Mutant with third-class ACS gene knocked out in plant and application of mutant

Abstract

The invention relates to the technical field of gene engineering, in particular to a mutant for knocking out a third-class ACS gene in a plant and application of the mutant, the mutant is a mutant for knocking out the third-class ACS gene in the plant in a targeted mode through the CRISPR / Cas9 gene editing technology, and the mutant does not have the third-class ACS functional gene and only retains the first-class ACS functional gene and the second-class ACS functional gene; the mutant with the third-class ACS gene knocked out is used for breeding for improving the stress resistance of plants, can greatly improve the salt and alkali resistance of the plants, is expected to be applied to research on ACS family functions of important crops and cultivation of new salt and alkali tolerant varieties, and has important economic value.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for knocking out the third ACS Gene mutants and their applications. Background Art

[0002] According to statistics, the global land area affected by salinity is more than 1 billion hectares, of which about 60% is classified as alkaline land. Soil salinization may become a global problem affecting plant growth and crop yields. If these saline-alkali lands can be fully utilized for crop cultivation, it will help meet the food supply of mankind. Therefore, in the future agricultural development, it is of great significance to explore the laws of plant life activities under adverse conditions and artificially regulate them, cultivate better varieties with better salt and alkali tolerance, and improve the yield and quality of crops to achieve high and stable agricultural yields.

[0003] The plant hormone ethylene affects multiple processes of plant growth and development, and it also participates in regulating the response of plants to biotic or abiotic stresses in the environment. Plants control ethylene levels in the body mainly by regulating the expression and activity of 1-aminocyclopropane-1-carboxylic acid synthase (ACS), a key enzyme in ethylene biosynthesis. ACS proteins are encoded by a multigene family. According to the characteristics of the C-terminal sequence, ACS proteins are divided into three categories. The first type of ACS protein has a longer C-terminal and has two kinase phosphorylation sites, including three mitogen-activated protein kinase (MAPK) phosphorylation sites and one calcium-dependent protein kinase (CDPK) phosphorylation site. The C-terminal of the second type of ACS protein is shorter than that of the first type, with only one CDPK phosphorylation site. The C-terminal of the third type of ACS protein is the shortest and has no identifiable phosphorylation site. Among them, ACS7 is the only third type of ACS protein in Arabidopsis.

[0004] Different environmental stresses can affect different ACS Gene expression, for ACS The redundant and unique regulatory roles of genes in regulating plant growth and development have been studied, but the functions and mechanisms of each member in plant growth and development and environmental stress response are still not clear.

[0005] How to ACS The application of gene regulation in the breeding of new high-quality and highly resistant crop varieties requires further research. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the related art. To this end, the first object of the present invention is to provide a method for knocking out the third class in a plant. ACS A mutant of a gene; the second object of the present invention is to provide an application of a mutant.

[0007] In order to achieve the first purpose, the technical solution adopted by the present invention is: Knockout of the third class in one plant ACS A mutant of a gene, wherein the mutant is a mutant in which the third type is knocked out by using CRISPR / Cas9 gene editing technology ACS Gene mutants ， The mutant does not have a third type ACS Functional genes, only the first category is retained ACS and the second category ACS Functional genes.

[0008] Furthermore, the plants include agricultural crops and horticultural crops.

[0009] Furthermore, the agricultural crops include one or more of rice, wheat, corn, cotton, soybean, rapeseed, potato, fruits and vegetables, and the horticultural crops include one or more of trees and flowers.

[0010] In order to achieve the second purpose, the technical solution adopted by the present invention is: Application of a mutant, wherein the mutant is a mutant of the above-mentioned plant that knocks out the third type ACS A mutant of a gene, and the application includes breeding using the mutant.

[0011] Furthermore, the breeding includes the cultivation of plants with improved resistance to stress.

[0012] Furthermore, the stress resistance includes saline-alkali resistance.

[0013] Furthermore, the breeding comprises the following steps: S1. For the third category ACS The gRNA was designed for the gene, and restriction sites were introduced upstream and downstream of the gRNA. The Golden Gate reaction was performed using restriction endonucleases and T4 ligase to construct a targeted knockout of the third type ACS Gene editing vectors for genes; S2, knock out the third category ACS The gene editing vector of the gene is used to transform Agrobacterium, and the transformed Agrobacterium is cultured and identified to obtain the transformed Agrobacterium carrying the gene editing vector; S3. Use transformed Agrobacterium carrying gene editing vector to infect recipient plant explants or inflorescences to obtain knockout of the third type ACST0 generation seeds of gene mutants.

[0014] Furthermore, the plant is Arabidopsis thaliana, and the third type ACS Gene ACS7 Gene.

[0015] Furthermore, in step S1, Bsa I restriction sites are introduced upstream and downstream of the gRNA, and the nucleotide sequence of the gRNA from the 5' end to the 3' end is as shown in SEQ NO.2.

[0016] Furthermore, gene editing ACS7 The gene nucleotide sequence is shown in SEQ NO.1.

[0017] The present invention provides a mutant of a plant in which a third class ACS gene is knocked out, so as to knock out the third class ACS Functional genes ACS7 Arabidopsis mutants acs7-105 For example, only the first and second categories are retained. ACS Functional gene acs7-105 The mutant obtained can greatly improve the salt-alkali resistance of plants. This mutant is expected to be used in the functional research of the ACS family of important crops and the breeding of new salt-alkali tolerant varieties, and has important economic value.

[0018] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The embodiment 1 of the present invention provides ACS7 Schematic diagram of the targeting sites.

[0020] Figure 2 The embodiment 1 of the present invention provides acs7-105 Schematic diagram of gene editing results.

[0021] Figure 3 The WT and acs7-105 Images of root length of mutant plants.

[0022] Figure 4 The WT and acs7-105 Images of root length of mutant plants.

[0023] Figure 5 The WT and acs7-105 Growth status diagram of mutant plants.

[0024] in, BOX3 for ACS7 Gene fragment III, BOX4 for ACS7 Gene fragment IV. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0026] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0027] Explanation of terms Golden Gate cloning method: first proposed by Engler et al. in 2008. The core steps of Golden Gate reaction vector construction include: designing primers to amplify DNA fragments, preparing enzyme digestion mixture, performing Golden Gate reaction, connecting reaction products to vectors, and transforming host cells.

[0028] Golden Gate reaction: DNA fragments, primers and enzyme digestion mixture are reacted together, allowing restriction endonucleases to cut and recombine the DNA fragments to generate the final target DNA.

[0029] Example 1 acs7-105 Construction of mutants.

[0030] After gene editing ACS7 The nucleotide sequence of the gene from the 5' end to the 3' end is shown in SEQ NO.1, and SEQ NO.1 is as follows: 1. ACS7-pHEE401E Construction of gene editing vectors.

[0031] Arabidopsis thaliana was cloned and cloned using CRISPR-PLANT (http: / / www.genome.arizona.edu / crispr / index.html). ACS7 The gRNA was designed for the gene. The nucleotide sequence of the gRNA from 5' to 3' was shown in SEQ NO.2, and BsaI restriction sites were introduced upstream and downstream of the gRNA. The sequences of the introduced restriction sites were ACS7-CRISPR-F and ACS7-CRISPR-R, respectively. The nucleotide sequence of ACS7-CRISPR-F from 5' to 3' was shown in SEQ NO.3, and the nucleotide sequence of ACS7-CRISPR-R from 5' to 3' was shown in SEQ NO.4. ACS7 Gene fragment III and ACS7 The nucleotide sequence between gene fragment IV (as shown in SEQ NO.5) was constructed ACS7-pHEE401E Gene editing vectors, ACS7 Gene targeting sites such as Figure 1 As shown; ACS7 The nucleotide sequence of gene fragment III from 5' end to 3' end is shown in SEQ NO.6; ACS7 The nucleotide sequence of gene fragment IV from 5' end to 3' end is shown in SEQ NO.7; SEQ NO.2 is as follows: TAGCGCCTCCGGGGTTATC; SEQ NO.3 is as follows: ATTGTAGCGCCTCCGGGGTTATC; SEQ NO.4 is as follows: AAACGATAACCCCGGAGGCGCTA; SEQ NO.5 is as follows: TAGCGCCTCCGGGGTTATC; SEQ NO.6 is as follows: ACTTTCATTCTCGCCGATCCTAACGACGCCCTTCTAGTT; SEQ NO.7 is as follows: ACCAACCCATCGAACCCATTAGGGGCGACG; The Golden Gate reaction was performed using restriction endonuclease Bsa I and T4 DNA Ligase (HC, NEB) from NEW ENGLAND Biolabs. The specific reaction system is shown in Table 1.

[0032] Table 1 PCR reaction system in vector construction

[0033] The reaction conditions were: 37°C for 5 h, 50°C for 5 min, and 80°C for 10 min.

[0034] 5 μL of Golden Gate reaction product was transferred into competent E. coli DH5α by heat shock method, spread on LB solid plate containing 50 μg / mL kanamycin, and cultured at 37°C overnight. Single colonies were picked for PCR identification using primers U6-26p-F and U6-26t-R, positive clones were shaken, plasmids were extracted using plasmid extraction kit from Quanshijin Company, and sent to Beijing Qingke Biotechnology Company for sequencing verification, and the correct ACS7-pHEE401E Gene editing vectors.

[0035] The nucleotide sequence of U6-26p-F from 5' to 3' is shown in SEQ NO.8, and the nucleotide sequence of U6-26t-R from 5' to 3' is shown in SEQ NO.9; SEQ NO.8 is as follows: TGTCCCAGGATTAGAATGATTAGGC; SEQ NO.9 is as follows: CCCCAGAAATTGAACGCCGAAGAAC.

[0036] 2. Screening and identification of gene-edited Arabidopsis thaliana.

[0037] The constructed ACS7-pHEE401E The vector was transformed into GV3101 Agrobacterium. The specific process was as follows: 150 ng DNA was added to 50 μL Agrobacterium competent cells and mixed. The cells were placed on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. 500 μL of LB liquid medium was added to the tube and cultured at 28°C for 4 h. After collecting the cells by centrifugation, they were spread on LB plates containing 50 μg / mL kanamycin and 25 μg / mL rifampicin and placed in an incubator at 28°C for inversion. Single colonies were picked and identified by PCR using primers U6-26p-F and U6-26t-R; the positive clones identified by PCR were shaken to OD600>1.0 and used for Arabidopsis inflorescence infection.

[0038] The specific process of inflorescence infection is: centrifuge the bacterial solution, collect the precipitate, and then resuspend the bacteria in the prepared transformation solution (10 mM 1 / 2MS, 2.5 mM MES, 5% sucrose, 1 mg / mL 6-BA). Before infecting Arabidopsis, add SilwetL-77 (50mL / L) to fully contact the inflorescence part of Arabidopsis with the bacterial solution. After the infection is completed, culture in the dark for 24 hours, and then culture under normal conditions until the end of the growth cycle, and harvest T0 generation seeds.

[0039] The harvested T0 generation seeds were dried and placed for about 14 days, then sown on 1 / 2 MS medium containing 25 mg / mL hygromycin, placed in the dark at 4°C for 3 days, and then cultured in a light incubator for about 7 days. Plants with normal growth and obvious root length were the T1 generation of resistant transgenic plants, which were transplanted into the soil for continued growth and subjected to PCR identification.

[0040] The specific experimental process is: extract the genomic DNA of T1 transgenic plants respectively, use primers ACS7-F and ACS7-R to amplify the PCR reaction to obtain ACS7 PCR fragment of the target site; the nucleotide sequence of ACS7-F from 5' to 3' is shown in SEQ NO.10, and the nucleotide sequence of ACS7-R from 5' to 3' is shown in SEQ NO.11; SEQ NO.10 is as follows: CACTGCGACAGCTCGAAAACCCCGGAGGCGCTAG; SEQ NO.11 is as follows: CTAGCGCCTCCGGGGTTTTCGAGCTGTCGCAGTG; The PCR amplification system is shown in Table 2: Table 2 PCR amplification system

[0041] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for 30 cycles; final extension at 72°C for 10 min; and storage at 4°C.

[0042] After sequencing the amplified products, the plants with mutations to be sequenced are harvested after completing their life cycle, and the harvested seeds are sown again to form the transgenic T2 generation. PCR identification is performed on the T2 generation transgenic lines using the same method as above, and the sequencing results are retained as plants with homozygous mutations.

[0043] Through this method, 12 bases were identified to be deleted, resulting in changes in nucleotides 185 to 196 and premature termination of translation. ACS7 Mutants, named acs7-105 ,like Figure 2 As shown, the mutation had no adverse effects on the normal growth and development of Arabidopsis.

[0044] Experimental Example 1 Observation of root length phenotype under saline-alkali stress.

[0045] The wild-type Arabidopsis Col and mutant acs7-105 The seeds were soaked in 1% sodium hypochlorite solution for 3 min, then washed repeatedly with sterile distilled water for 6 to 8 times. The sterilized seeds were placed in a 4°C refrigerator away from light for 2 days, spread on 1 / 2 MS medium containing 0 and 3 mM NaHCO3, and then transferred to a light incubator for vertical culture. The culture conditions were 20°C to 22°C, long day (16 h light, 8 h dark), relative humidity of 60% to 70%, and light intensity of 90 to 110 μmol·m −2 ·s −1 The results showed that when the seedlings were 8 days and 17 days old, on 1 / 2 MS medium without NaHCO3, WT and acs7-105 There was no significant difference in root length between the two groups. On 1 / 2 MS medium containing 3 mM NaHCO3, acs7-105 The roots are longer and show obvious salt and alkali resistance, such as Figure 3 and Figure 4 shown.

[0046] Experimental Example 2: Salt-alkali stress survival rate experiment.

[0047] The wild-type Arabidopsis Col and mutant acs7-105 The seeds were sterilized with 1% (v / v) NaClO for 2–3 min, washed 6–8 times with sterile distilled water, and planted on normal 1 / 2 MS medium and 1 / 2 MS medium containing 10 mM NaHCO3. After two days of dark treatment, they were placed in an Arabidopsis culture box under the conditions of 20–22°C, long daylight (16 h light, 8 h dark), relative humidity of 60%–70%, and light intensity of 90–110 μmol m −2 s −1 After 14 days of growth, the survival rates of WT plants and plants containing gene mutants were counted. The results are as follows Figure 5 As shown, the results showed that under normal culture conditions, Arabidopsis Col and mutant acs7-105 There was no significant difference in the survival rate of the mutants under saline-alkali stress. acs7-105 The survival rate of the plants was significantly higher than that of the WT plants, showing obvious salt-alkali resistance.

[0048] The invention provides a plant in which the third class is knocked out ACS Mutants of genes that retain the complete first and second classes ACS Gene editing mutants of functional genes, constructed using Arabidopsis thaliana as an example acs7-105 This mutation has no adverse effect on the normal growth and development of Arabidopsis, while significantly improving the resistance to saline-alkali stress. ACS7 Genetic ACS The mutants are expected to be used in breeding new salt- and alkali-tolerant varieties of the ACS family of important crops and have important economic value.

[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Knockout of the third class in a plant ACS A mutant of a gene, characterized in that The mutant is a targeted knockout of the third type using CRISPR / Cas9 gene editing technology ACS Gene mutants ， The mutant does not have a third type ACS Functional genes, only the first category is retained ACS and the second category ACS Functional genes.

2. Knockout of the third class in the plant as claimed in claim 1 ACS A mutant of a gene, characterized in that The plants include agricultural crops and horticultural crops.

3. Knockout of the third class in the plant as claimed in claim 2 ACS A mutant of a gene, characterized in that The agricultural crops include one or more of rice, wheat, corn, cotton, soybean, rapeseed, potato, fruits and vegetables, and the horticultural crops include one or more of trees and flowers.

4. An application of a mutant, characterized in that: The mutant is a plant according to any one of claims 1 to 3 in which the third class ACS A mutant of a gene, and the application includes breeding using the mutant.

5. The use of the mutant according to claim 4, characterized in that: The breeding includes the cultivation of plants with improved resistance to stress.

6. The use of the mutant according to claim 5, characterized in that: The stress resistance includes saline-alkali resistance.

7. The use of the mutant according to claim 4, characterized in that: The breeding comprises the following steps: S1. For the third category ACS The gRNA was designed for the gene, and restriction sites were introduced upstream and downstream of the gRNA. The Golden Gate reaction was performed using restriction endonucleases and T4 ligase to construct a targeted knockout of the third type ACS Gene editing vectors for genes; S2, knock out the third category ACS The gene editing vector of the gene is used to transform Agrobacterium, and the transformed Agrobacterium is cultured and identified to obtain the transformed Agrobacterium carrying the gene editing vector; S3. Use transformed Agrobacterium carrying gene editing vector to infect recipient plant explants or inflorescences to obtain knockout of the third type ACS T0 generation seeds of gene mutants.

8. The use of the mutant according to claim 7, characterized in that: The plant is Arabidopsis thaliana, the third type ACS Gene ACS7 Gene.

9. The use of the mutant according to claim 8, characterized in that: In step S1, Bsa I restriction sites are introduced upstream and downstream of gRNA, and the nucleotide sequence of gRNA from 5' end to 3' end is shown in SEQ NO.

2.

10. The use of the mutant according to claim 8, characterized in that: After gene editing ACS7 The nucleotide sequence of the gene from 5' to 3' end is shown in SEQ NO.1.

Images