-frequency variant; PM3(Trans): Recessive genetic disease, which exists in trans form with another suspected pathogenic variant (forming a complex heterozygous variant with the aforementioned suspected pathogenic mutation); PM5: The mutation at the same position has been reported in the literature database / Clinvar, but the amino acid changes are different; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; Through family verification analysis, the father of proband 2 has a heterozygous variant at this site, while the mother of proband 2 has no variant at this site. Based on the above information, it can be confirmed that the c.677_680delCCCG mutation and the c.731C>T mutation on another chromosome constitute a complex heterozygous (in trans) genotype, which causes the proband 2 in this family of infantile myoclonic epilepsy to be the cause of the disease.

[0074] Proband 3: DIAPH3 c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA (p.F809Sfs*12). According to the ACMG guidelines, this variant is preliminarily identified as a likely pathogenic variant. PVS1+PM2: PVS1: This variant is a zero-effect variant (frameshift mutation), which may lead to loss of gene function; PM2: Its frequency in normal population databases is negative, indicating a low-frequency variant; there are no reports of its relevance in literature databases; the ClinVar database has no pathogenicity analysis results for this locus; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively. Family validation analysis shows that the proband's father has no variant at this locus, while the proband's mother has a heterozygous variant at this locus.

[0075] Proband 4: Detailed interpretation of ACMG genetic variation information is as follows: (I) PRX c.3149G>A (exon7, NM_181882.3), resulting in amino acid changes p.Trp1050Ter, which is a nonsense mutation. According to the ACMG guidelines, this variation is initially identified as a suspected pathogenic variation. PVS1+PM2_Supporting: PVS1: This variation is a zero-effect variation (nonsense mutation), which can lead to loss of gene function; PM2_Supporting: The frequency in the normal population database is -; There are no reports of the correlation of this site in the literature database, and there are no pathogenicity analysis results for this site in the ClinVar database; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; Through family verification analysis, the father of Proband 4 has no variation at this site, and the mother of Proband 4 has a heterozygous variation at this site. (ii) PRX c.501dup (exon7, NM_181882.3) leads to an amino acid alteration p.Arg168SerfsTer55, a frameshift mutation. According to the ACMG guidelines, this variant is preliminarily identified as a likely pathogenic variant. PVS1+PM2_Supporting: PVS1: This variant is a zero-effect variant (frameshift mutation), which can lead to loss of gene function; PM2_Supporting: The frequency in the normal population database is negative; there are no reports of the correlation of this locus in the literature database, and there are no pathogenicity analysis results for this locus in the ClinVar database; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; through family verification analysis, the father of proband 4 has a heterozygous variant at this locus, while the mother of proband 4 has no variant at this locus. Since both parents of proband 4 are carriers, it indicates that neither mutation is dominant. Based on the above information, it can be confirmed that the c.3149G>A mutation and the c.501dup mutation on another chromosome constitute a complex heterozygous (in trans) genotype, resulting in the disease in proband 4 of this Dejerine-Sottas family.

[0076] (2) Analysis of protein function and conservation

[0077] SLC2A1 c.389G>T (p.Gly130Val): This mutation causes the nucleotide at position 389 to change from guanine (G) to thymine (T), resulting in the change of amino acid at position 130 from glycine to valine. This affects the normal translation of the protein, leading to abnormalities in the GLUT1 protein encoded by SLC2A1 and resulting in susceptibility type 12 of idiopathic generalized epilepsy. GLUT1 encoded by SLC2A1 is highly conserved; if SLC2A1 encoding GLUT1 is abnormal, it will lead to a deficiency of GLUT1 protein, resulting in susceptibility type 12 of idiopathic generalized epilepsy.

[0078] TBC1D24 c.677_680delCCCG (p.A226Gfs*28): This mutation results in the deletion of nucleotides 677 to 680, causing amino acid 226 to change from alanine to glycine. This leads to a frameshift mutation in the subsequent amino acid sequence, and the deletion of 28 amino acids starting from this position, resulting in the termination of protein synthesis and affecting normal protein translation. TBC1D24c.731C>T (p.A244V): This mutation results in the change of nucleotide 731 from cytosine to thymine, causing amino acid 244 to change from alanine to valine, affecting normal protein translation. The TBC1D24 gene encodes a highly conserved TBC domain. TBC domain proteins act as activators of a specific set of gtpases. When abnormalities occur in all gtpase activators encoded by a set of TBC1D24 alleles on homologous chromosomes, it can lead to familial infantile myoclonic epilepsy. That is, when the two genes in this group of alleles have the above two mutations, the individual will exhibit the characteristics of familial infantile myoclonic epilepsy.

[0079] DIAPH3 c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA (p.F809Sfs*12): This mutation results in the deletion of nucleotides 2426 to 2456, causing phenylalanine at position 809 to be replaced by serine. This leads to a frameshift mutation in the subsequent amino acid sequence, and the deletion of 12 amino acids starting from this position. This affects normal protein translation, causing protein synthesis to terminate and resulting in autosomal dominant auditory neuropathy type 1. DIAPH3 encodes a conserved member of the clear subfamily of the Fulmin family. Abnormalities in DIAPH3 encoding lead to functional abnormalities in members of the clear subfamily of the Fulmin family, resulting in autosomal dominant auditory neuropathy type 1.

[0080] PRX c.3149G>A (p.Trp1050Ter): This mutation causes the 3149th nucleotide to change from guanine to adenine, resulting in the 1050th amino acid to change from tryptophan to glycine. This leads to the premature appearance of the stop codon, affecting normal protein translation. PRX c.501dup (p.Arg168SerfsTer55): This mutation causes the 501st nucleotide to be deleted, resulting in the 168th amino acid to change from arginine to serine. This causes a frameshift of 55 amino acids, leading to the appearance of a stop codon, terminating translation and affecting normal protein translation. The PRX gene encodes a protein involved in the maintenance of myelin sheath in peripheral nerves. The encoded protein contains two conserved PDZ domains. When both PDZ domains encoded by a set of alleles in the same homologous chromosome are abnormal, it leads to abnormal function of the PDZ domain protein, thus causing Dejerine-Sottas disease. That is, when both genes in this set of alleles have the above two mutations, the individual will exhibit the characteristics of Dejerine-Sottas disease.

[0081] 4. Sanger sequencing verification: The identified mutations were verified using Sanger sequencing. Take 20 ng of DNA (e.g., peripheral blood genomic DNA), use primers, and perform a PCR reaction according to the TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa) procedure.

[0082] Primer sequence 1: F-GTGGGAGGTAGGGGAGACTT, R-CACAGATCCGAGAGCCACTG.

[0083] Primer sequence 2: F-CATGACGTTTGGGGACCTGG, R-CCGGCGACCTACCTCTTCTG.

[0084] Primer sequence 3: F-AGCAGGGCTTTTCTCTCTTCC, R-TGCAATCAGGGCTGACATTT.

[0085] Primer sequence 4: F-CAGGTTTGCTCTCCCCAAGT, R-CACCTGAACCCTGTAGCCTG.

[0086] Sequencing analysis performed on the ABI 3730XL (Applied Biosystems) platform confirmed the presence of each mutation in the gene. Furthermore, analysis of samples from other individuals without the disease revealed no heterozygous or compound heterozygous mutations.

[0087] Overall Conclusions: (I) Based on the analysis of the proband 1 mutation: The heterozygous c.389G>T mutation in the SLC2A1 gene, detected by whole-exome sequencing, is the pathogenic cause of this idiopathic generalized epilepsy susceptibility type 12 family. The results of this study broaden the genetic spectrum of idiopathic generalized epilepsy susceptibility type 12, providing experience for the screening and diagnosis of idiopathic generalized epilepsy susceptibility type 12 in clinical practice, and also providing a basis for prenatal diagnosis. Therefore, targeted genetic research on idiopathic generalized epilepsy susceptibility type 12 will provide research directions and new theoretical basis for the early diagnosis and effective treatment of idiopathic generalized epilepsy susceptibility type 12, and will also provide new molecular targets for the development of effective drugs for the treatment of idiopathic generalized epilepsy susceptibility type 12 in practice. (II) Conclusions based on the analysis of the proband 2 mutation: The compound heterozygous mutations c.677_680delCCCG and c.731C>T in the TBC1D24 gene, detected by whole-exome sequencing, are the pathogenic cause of this family pedigree of infantile myoclonic epilepsy. The results of this study broaden the genetic spectrum of familial infantile myoclonic epilepsy, provide experience for the screening and diagnosis of familial infantile myoclonic epilepsy in clinical practice, and also provide a basis for prenatal diagnosis. Therefore, targeted genetic research on familial infantile myoclonic epilepsy will provide research directions and new theoretical basis for the early diagnosis and effective treatment of familial infantile myoclonic epilepsy, and will also provide new molecular targets for the development of specific drugs for the treatment of familial infantile myoclonic epilepsy in practice. (III) Conclusions based on the analysis of the proband's 3 mutation: The heterozygous mutation c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA in the DIAPH3 gene, detected by whole-exome sequencing, is the pathogenic cause of this family with autosomal dominant auditory neuropathy type 1. The results of this study broaden the genetic spectrum of autosomal dominant auditory neuropathy type 1, providing experience for the clinical screening and diagnosis of autosomal dominant auditory neuropathy type 1, and also providing a basis for prenatal diagnosis. Therefore, targeted genetic research on autosomal dominant auditory neuropathy type 1 will provide research directions and new theoretical basis for the early diagnosis and effective treatment of autosomal dominant auditory neuropathy type 1, and will also provide new molecular targets for the development of specific drugs for the treatment of autosomal dominant auditory neuropathy type 1 in practice.(iv) Based on the analysis of the proband's 4 mutations: The compound heterozygous mutations c.3149G>A and c.501dup in the PRX gene, detected by whole-exome sequencing, are the cause of Dejerine-Sottas disease in this family. The results of this study broaden the genetic spectrum of Dejerine-Sottas disease, provide experience for clinical screening and diagnosis of Dejerine-Sottas disease, and also provide a basis for prenatal diagnosis. Therefore, targeted genetic research on Dejerine-Sottas disease will provide research directions and new theoretical basis for early diagnosis and effective treatment of Dejerine-Sottas disease, and will also provide new molecular targets for the development of effective drugs for the treatment of Dejerine-Sottas disease in practice.

[0088] Those skilled in the art will appreciate that various modifications to the above embodiments can be made without departing from the overall spirit and concept of the present invention. For any omissions, reference can be made to the prior art, all of which fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.

Claims

1. A TBC1D24 gene mutant, characterized in that, The TBC1D24 gene mutant is a TBC1D24 complex mutant and has the following complex heterozygous mutations: The nucleic acid TBC1D24-1 contains a target fragment, and the target fragment, compared with the wild-type TBC1D24 gene with the sequence SEQ ID NO:1, has a c.677_680delCCCG mutation. The nucleic acid TBC1D24-2 contains a target fragment, and the target fragment has a c.731C>T mutation compared with the wild-type TBC1D24 gene with the sequence SEQ ID NO:

1.

2. The use of a reagent for specifically detecting the TBC1D24 gene mutant of claim 1 in the preparation of products for screening familial infantile myoclonic epilepsy; characterized in that, The product used for screening familial infantile myoclonic epilepsy is either a product for screening individuals with a family history of infantile myoclonic epilepsy or a product for screening carriers of genes associated with autosomal recessive familial infantile myoclonic epilepsy.

3. The application of the reagent for specifically detecting the TBC1D24 gene mutant of claim 1 according to claim 2 in the preparation of products for screening familial infantile myoclonic epilepsy; characterized in that, The reagent for specifically detecting the TBC1D24 gene mutant of claim 1 is at least one of the probes and primers specifically targeting the TBC1D24 gene mutant.

4. The application of the reagent for specifically detecting the TBC1D24 gene mutant of claim 1 according to claim 3 in the preparation of products for screening familial infantile myoclonic epilepsy; characterized in that, The primers are at least primer pairs: F-CATGACGTTTGGGGACCTGG, R-CCGGCGACCTACCTCTTCTG.

Images