Brassica napobrassica fatty acyl reductase BcFAR2 gene as well as expression protein and application thereof

Abstract

The invention relates to the technical field of plant genetic breeding, in particular to a brassica napobrassica fatty acyl reductase BcFAR2 gene and expression protein and application thereof, the base sequence of the brassica napobrassica fatty acyl reductase BcFAR2 gene is shown as SEQ ID NO.1, and the amino acid sequence of the expression protein is shown as SEQ ID NO.2. The brassica napobrassica fatty acyl reductase BcFAR2 gene is cloned, and the brassica napobrassica fatty acyl reductase BcFAR2 gene can be used for preparing the brassica napobrassica fatty acyl reductase BcFAR2 gene. The BcFAR2 gene overexpresses a black cabbage sterile plant, so that the pollen activity can be recovered; the pollen activity of the gene knockout black cabbage fertile plant can be obviously reduced; the gene is over-expressed in arabidopsis thaliana, and it is found that the salt tolerance of a transgenic plant can be remarkably improved; the gene is over-expressed in black cabbage, so that the salt tolerance is obviously enhanced.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic breeding, and in particular to a Wucai fatty acyl reductase BcFAR2 gene and its expression protein and application. Background Art

[0002] Wucai (Brassica campestris L.ssp.chinensis var.rosularis Tsen et Lee) is a biennial herbaceous plant of Brassica rapa, a species of the family Cruciferae. The leaves of Wucai have abundant bubble-like fresh wrinkles and high content of vitamin C. It is widely planted in the Yangtze River and Huaihe River basins in China and is an important economic crop.

[0003] Fatty acyl reductase (FAR) is a key enzyme in the fat metabolism process. Its main function is to catalyze the reduction of fatty acyl-CoA or acyl-ACP substrates to primary fatty alcohols under the influence of NADPH. So far, FAR genes related to sporopollenin synthesis have been studied in a variety of plants such as Arabidopsis, rice and corn. In addition to angiosperms, sporopollenin is also widely found in green algae, bryophytes, ferns, liverworts and even fungi. Fatty acyl reductase is an enzyme targeting acyl-CoA or acyl-ACP, which provides fatty alcohol substrates for the lipid synthesis process, and fatty alcohols are crucial for the formation of sporopollenin. Therefore, fatty alcohols play an indispensable role in sporopollenin synthesis. However, there is no report on the related function of BcFAR2 gene in Wucai. Therefore, studying the function of Wucai fatty acyl reductase BcFAR2 gene is of great significance to the theory and practical application of Wucai male sterility and stress tolerance breeding.

[0004] In view of the above-mentioned defects, the inventors of the present invention finally obtained the present invention after a long period of research and practice. Summary of the invention

[0005] The purpose of the present invention is to solve the problem of how to apply the Wucai fatty acyl reductase BcFAR2 gene to Wucai male sterility and stress tolerance breeding, and provide a Wucai fatty acyl reductase BcFAR2 gene and its expression protein and application.

[0006] In order to achieve the above object, the present invention discloses a Wucai fatty acyl reductase BcFAR2 gene, the base sequence of which is shown in SEQ ID NO.1.

[0007] The invention discloses an expression protein of a wucai fatty acyl reductase BcFAR2 gene, and the amino acid sequence is shown as SEQID NO.2.

[0008] The invention also discloses an overexpression vector of the Wucai fatty acyl reductase BcFAR2 gene, and the overexpression vector is p1305-BcFAR2.

[0009] The invention also discloses a silencing expression vector of the Wucai fatty acyl reductase BcFAR2 gene. The silencing expression vector is pCRISPR-BcFAR2, and the targeting site sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] The invention also discloses the application of the overexpression of the Wucai fatty acyl reductase BcFAR2 gene in restoring the pollen fertility of Wucai male sterile plants and improving salt tolerance.

[0011] The invention also discloses the application of the Wucai fatty acyl reductase BcFAR2 gene in regulating the expression of key Wucai salt tolerance genes.

[0012] The key genes are BcSTZ1 and BcSOS1.

[0013] The invention also discloses the use of the Wucai fatty acyl reductase BcFAR2 gene in enhancing the salt tolerance of Arabidopsis thaliana. The salt tolerance of Arabidopsis thaliana is enhanced by overexpressing the Wucai fatty acyl reductase BcFAR2 gene in Arabidopsis thaliana.

[0014] Compared with the prior art, the present invention has the following beneficial effects: the present invention clones the Wucai fatty acyl reductase BcFAR2 gene, and the Wucai sterile plants with overexpression of the BcFAR2 gene can restore pollen activity; the Wucai fertile plants with gene knockout can significantly reduce pollen activity; overexpression of the gene in Arabidopsis thaliana can significantly improve the salt tolerance of transgenic plants; and overexpression of the gene in Wucai can significantly enhance salt tolerance. It can be seen that the BcFAR2 gene has a wide range of applications in pollen development and salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 To clone the BrFAR2 gene from Wucai;

[0016] Figure 2 BcFAR2 gene expression analysis; A, relative expression of BcFAR2 in different organs of fertile and sterile plants; B, relative expression of BcFAR2 in different developmental stages of pollen in fertile plants, different lowercase letters indicate significant differences in expression at different stages (P<0.05, Duncan's method); C, relative expression of BcFAR2 gene in sterile plants relative to fertile plants at different developmental stages of pollen, asterisks indicate significant differences by Student's test, P<0.05 (*) or P<0.01 (**), ns indicates no significant difference, error bars indicate mean ± SE from three independent experiments;

[0017] Figure 3 Pollen fertility analysis of Arabidopsis thaliana mutant far2 overexpressing BcFAR2 gene; A, pollen fertility of Arabidopsis wild-type plant (Col-0); B, pollen fertility of Arabidopsis thaliana far2 mutant (far2); C, pollen fertility of Arabidopsis thaliana far2 mutant overexpressing BcFAR2 gene (far2 / BcFAR2);

[0018] Figure 4 Expression analysis of key fertility genes in Arabidopsis mutant far2 overexpressing BcFAR2 gene plants; A, relative expression of BcFAR2 gene in Arabidopsis wild type (Col-0), BcFAR2 overexpression (far2 / BcFAR2) and far2 mutant (far2); B, relative expression of AtAMS1 gene in Col-0, far2 / BcFAR2 and far2; C, relative expression of AtTDF1 gene in Col-0, far2 / BcFAR2 and far2; D, relative expression of AtMS1 gene in Col-0, far2 / BcFAR2 and far2, *** indicates extremely significant (P<0.001);

[0019] Figure 5 Analysis of salt tolerance of BcFAR2 in Arabidopsis; A, under 150 mM NaCl treatment, the expression levels of AtSTZ1 and AtSOS1 genes in far2 transgenic plants (far2 / BcFAR2) were significantly higher than those in mutant plants (far2); B, under 150 mM NaCl treatment, the proline content in far2 / BcFAR2 plants was significantly higher than that in far2, while the malondialdehyde content was significantly lower than that in far2; C, under 150 mM NaCl treatment, the relative water content and survival rate in far2 / BcFAR2 were significantly higher than those in far2 mutant plants;

[0020] Figure 6Analysis of the BcFAR2 gene regulating pollen fertility function; A: Analysis of the relative expression of BcFAR2 gene in fertile Wucai plants (12-14B), gene-edited Wucai plants [CRISPR-BcFAR2 (12-14B)], sterile plants (12-14A) and BcFAR2 transgenic Wucai [35S::BcFAR2 (12-14A)]; B: Analysis of pollen activity in 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, 35S::BcFAR2 (12-14A) plants; C: Analysis of the relative expression of BcFAR2 gene in 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, 35S::BcFAR2 (12-14A) plants; -BcFAR2 (12-14B), 12-14A, 35S::BcFAR2 (12-14A) plants; D: Relative expression analysis of BcTDF1 gene in 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, 35S::BcFAR2 (12-14A) plants; E: Relative expression analysis of BcMS1 gene in 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, 35S::BcFAR2 (12-14A) plants;

[0021] Figure 7 Figure 2 is an analysis of the salt tolerance of the BcFAR2 gene; A, the expression level of the BcFAR2 gene increased with the increase of NaCl concentration; B-C, the expression of BcSTZ1 and BcSOS1 genes in the fertile Wucai plant 12-14B and its BcFAR2 gene silenced plant [CRISPR-BcFAR2(12-14B)], the sterile plant 12-14A and its BcFAR2 overexpressed plant [35S::BcFAR2(12-14A)] under salt stress; D, the expression of BcSTZ1 and BcSOS1 genes in the 12-14B, CRISPR-BcFAR2(12-14B), 12-14A and 35S::BcFAR2(12-14A) plants under salt stress. Relative water content of leaves under stress conditions; E, malondialdehyde content of 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, and 35S::BcFAR2 (12-14A) plants under salt stress conditions; F, proline content of 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, and 35S::BcFAR2 (12-14A) plants under salt stress conditions; G, survival rate of 12-14B, CRISPR-BcFAR2 (12-14B), 12-14A, and 35S::BcFAR2 (12-14A) plants under salt stress conditions. DETAILED DESCRIPTION

[0022] The above and other technical features and advantages of the present invention are described in more detail below in conjunction with the accompanying drawings.

[0023] Example 1

[0024] Cloning of BcFAR2 gene

[0025] 1. Take the inflorescence of 12-14B fertile plants of Wucai, and use the flower buds in the tetrad stage as materials, extract total RNA, and reverse transcribe it into cDNA.

[0026] 2. Retrieve the CDS sequences of FAR2 genes of Arabidopsis, Chinese cabbage, rapeseed, and other cruciferous plants in the BRAD database and NCBI database; after BLAST comparison, design upstream and downstream specific primers FAR2-F1 and FAR2-R1 according to the homologous regions.

[0027] FAR2-F1:ATGGAAGCTCTCTTCTTGAC

[0028] FAR2-R1: TTAAGCTCTTCCCTTCAAG

[0029] 3. Using cDNA as template, FAR2-F as upstream primer and FAR2-R as downstream primer, carry out PCR reaction: Taq PCR Master Mix (25mM / L) 12.5μL, cDNA (100ng / μL) 1μL, Forward Primer (10μmol / L) 1μL, Reverse primer (10μmol / L) 1μL, ddH2O 9.5μL.

[0030] 4. The PCR-purified product was connected to the pMD19-T vector to obtain the pMD-BcFAR2 recombinant vector; the vector was transformed into DH5α Escherichia coli, and after the bacterial solution was verified to be positive by PCR, it was sequenced for confirmation.

[0031] like Figure 1 As shown, the BcFAR2 gene sequence cloned from Wucai is 1842 bp in length and encodes 614 amino acids; its base sequence is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2.

[0032] Example 2

[0033] Detection of BcFAR2 gene expression

[0034] 1. Take the inflorescences of the fertile line 12-14B and the male sterile line 12-14A of Wucai at full flowering stage, divide the flower buds into four developmental stages: pollen mother cell stage, pre-tetrad stage, post-tetrad stage, and pollen grain maturity stage, and extract RNA from each stage and reverse transcribe them into cDNA.

[0035] 2. Using the BcFAR2 gene sequence as a template, design the upstream and downstream specific primers BcFAR2-F2 and BcFAR2-R2 for fluorescence quantitative PCR.

[0036] BcFAR2-F2: TGCTAAGCATGGAGTGGTGA

[0037] BcFAR2-R2:AAGAAGCTCTGCCAAGTCCT

[0038] 3. Fluorescence quantitative PCR analysis was performed using the BcActin gene as an internal reference (BcActin-F: TGGGTTTGCTGGTGACGAT, BcActin-R: TGCCTAGGACGACCAACAATACT).

[0039] The results are as follows Figure 2 As shown in Figure 2, the BcFAR2 gene was expressed in the roots, stems, leaves, and flowers of the 12-14B fertile plants and the 12-14A sterile plants, but the highest expression level was in the flower buds ( Figure 2 A); The expression level of BcFAR2 gene in different developmental stages of anthers of 12-14B fertile plants showed that the expression level of this gene increased significantly in the tetrad stage ( Figure 2 B), indicating that this gene may be related to the development of the tapetum; the expression of BcFAR2 gene in sterile plants was significantly reduced compared with that in fertile plants ( Figure 2 C), indicating that this gene is involved in tapetum development and abnormal expression of this gene may lead to pollen abortion.

[0040] Example 3

[0041] Construction of BcFAR2 gene overexpression vector

[0042] 1. Use CE Design V and Snap Gene software to design the BcFAR2 gene homologous recombination primer sequences 1305FAR2-F and 1305FAR2-R.

[0043] 1305FAR2-F:gacgatgacgataagggatccATGGAAGCTCTCTTCTTGACTTCTTC

[0044] 1305FAR2-R:tgcctgcaggtcgactctagaTTAAGCTCTTCCCTTCAAGACATG

[0045] 2. Using the pMD-BcFAR2 recombinant vector template, 1305FAR2-F as the upstream primer and 1305FAR2-R as the downstream primer, PCR amplification was performed, and the PCR product BcFAR2 fragment was purified.

[0046] 3. Double-digest the pCAMBIA1305 vector (containing the 35S-MYC-nos multicloning expression cassette) with BamH I and Xba I restriction endonucleases, and recover the digested fragments.

[0047] 4. Use plus One step PCR Cloning Kit was used to connect the PCR-purified BcFAR2 fragment with the pCAMBIA1305 double-digested fragment; the ligation product was transformed into Escherichia coli DH5α, and the bacterial solution was verified by PCR, and the positive bacterial solution was selected for sequencing confirmation, and finally the p1305-BcFAR2 overexpression vector was obtained.

[0048] 5. The p1305-BcFAR2 overexpression vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-p1305-BcFAR2 engineered bacteria.

[0049] Example 4

[0050] Construction of BcFAR2 gene silencing vector

[0051] 1. Use CHOPCHOP software to design BcFAR2 gene knockout targeting site sequences T1 and T2 online, as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0052] T1(50%GC):CGAGAACGGGAGATACATTGAGG

[0053] T2(50%GC):GGCATTGTCAGTTTCTCCAAGG

[0054] 2. According to the targeting sites T1 and T2, using the BcFAR2 gene as a template, the forward and reverse primers FAR2gRT1 and FAR2-U3dT1, FAR2gRT2 and FAR2-U3dT2 containing the targeting sites were designed respectively.

[0055] FAR2gRT1:AACTTCTTCCCTTGGAGGAAACgttttagagctagaaat

[0056] FAR2-U3dT1:GAAGCATCAAACCAGAGAGGTCgaccaatggtgctttg

[0057] FAR2gRT2:CAGCTTCTTTGTTTTTGGCTTTgttttagagctagaaat

[0058] FAR2U3dT2: TGCTGAGACATTGGTTCTGTCTgaccaatgttgctcc

[0059] 3. Using the pYLgRNA-AtU3d-LacZ intermediate vector as a template, UF (CTCCGTTTTACCTGTGGAATCG) and FAR2-U3dT1 as primer pairs, FAR2gRT1 and gR-R (CGGAGGAAAATTCCATCCAC) as primer pairs were amplified respectively; 1 μL of each of the above PCR products was taken and diluted 10 times as a template, and Pps-RC (TTCAGAggtctcTACCGACTAGTATGGAATCGGCAGCAAAGG) and Pgs-GG2 (AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC) were used as primer pairs to perform PCR amplification of the U3dT1-gRNA fragment, and the PCR product was purified to obtain the T1sgRNA expression cassette. In the same way, pYLsgRNA-AtU3b was used as a template, and PCR was performed using UF and FAR2-U3dT2, FAR2gRT2 and gR-R as primer pairs, respectively. Then, Pps-GG2 (TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG) and Pgs-LC (AGCGTGggtctcGCTCGACGCGTATCCATCCACTCCAAGCT) were used as primer pairs to amplify the U3bT2-gRNA fragment by PCR, and the T2sgRNA expression cassette was obtained after purification.

[0060] 4. Take the purified products of the T1sgRNA expression cassette and T2sgRNA expression cassette, and perform restriction digestion-ligation reaction with pYLCRISPR / Cas9 plasmid (10×CutSmart Buffer 3μL, 10mM ATP 3μL, pYLCRISPR / Cas9 plasmid 160ng, T1sgRNA expression cassette 30ng, T1sgRNA expression cassette 30ng, BsaI-HF 1μL, T4 DNAligase 0.2μL, H2O final 30μL); reaction procedure: 37℃1min, 16℃, 1min, 30 cycles, 55℃5min; the purified products were transformed into DH5α Escherichia coli, the extracted plasmid was verified by Mlu I restriction digestion, and then sequenced to obtain the pCRISPR-BcFAR2 silencing vector.

[0061] 5. Transform the pCRISPR-BcFAR2 silencing vector into Agrobacterium GV3101 to obtain GV3101-pCRISPR-BcFAR2 engineered bacteria.

[0062] Example 5

[0063] BcFAR2 gene genetic transformation into Arabidopsis mutant far2

[0064] 1. The GV3101-p1305-BcFAR2 engineered bacteria obtained in Example 3 were used to infect the Arabidopsis mutant far2 by the inflorescence infection method to obtain T0 generation transgenic seeds.

[0065] 2. The T0 generation transgenic seeds were obtained and resistant plants were selected using hygromycin resistance. The PCR method was used for identification to obtain positive plants.

[0066] 3. After obtaining T1 seeds from positive plants, use the same method as above until obtaining T3 generation stable genetic transgenic plants (far2 / BcFAR2).

[0067] When the T3 transgenic plants were in full bloom, the pollen viability was measured using Alexander staining solution. Figure 3 As shown, genetic transformation of the Arabidopsis mutant far2 with the BcFAR2 gene can completely restore its pollen fertility.

[0068] Fluorescence quantitative PCR was used to detect the expression levels of the target gene and tapetum development key genes AtAMS1, AtTDF1, AtMS1, etc. in the transgenic plants far2 / BcFAR2. Figure 4 As shown, the expression levels of AtAMS1, AtTDF1, and AtMS1 genes in the transgenic plant far2 / BcFAR2 were restored to the expression levels in the wild type Col-0.

[0069] The far2 mutant and its BcFAR2 overexpressing plant far2 / BcFAR2 (4 leaves and one heart) were subjected to 150 mM NaCl salt tolerance analysis. The expression levels of salt tolerance-related genes such as AtSTZ1 and AtSOS1 were detected after 12 hours of treatment. The relative water content and proline and malondialdehyde content in the leaves were also detected. After 2 days of treatment, the plants were transferred to NaCl-free conditions for growth, and the surviving plants were counted. Figure 5 As shown in Figure 2, under salt damage, the expression levels of salt-tolerant genes AtSTZ1 and AtSOS1 and the relative proline content in far2 / BcFAR2 plants were significantly upregulated ( Figure 5 A, B), the relative water content of far2 / BcFAR2 plants was significantly higher than that of far2 mutant plants ( Figure 5 C), while the malondialdehyde content was significantly lower than that of far2 mutant plants ( Figure 5 B), and the survival rate of far2 transgenic plants under salt damage was significantly increased ( Figure 5 C).

[0070] Example 6

[0071] Genetic transformation of BcFAR2 gene into Wucai plants

[0072] 1. The GV3101-p1305-BcFAR2 engineered bacteria obtained in Example 3 were used to infect the flower buds of the fertile plants 12-14B of Wucai by the inflorescence infection method. After the infected flower buds opened, the pollen was pollinated on the stigma of the sterile plants 12-14A to obtain T0 generation transgenic seeds; the GV3101-pCRISPR-BcFAR2 engineered bacteria obtained in Example 4 were used to infect the flower buds of the fertile plants 12-14B of Wucai by the inflorescence infection method to obtain T0 generation transgenic seeds.

[0073] 2. After the p1305-BcFAR2 transgenic seeds germinated, they were identified by hygromycin and BcFAR2 target gene PCR to obtain positive transgenic plants; the fluorescent quantitative PCR technology was used to detect the expression level of BcFAR2 gene in positive plants, and plants with overexpression of BcFAR2 gene [35S::BcFAR2(12-14A)] were screened.

[0074] 3. After the pCRISPR-BcFAR2 transgenic seeds germinated, they were identified by hygromycin and Cas9 gene sequence PCR to obtain positive gene-edited plants; the targeted site detection primers (T1L: AATAAAGGGAGCAGAGTTCACCA, T1R: AACTTCTTCCCTTGGAGGAAAC; T2L: GAGAACGGGAGATACATTGAGG, T1R: CAGCTTCTTTGTTTTTGGCTTT) were used to detect the targeted site editing effect; the fluorescence quantitative PCR technology was used to detect the expression level of the BcFAR2 gene in the edited plants, and the plants with silent expression of the BcFAR2 gene [CRISPR-BcFAR2 (12-14B)] were screened.

[0075] Fluorescence quantitative PCR analysis was performed on the flower buds of the tetrad stage of BcFAR2 gene overexpression and gene silencing transgenic plants to detect the expression levels of BcAMS1, BcTDF1, and BcMS1; the results are as follows Figure 6 As shown in the results, overexpression of the BcFAR2 gene [35S::BcFAR2(12-14A)] in sterile plants of Wucai can significantly restore pollen fertility and the expression levels of BcAMS1, BcTDF1, and BcMS1 genes; while silencing the BcFAR2 gene [CRISPR-BcFAR2(12-14B)] in fertile plants of Wucai can significantly reduce pollen fertility and significantly downregulate the expression levels of BcAMS1, BcTDF1, and BcMS1 genes.

[0076] One-month-old fertile plants of Wucai (12-14B) were treated with 0, 50, 100, 150, and 200 mM NaCl, and the expression of BcFAR2 gene was detected at 12 h. The results showed that the expression of BcFAR2 gene increased with the increase of NaCl concentration ( Figure 7 A). The 150mM NaCl salt tolerance of 12-14B fertile plants, BcFAR2 gene silenced plants [CRISPR-BcFAR2(12-14B)] and sterile plants 12-14A 1-month-old seedlings were analyzed. The expression levels of genes such as BcSTZ1 and BcSOS1 were detected after 12 hours of treatment. The relative water content and the content of proline and malondialdehyde were also detected. After 2 days of treatment, the plants were transferred to NaCl-free conditions for growth, and the surviving plants were counted. The results are shown in Figure 7 As shown in Figures BG, under salt damage, the expression of salt-tolerant genes BcSTZ1 and BcSOS1 and the relative proline content in CRISPR-BcFAR2 (12-14B) plants were significantly downregulated, the relative water content survival rate and proline content were also significantly downregulated, while the malondialdehyde content was significantly upregulated ( Figure 7 F); In 35S::BcFAR2(12-14A) plants, the expression of BcSTZ1 and BcSOS1 salt-tolerance genes and relative proline content were significantly upregulated, and the relative water content, survival rate and proline content were also significantly upregulated, while the malondialdehyde content was significantly downregulated. This indicates that the upregulated expression of the BcFAR2 gene can enhance the salt tolerance of plants.

[0077] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. Those skilled in the art understand that many changes, modifications, and even equivalences may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention.

Claims

1. A Wucai fatty acyl reductase BcFAR2 gene, characterized in that: The base sequence is shown in SEQ ID NO.

1.

2. An expression protein of Wucai fatty acyl reductase BcFAR2 gene, characterized in that: The amino acid sequence is shown in SEQ ID NO.

2.

3. An overexpression vector of Wucai fatty acyl reductase BcFAR2 gene, characterized in that: The overexpression vector is p1305-BcFAR2.

4. A silencing expression vector of Wucai fatty acyl reductase BcFAR2 gene, characterized in that: The silencing expression vector is pCRISPR-BcFAR2, and the targeting site sequences are shown in SEQ ID NO.3 and SEQ ID NO.

4.

5. Application of overexpression of the Wucai fatty acyl reductase BcFAR2 gene in restoring the pollen fertility of Wucai male sterile plants and improving salt tolerance.

6. Application of a knockout gene for fatty acyl reductase BcFAR2 in causing pollen abortion and reducing salt tolerance in fertile plants of Wucai.

7. Application of a Wucai fatty acyl reductase BcFAR2 gene in regulating the expression of key genes for Wucai salt tolerance.

8. The use of a Wucai fatty acyl reductase BcFAR2 gene in regulating the expression of a Wucai salt-tolerance key gene as claimed in claim 7, characterized in that: The key genes are BcSTZ1 and BcSOS1.

9. An application of Wucai fatty acyl reductase BcFAR2 gene in enhancing salt tolerance of Arabidopsis thaliana, characterized in that: The salt tolerance of Arabidopsis thaliana is enhanced by overexpressing the Wucai fatty acyl reductase BcFAR2 gene in Arabidopsis thaliana.

Images