CsACS6 gene and application of CsACS6 gene in improvement of citrus canker resistance

Abstract

The invention discloses a CsACS6 gene and application of the CsACS6 gene to improvement of citrus canker resistance, and relates to the technical field of agricultural biology. The coding sequence of the CsACS6 gene is shown as SEQ ID NO.1, and the protein coded by the CsACS6 gene is ACC synthase. According to the invention, an overexpression vector of the CsACS6 coding sequence is constructed, and an agrobacterium tumefaciens-mediated method is utilized to transform citrus epicotyl, so that the expression level of CsACS6 in transgenic citrus is successfully improved, and a transgenic plant with obviously enhanced citrus canker resistance is obtained; the invention has important application value in canker-resistant breeding of citrus, lays a foundation for genetic breeding of citrus canker resistance, and greatly promotes the development and application of citrus canker-resistant genetic engineering.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology, and in particular to a CsACS6 gene and an application thereof in improving resistance to citrus canker. Background Art

[0002] Citrus is the largest fruit in southern my country and an important economic crop in the world. However, citrus canker has seriously hindered the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc), which originated in India, Java and other places (Hu Junhua et al., 2015). The main citrus producing areas in Fujian, Hunan, Guangdong and other places in my country are seriously affected by citrus canker. The canker bacteria mainly infect citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected (He Xiuling et al., 2007). Diseased trees will experience leaf fall, dead branches, weak tree vigor and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. Studies have found that sweet orange is most susceptible to the disease, followed by sour orange and pomelo (Yuan et al., 1997; Li et al., 2013).

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical control as the main method and biological control as the auxiliary method. However, since chemical control measures are not environmentally friendly, they are very likely to cause environmental pollution, and require a lot of manpower and material resources, and biological control has poor effects and high costs, it is urgent to reduce the losses caused by canker by breeding new disease-resistant varieties (Chen Li et al., 2008; Zhu Xuemei et al., 2017). The long hybrid breeding cycle makes breeding efficiency low. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the direction of disease-resistant genetic engineering. Genetic engineering methods have also been tried in the study of anti-ulcer disease (Duan Minjie et al., 2016; Jia Ruirui et al., 2017), and some transgenic materials resistant to canker disease have been obtained. For example, Chen Shanchun et al. obtained Jincheng, Xinhuicheng and Navelcheng orange lines that were resistant to citrus canker by carrying the antimicrobial peptide D gene of the silkworm (Chen Shanchun et al., 1996); the exogenous genes NLS, chit42, Xa21 and PthA were resistant to citrus canker after being transferred to Bingtangcheng, Ponkan and Sweet Orange (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor that responds to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker (Li et al., 2014); CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptibility gene CsLOB1 can obtain plants with improved resistance to citrus canker (Penget al., 2017).

[0004] ACC synthase (ACS) encoded by the ACS gene family is the rate-limiting enzyme in the ethylene biosynthesis pathway in plants. Its activity directly affects the rate of ethylene production in plants (Tsuchisaka et al., 2004), and thus plays an important role in plant growth, development, and response to abiotic and biotic stresses. For example, inhibiting the transcription of rice ACS1 can inhibit ethylene biosynthesis in rice and promote the elongation of rice taproots (Qin et al., 2019); salt stress can induce a significant outbreak of salt ethylene synthesis in Solanum nigrum and the expression of the ACS2 gene (Gharbi et al., 2016); Botrytis cinerea infection can induce the expression of ACS2, ACS6, ACS7, ACS8, and ACS11 in Arabidopsis (Li G et al., 2012).

[0005] At present, there is no research and application on using ACS gene to improve the resistance of citrus to citrus canker. Summary of the invention

[0006] The present invention aims to solve the technical problem that there is a technical gap in the existing technology in the research and application of using ACS genes to improve the resistance of citrus to citrus canker. The purpose is to provide a CsACS6 gene and its application in improving the resistance of citrus to citrus canker. By integrating the CsACS6 gene into citrus using an expression vector, transgenic plants with significantly enhanced resistance to citrus canker are obtained, which has great application value for breeding citrus resistance to citrus.

[0007] The present invention is achieved through the following technical solutions:

[0008] The first object of the present invention is to provide a CsACS6 gene, the coding sequence of the CsACS6 gene is shown as SEQ ID NO.1.

[0009] The second object of the present invention is to provide an ACC synthase encoded by the aforementioned CsACS6 gene.

[0010] The third object of the present invention is to provide an application of a CsACS6 gene or an ACC synthase in improving resistance to citrus canker.

[0011] Furthermore, the specific method of the application is:

[0012] (1) Cloning the CsACS6 coding sequence;

[0013] (2) Construction of CsACS6 overexpression vector;

[0014] (3) The CsACS6 overexpression vector was used to transform citrus, and transgenic plants with improved resistance to ulcer disease were obtained through identification.

[0015] Furthermore, in step (1), the cloning method of the CsACS6 coding sequence is:

[0016] Total RNA was extracted from citrus, reverse transcribed into cDNA as template, and PCR amplified using primers OE-CsACS6-F and OE-CsACS6-R to recover the CsACS6 coding sequence DNA fragment;

[0017] The nucleotide sequences of primers OE-CsACS6-F and OE-CsACS6-R are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0018] Furthermore, in step (2), the CsACS6 overexpression vector is pLGNe-CsACS6.

[0019] Furthermore, in step (2), the method for constructing the CsACS6 overexpression vector is:

[0020] The CsACS6 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI was ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsACS6.

[0021] Furthermore, in step (3), the method for transforming citrus with the CsACS6 overexpression vector is:

[0022] The CsACS6 overexpression vector was transformed into Agrobacterium tumefaciens by electroporation, and then transformed into citrus epicotyls mediated by Agrobacterium tumefaciens. Transgenic plants were obtained after GUS staining, PCR identification, and qRT-PCR analysis of CsACS6 expression.

[0023] Furthermore, the primers for PCR identification of transgenic plants are: ID-CsACS6-F and ID-CsACS6-R, ID-CsACS6-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsACS6-R is designed based on the terminal sequence of the CsACS6 gene. The nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0024] Furthermore, the primers for qRT-PCR analysis of CsACS6 expression were: RT-CsACS6-F and RT-CsACS6-R, and the nucleotide sequences were shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0026] The invention clones the citrus CsACS6 coding sequence, constructs an overexpression vector, and then transforms the citrus to obtain transgenic plants, thereby successfully improving the expression level of CsACS6 in the transgenic citrus and effectively improving the resistance of the citrus to canker disease. The incidence of canker disease can be reduced to 34.0% (disease index) and 41.9% (incidence area) of existing citrus at a maximum, which can significantly reduce the incidence of canker disease and reduce the area of ​​lesions, and has great application value for breeding citrus resistant to canker disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0028] Figure 1The electrophoresis diagram of PCR amplification of the CsACS6 gene clone of the present invention, wherein M is a DNA molecular weight standard;

[0029] Figure 2 The structure diagram of the CsACS6 plant overexpression vector of the present invention, wherein GUS:NPTII represents the fusion gene of β-glucosidase gene and neomycin phosphotransferase gene, P 35S indicates the plant constitutive promoter derived from cauliflower mosaic virus, NOS indicates the opine synthase gene terminator;

[0030] Figure 3 This is a flow chart of citrus genetic transformation of the present invention;

[0031] Figure 4 The figure is a GUS staining diagram of the transgenic plants of the present invention, wherein OE-ACS6-1, OE-ACS6-2, OE-ACS6-3, and OE-ACS6-4 represent four transgenic plants, respectively, and WT is a wild-type Wanjin orange plant;

[0032] Figure 5 The figure is a PCR identification diagram of the transgenic plants of the present invention, wherein OE-ACS6-1, OE-ACS6-2, OE-ACS6-3, and OE-ACS6-4 represent four transgenic plants, respectively, WT is a wild-type Wanjin Orange plant, + is a plasmid pLGNe-CsACS6, and M is a DNA molecular weight standard;

[0033] Figure 6 This is a diagram for analyzing the expression of CsACS6 in the transgenic plants of the present invention;

[0034] Figure 7 is a phenotype diagram of the transgenic plant of the present invention;

[0035] Figure 8 This is a symptom diagram of the transgenic plant leaves of the present invention 10 days after inoculation of ulcer pathogens;

[0036] Fig. 9 This is a statistical diagram of the size of lesions on the leaves of the transgenic plants of the present invention 10 days after being inoculated with canker bacteria;

[0037] Fig.10 This is a statistical graph of the disease index 10 days after the leaves of the transgenic plants of the present invention were inoculated with canker bacteria. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.

[0039] Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] The technical solution of the present invention is further described in detail below in conjunction with embodiments.

[0041] It should be noted that the present invention uses Wanjin orange as the test object. In practical applications, the method can also be used to improve the resistance of other citrus varieties to canker. The experimental methods used in the examples are conventional methods unless otherwise specified. The materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the field, unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0042] Example 1

[0043] Cloning of the coding sequence of Citrus CsACS6

[0044] 1. RNA Extraction and cDNA Synthesis

[0045] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0046] 2. PCR Amplification of CsACS6 Coding Sequence

[0047] The DNA fragment of CsACS6 coding sequence was amplified from citrus cDNA using primers OE-CsACS6-F (SEQ ID NO.2), OE-CsACS6-R (SEQ ID NO.3) and high-fidelity enzyme PrimeSTARMaxDNA Polymerase (TaKaRa, CAT: R045Q). The length of the fragment was 1464 bp (including the restriction site) ( Figure 1 ), the amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsACS6 gene (SEQ ID NO.1). Under ultraviolet light, a clean blade was used to cut out the agarose gel block containing the target fragment, and a kit (BioFlux, CAT: BSC02M1) was used to recover the DNA fragment.

[0048] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0049] Example 2

[0050] Construction of CsACS6 overexpression vector and transformation of Agrobacterium

[0051] 1. Construction of overexpression vector

[0052] The CsACS6 coding sequence DNA fragment and the overexpression vector pLGNe were double digested with restriction endonucleases KpnⅠ and SalI (ThermoFisher), recovered from the gel and ligated overnight at 16°C using T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into E. coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsACS6 overexpression vector pLGNe-CsACS6 ( Figure 2 ).

[0053] 2. Transformation of Agrobacterium with Overexpression Vector

[0054] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix by blowing, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, mix by blowing with a pipette, transfer to a sterile centrifuge tube, and shake and culture at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remain), resuspend and apply, and invert and dark culture at 28°C for 2 days; after the growth of plaques, use primers OE-CsACS6-F (SEQ ID NO.2) and OE-CsACS6-R (SEQ ID NO.3) Perform PCR verification on single colonies.

[0055] PCR reaction conditions: 94°C, 3 min; 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 30 cycles; 72°C, 10 min.

[0056] Example 3

[0057] Genetic transformation of citrus with CsACS6 overexpression vector

[0058] according to Figure 3 The process shown in the figure is used for citrus genetic transformation, and the specific operations are as follows:

[0059] 1. Obtaining epicotyls of citrus seedlings

[0060] Fresh citrus fruits were washed and surface disinfected with 75% alcohol. The seeds were taken out under sterile conditions, the seed coats were peeled off, and the seeds were germinated on seed germination medium. The seeds were cultured in the dark at 28°C for 2 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0061] 2. Preparation of Agrobacterium tumefaciens

[0062] Before transfection, streak the Agrobacterium (containing the pLGNe-CsACS6 vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it at 28°C with shaking overnight; dilute the bacterial solution to OD=0.1 and continue to culture it to OD=0.5, centrifuge it at 5000 r / min for 10 min, discard the supernatant, and resuspend it in MS liquid medium at pH 5.4 for transfection.

[0063] 3. Transformation of Citrus Epicotyls

[0064] Soak the citrus epicotyl stem segments in Agrobacterium solution for 10 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 28°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then identify them by GUS staining.

[0065] 4. Seedling Culture of Transformants

[0066] When the seedlings grow to more than 1 cm, they are cut and grafted onto sterile cultured Wanjin Orange yellow seedlings and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto Citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0067] The culture medium used in this embodiment is as follows:

[0068] Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0069] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4–D+100μmolAS+30g / L sucrose+2.5g / L Gelrite, PH 5.8.

[0070] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0071] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0072] Example 4

[0073] Verification of CsACS6 overexpression transgenic plants

[0074] 1. GUS staining identification of transgenic plants

[0075] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed obvious blue, while the blue color of the leaf discs of the WT plants was not obvious ( Figure 4 ).

[0076] 2. PCR Identification of Transgenic Plants

[0077] 100 mg of transgenic plant leaves were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsACS6 coding sequence in the citrus genome. The detection primers were ID-CsACS6-F (SEQ ID No. 4) and ID-CsACS6-R (SEQ ID No. 5). A 1647 bp amplified fragment was obtained from the positive plants, while no amplification was obtained from the WT plants ( Figure 5 ).

[0078] PCR reaction conditions: 94°C, 3 min; 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 30 cycles; 72°C, 10 min.

[0079] 3. qRT-PCR Analysis of Transgenic Plants

[0080] Total RNA (Adlai, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsACS6-F (SEQ ID No. 6) and RT-CsACS6-R (SEQ ID No. 7). -△△CtThe relative expression of CsACS6 gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsACS6 expression level was 1, and then the multiple of gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. The results showed that the CsACS6 gene was expressed at a higher level in transgenic plants than in wild-type plants (up to 50 times that of the control) ( Figure 6 ).

[0081] qRT-PCR reaction conditions: 95°C, 3 min, 94°C, 10 s; 56°C, 10 s; 72°C, 10 s, 40 cycles; 72°C, 10 min.

[0082] 4. Phenotypic observation of transgenic plants

[0083] The phenotypes of the four transgenic plants were observed and analyzed, and no obvious abnormalities were found in their appearance and growth. Figure 7 ). This indicates that overexpression of the CsACS6 gene did not have a significant effect on the phenotype and development of the plant.

[0084] Example 5

[0085] Resistance evaluation of CsACS6 overexpressing transgenic plants

[0086] The mature leaves of the transgenic plants were washed and disinfected with 75% alcohol and rinsed with sterile water, and placed on a clean bench. The leaves were punctured with needles in the center of the veins, with seven needles in a group and two groups on each side. The ulcer pathogen liquid was applied with a pipette, and 1 μL (1X 10 5 CFU / mL); cultured in a 28°C constant temperature and light incubator (16 h light / 8 h dark); photos were taken 10 days after the leaves were spotted with bacteria, and the lesion area was counted using Image J V1.47 software.

[0087] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R≤0.5mm 2 ), Level 1 (0.5mm 2 <R≤1mm 2 ), Level 2 (1mm 2 <R≤1.5mm 2 ), 3rd level (1.5mm 2 <R≤2mm 2 ), 4th level (2mm 2 <R≤2.5mm 2 ), 5 levels (2.5mm 2 <R≤3mm 2 ), 6 levels (3mm 2 <R≤3.5mm 2 ), 7th level (R>3.5mm2 ); calculate the disease index according to the formula: DI = 100XΣ [number of lesions at each level X corresponding level value] / (total number of lesions X maximum level).

[0088] The results showed that 10 days after inoculation with the ulcer bacteria, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions ( Figure 8 ). According to statistics and analysis, the lesion area of ​​transgenic plants was significantly smaller than that of wild-type controls, accounting for 41.9%-64.8% of the controls ( Fig. 9 The disease index of transgenic plants was significantly lower than that of wild-type controls, ranging from 34.0% to 65.4% of the control ( Fig.10 ). It can be seen that overexpression of CsACS6 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0089] It can be seen that overexpression of CsACS6 can greatly reduce the lesion area of ​​ulcer disease and alleviate the severity of ulcer disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for citrus ulcer disease resistance molecular breeding.

[0090] The following is the nucleotide sequence involved in the present invention:

[0091] SEQ ID NO.1

[0092]

[0093] SEQ ID NO.2

[0094] GGGGTACCCCATGGCCTTCGCGTTGAGTAAC

[0095] SEQ ID NO.3

[0096] GCGTCGACGTCTTGGCCATAGCGGCCGCGGTTAAGTCCGGGCCTGAACAAG

[0097] SEQ ID NO.4

[0098] GCAAGTTCCTTAAGTAGCATCACAC

[0099] SEQ ID NO.5

[0100] GTCGACTCTAGATTATGGCAAGTGATAATTAAC

[0101] SEQ ID NO.6

[0102] GTGGAAGCCAAGGTGCCTAA

[0103] SEQ ID NO.7

[0104] TCGAGATGACATGCTGAGCC

[0105] Finally, it should be noted that the above specific embodiments are only used to explain in detail the purpose, technical solutions and beneficial effects of the present invention. It should be understood that the above description is only a specific implementation method of the present invention and is not used to limit the protection scope of the present invention. Although the present invention is described in detail with reference to the above specific embodiments, ordinary technicians in this field should understand that it is still possible to modify the technical solutions recorded in the above embodiments, or to replace or improve some or all of the technical features therein. These modifications, equivalent replacements and improvements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be included in the scope of the claims and description of the present invention.

Claims

1. A CsACS6 gene, characterized in that: The CsACS6 gene coding sequence is shown in SEQ ID NO.

1.

2. An ACC synthase, characterized in that Encoded by the CsACS6 gene according to claim 1.

3. Use of the CsACS6 gene according to claim 1 or the ACC synthase according to claim 2 in improving resistance to citrus canker.

4. The use according to claim 3, characterized in that: The specific method of the application is: (1) Cloning the CsACS6 coding sequence; (2) Construction of CsACS6 overexpression vector; (3) The CsACS6 overexpression vector was used to transform citrus, and transgenic plants with improved resistance to ulcer disease were obtained through identification.

5. The use according to claim 4, characterized in that: In step (1), the cloning method of the CsACS6 coding sequence is: Total RNA was extracted from citrus, reverse transcribed into cDNA as template, and PCR amplified using primers OE-CsACS6-F and OE-CsACS6-R to recover the CsACS6 coding sequence DNA fragment; The nucleotide sequences of primers OE-CsACS6-F and OE-CsACS6-R are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

6. The use according to claim 4, characterized in that: In step (2), the CsACS6 overexpression vector is pLGNe-CsACS6.

7. The use according to claim 6, characterized in that: In step (2), the method for constructing the CsACS6 overexpression vector is as follows: The CsACS6 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI was ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsACS6.

8. The use according to claim 4, characterized in that: In step (3), the method for transforming citrus with the CsACS6 overexpression vector is: The CsACS6 overexpression vector was transformed into Agrobacterium tumefaciens by electroporation, and then transformed into citrus epicotyls mediated by Agrobacterium tumefaciens. Transgenic plants were obtained after GUS staining, PCR identification, and qRT-PCR analysis of CsACS6 expression.

9. The use according to claim 8, characterized in that: The primers for PCR identification of transgenic plants are: ID-CsACS6-F and ID-CsACS6-R, and the nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

10. The use according to claim 8, characterized in that: The primers for qRT-PCR analysis of CsACS6 expression were: RT-CsACS6-F and RT-CsACS6-R, and the nucleotide sequences were shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

Images