Application of ZmFS1 gene in corn disease control

Abstract

The invention discloses application of a ZmFS1 gene in corn disease prevention and control, and belongs to the technical field of crop disease prevention and control. The nucleotide sequence of cDNA of the ZmFS1 gene is as shown in SEQ ID NO.1. By inhibiting expression of the gene, resistance of corn to various diseases including southern leaf blight, northern leaf blight, southern rust disease, anthracnose, stem rot, seed rot and the like can be remarkably enhanced, a new solution thought is provided for preventing and treating corn diseases from the perspective of molecular biology, and the application prospect is broad. The method can be applied to corn disease-resistant breeding.

Description

Technical Field

[0001] The invention relates to the technical field of crop disease prevention and control, and in particular to application of ZmFS1 gene in corn disease prevention and control. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Corn (Zea mays L.) is one of the world's major food crops and is widely used in animal feed and industrial raw materials. However, with climate change, diseases caused by various pathogens such as small leaf spot, large leaf spot, stem rot and southern rust have seriously affected corn yield and quality. Therefore, it is urgent to enhance the disease resistance of corn and improve the yield and quality of corn. Pathogens use the plant's disease-susceptible genes to infect plants, affecting the growth and development of plants and reducing the quality of grains. Discovering the disease-susceptible genes of corn and studying its disease-susceptibility mechanism, reducing the expression of disease-susceptible genes through biotechnology methods to obtain sustained and broad-spectrum resistance to multiple diseases can provide new solutions for plant molecular breeding and obtain more corn varieties with good quality and high yield.

[0004] Secondary metabolites, flavonoids, not only participate in the growth and development of plants, but also play an important role in the disease resistance of plants. Flavonoids can be divided into: flavanones, flavanols, flavonols, anthocyanins, isoflavones and flavonoids. Flavonoid synthase I belongs to 2-ketoglutarate-dependent dioxygenases, which can directly catalyze the formation of double bonds between carbon 2 and carbon 3 of flavanone compounds, catalyzing naringenin to apigenin, and is a key enzyme in the synthesis of plant flavonoids. Flavonoid synthase I catalyzes the conversion of flavanones into corresponding flavonoids, such as catalyzing naringenin and eriodictyol to apigenin and luteolin, but there is no report on the function of maize flavonoid synthase ZmFS1 in maize disease resistance. Summary of the invention

[0005] In view of this, the present invention provides an application of the ZmFS1 gene in corn disease prevention and control. The present invention improves the broad-spectrum disease resistance of corn by reducing the expression of the ZmFS1 gene, which is of great significance in corn disease resistance breeding.

[0006] In a first aspect, the present invention provides an application of the ZmFS1 gene in preventing and controlling corn diseases. The nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1.

[0007] Preferably, the corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot.

[0008] Preferably, the application is: inhibiting the expression of ZmFS1 gene in corn, thereby improving the disease resistance of crops to corn diseases.

[0009] Furthermore, the method for inhibiting the expression of the ZmFS1 gene in corn includes one or more of transposon insertion, gene editing, gene silencing or ethyl methanesulfonate (EMS) mutagenesis.

[0010] Furthermore, the transposon insertion sites are located at positions 432 and 946 of SEQ ID No. 1, respectively.

[0011] In a second aspect, the present invention provides an application of biological materials related to the ZmFS1 gene in the prevention and control of corn diseases, wherein the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1; the corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot.

[0012] Preferably, the biomaterial is any one of the following (1) to (4):

[0013] (1) a protein encoded by the ZmFS1 gene, the amino acid sequence of which is shown in SEQ ID NO.2;

[0014] (2) a recombinant vector containing the ZmFS1 gene;

[0015] (3) a recombinant microorganism containing the ZmFS1 gene;

[0016] (4) Transgenic plant cell lines containing the ZmFS1 gene.

[0017] Furthermore, the vector is a plasmid, a cosmid, a phage or a virus vector; the microorganism can be a yeast, a bacterium, an algae or a fungus.

[0018] In a third aspect, the present invention provides a method for preventing and controlling corn diseases by inhibiting the expression of the ZmFS1 gene in corn; the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1, and the corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot.

[0019] In a fourth aspect, the present invention provides a corn breeding method, comprising the following steps: inhibiting the expression level of the ZmFS1 gene in corn, thereby making the corn resistant to southern leaf spot, southern leaf spot, anthracnose, stem rot and seed rot; the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1.

[0020] Compared with the prior art, the present invention has achieved the following beneficial effects:

[0021] The present invention found through gene function test and verification that the ZmFS1 transgenic overexpression positive strains showed susceptible phenotypes to various corn diseases such as small leaf spot, large leaf spot and stem rot; two transposon insertion mutant strains ZmFS1-1 and ZmFS1-2 were identified for disease resistance, and it was found that the two mutants showed broad-spectrum disease resistance to various corn fungal diseases such as small leaf spot, large leaf spot, southern rust and stem rot. It can be seen that the ZmFS1 gene provided by the present invention is a broad-spectrum disease resistance gene, which can significantly enhance the resistance of corn to various diseases, provide a new solution for preventing and controlling corn diseases from the perspective of molecular biology, and provide a certain theoretical and practical basis for applying the gene to corn disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The drawings constituting part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute an improper limitation of the present invention. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0023] Figure 1 The electrophoresis diagram of the CDS sequence of the maize type I flavonoid synthase gene ZmFS1 cloned by PCR in Example 1 of the present invention;

[0024] Figure 2 This is a Western blot identification diagram of the transgenic overexpression positive strain in Example 2 of the present invention; wherein, the ZmFS1 transgenic material was identified by Western Blot using GFP antibody, and the numbers of the positive (pos) and corresponding negative (neg) plants of the two transgenic strains are shown above the lanes; 1, 2, 3, 4, 5, and 6 are from six different plants;

[0025] Figure 3 The present invention is to identify the disease resistance of the ZmFS1 transgenic overexpression seedlings to anthracnose and small leaf spot in Example 2 of the present invention; wherein A is the phenotype of the ZmFS1 positive overexpression line and its corresponding negative strain after inoculation with Colletotrichum graminicola; B is the lesion area after inoculation measured by Image J; C is the disease resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative strain to small leaf spot; D is the lesion area after inoculation with small leaf spot bacteria measured by Image J (*p<0.05, **p<0.01, Student's t-test);

[0026] Figure 4The present invention is to identify the disease resistance of the ZmFS1 transgenic overexpressed plants to small spot disease and large spot disease in the field in Example 2 of the present invention; wherein A is the disease resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative line to small spot disease; B is the lesion grade of the ZmFS1 positive overexpression line and its corresponding wild type after infection with small spot disease; C is the disease resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative line to large spot disease; D is the lesion grade of the ZmFS1 positive overexpression line and its corresponding negative line after infection with large spot disease (*p<0.05, ***p<0.001, Student's t-test);

[0027] Figure 5 The disease resistance identification of the ZmFS1 transgenic overexpression strains to stem rot and seed rot in Example 2 of the present invention; wherein A is the resistance phenotype of the ZmFS1 positive overexpression strain and its corresponding negative strain to stem rot; B is the lesion grade of the ZmFS1 positive overexpression strain and its corresponding negative strain after inoculation with Fusarium verticillioides; C is the resistance phenotype of the ZmFS1 positive overexpression strain and its corresponding negative strain to seed rot; D is the spore concentration of the ZmFS1 positive overexpression strain and its corresponding negative strain after inoculation with Fusarium verticillioides (*p<0.05, **p<0.01, ***p<0.001, Student's t-test);

[0028] Figure 6 The identification of the ZmFS1 mutant strain in Example 3 of the present invention; wherein A is a schematic diagram of the ZmFS1 gene structure and the location of the ChinaMu transposon insertion site; B is the PCR identification result of the ZmFS1 mutant; C is the transcription level of ZmFS1 in the ZmFS1 mutant detected by qRT-PCR (*P<0.05, **p<0.01, Student's t-test);

[0029] Figure 7 The present invention is to identify the disease resistance of the ZmFS1 mutant to small leaf spot and large leaf spot in the field in Example 3; wherein A is the field phenotype of the ZmFS1 mutant and its wild type to small leaf spot; B is the lesion grade of the ZmFS1 mutant and its wild type after infection with small leaf spot; C is the field phenotype of the ZmFS1 mutant and its wild type to large leaf spot; D is the lesion grade of the ZmFS1 mutant strain and its wild type after infection with large leaf spot (**p<0.01; ***p<0.001, Student's t-test);

[0030] Figure 8The disease resistance identification of the ZmFS1 mutant strain to stem rot and seed rot in Example 3 of the present invention; wherein A is the resistance phenotype of the ZmFS1 mutant and its wild type to stem rot; B is the lesion grade of the ZmFS1 mutant and its wild type after inoculation with Fusarium verticillioides; C is the resistance phenotype of the ZmFS1 mutant and its wild type to seed rot; D is the spore concentration of the ZmFS1 mutant and its wild type after inoculation with Fusarium verticillioides (*P<0.05, **p<0.01, Student's t-test);

[0031] Fig. 9 This is the disease resistance identification of the ZmFS1 mutant strain in Example 1 of the present invention to southern rust; wherein A is the field phenotype of the ZmFS1 mutant and its wild type to southern rust; B is the lesion grade of the ZmFS1 mutant and its wild type after infection with southern rust (**p<0.01, Student's t-test). DETAILED DESCRIPTION

[0032] In the following examples, the techniques and methods of molecular biology used are conventional methods known in the art. For details, reference may be made to "Molecular Cloning Experiment Guide" (Sambrook and Russell, 2001). The skilled person in the field may adopt other conventional techniques and reagents according to the embodiments of the present invention, but is not limited to the limitations of the specific embodiments of the present invention. The examples of the present invention are only preferred embodiments of the present invention. The following description is only for explaining the present invention, rather than limiting the present invention in any form. Any simple modification made to the specific implementation according to the technical essence of the present invention belongs to the scope of the technical solution of the present invention. The materials, reagents, etc. used in the examples are purchased from commercial sources unless otherwise specified.

[0033] The technical solution of the present invention is further described below in conjunction with specific embodiments.

[0034] Example 1 Cloning of ZmFS1

[0035] 1. Extraction of total RNA from maize inbred line B73

[0036] (1) Maize B73 leaves were placed in a high-temperature sterilized mortar, quickly frozen in liquid nitrogen, ground into powder, and then transferred into a centrifuge tube. 500 μL RNA-easy extraction solution was immediately added.

[0037] (2) Add 500 μL of RNase-free ddH2O, mix by inverting, and let stand at room temperature for 5 min;

[0038] (3) Centrifuge at 12,000 g for 15 min, transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, mix well, and leave at room temperature for 10 min;

[0039] (4) Centrifuge at 12,000 g for 10 min, discard the supernatant, wash the precipitate with 500 μL 75% ethanol, and flick the bottom of the tube to allow the precipitate to fully contact the liquid; centrifuge at 8,000 g for 3 min; discard the supernatant, and repeat the above steps for a second wash;

[0040] (5) Place in a clean bench to dry for about 3 min, then add 30 μl of RNase-free water to dissolve;

[0041] (6) Use an ultra-micro spectrophotometer to measure the OD value and concentration of the RNA sample. 260 / A 280 The best value is 1.8-2.0; the quality of RNA is detected by agarose gel electrophoresis.

[0042] 2. Reverse transcription of RNA into cDNA

[0043] (1) Add the reagents listed in Table 1 to the centrifuge tube in sequence (20 μl reaction system):

[0044] Table 1 Reaction reagents and addition amounts

[0045]

[0046] (2) Mix by pipetting and incubate at 42°C for 2 min.

[0047] (3) Add 4 μl 5×HiScriptⅢqRT SuperMix to the centrifuge tube;

[0048] (4) After mixing, incubate at 25°C for 5 min, 50°C for 15 min, and 85°C for 5 min, then store at -20°C for later use.

[0049] 3. ZmFS1 gene cloning

[0050] The primer sequences used are:

[0051] ZmFS1-F1: 5'-GCACGCACGGCGCCGGCGGC-3' (SEQ ID NO. 3); ZmFS1-R1: 5'-ATCCATCCGTATCCGATTCG-3' (SEQ ID NO. 4).

[0052] The reaction system for amplification using the high-fidelity enzyme KOD is shown in Table 2 (20 μl system).

[0053] Table 2 Reaction system

[0054]

[0055]

[0056] Amplification conditions were as follows:

[0057] (1) 5°C, 2 min;

[0058] (2) 98°C, 10 s;

[0059] (3) 60°C, 30 seconds;

[0060] (4) 68°C, 45 seconds;

[0061] (5) Steps (2) to (4) are repeated 34 times;

[0062] (6) 68°C, 7 min;

[0063] (7) Store at 15℃.

[0064] After amplification, add loading buffer and perform agarose gel electrophoresis. Figure 1 As shown, the CDS sequence length of the ZmFS1 gene is 1011 bp.

[0065] The cloned fragments were recovered from gel using a Polymerase DNA Purification Kit.

[0066] 4. Connection between target gene and entry vector

[0067] The reaction system is as follows:

[0068] DNA recovery fragment: 7 μl;

[0069] Entry vector pENTR-T: 1 μl;

[0070] T4 Ligase: 1 μl;

[0071] T4 Buffer: 1μl.

[0072] Ligate overnight at 16°C.

[0073] 5. Transformation of plasmid or DNA ligation product into competent E. coli

[0074] (1) Add 10 μL of ligation product to 50 μL of DH5α competent cells, mix well and incubate on ice for 30 min;

[0075] (2) Heat shock at 42°C for 1 min, on ice for 2 min, add 800 μl of LB medium, shake at 37°C, 220 rpm for 1 h;

[0076] (3) Centrifuge at room temperature, 5000 rpm for 2 min and discard the supernatant;

[0077] (4) Keep a small amount of supernatant to suspend the bacteria and spread it on an LB plate containing the corresponding antibiotics, and incubate it upside down at 37°C overnight;

[0078] (5) Single clones were selected for colony PCR identification, and positive clones were selected for sequencing. The clones with correct sequencing results were named ZmFS1. The nucleotide sequence of the cDNA of the gene is shown in SEQ ID No. 1, and the amino acid sequence encoded by it is shown in SEQ ID No. 2.

[0079] Example 2 Construction of ZmFS1 overexpression vector and verification of disease resistance function of transgenic strains

[0080] 1. Construction of maize ZmFS1 overexpression vector

[0081] (1) BamH1 and Xma1 restriction sites were added to both ends of the gene ZmFS1, and the overexpression vector pCAMBIA3301 and the ZmFS1 fragment were double-digested;

[0082] (2) After gel recovery, ligation was performed using T4 DNA ligase;

[0083] (3) Transform into competent E. coli DH5α, and send the positive clones identified by PCR to the company for sequencing. The correct plasmid vector was named pCAMBIA3301::ZmFS1.

[0084] 2. Plasmid transformation into Agrobacterium

[0085] (1) 1 μg of pCAMBIA3301::ZmFS1 plasmid was transferred into EHA105 competent cells, mixed evenly, and placed on ice for 30 min;

[0086] (2) Quick freezing in liquid nitrogen for 1 min; incubate at 37°C for 3 min; add 800 μl of LB liquid medium and shake at 28°C and 220 rpm for 3 h;

[0087] (3) Centrifuge at room temperature, 5000 rpm for 2 min and discard the supernatant;

[0088] (4) Keep a small amount of supernatant to suspend the bacteria and spread it on an LB culture plate containing the corresponding antibiotics. Incubate the plate upside down at 28°C for 48 h. Pick a single clone for colony PCR identification. Store the positive clone in a -80°C refrigerator.

[0089] 3. Genetic transformation of corn

[0090] Agrobacterium EHA105 containing the pCAMBIA3301::ZmFS1 plasmid vector was sent to a biological company to transform the corn inbred line B104 to obtain a transgenic strain.

[0091] 4. Western blot detection of ZmFS1 transgenic maize plants

[0092] (1) Preparation of SDS-PAGE stacking gel and separation gel:

[0093] First, prepare 10% separation gel, add water to seal the separation gel until a clear boundary is formed, the separation gel solidifies, and remove the upper liquid; prepare 5% concentrated gel, insert the comb after the concentrated gel is prepared, and let it stand for 0.5h until the concentrated gel solidifies. The formula of 10% separation gel is shown in Table 3.

[0094] Table 3 10% separation gel formula

[0095]

[0096] The formula of 5% stacking gel is shown in Table 4.

[0097] Table 4 5% concentrated gel formula

[0098]

[0099]

[0100] (2) Sample preparation:

[0101] Take 200 mg of leaves in a 2 ml centrifuge tube, add porcelain beads, put into liquid nitrogen for quick freezing, and use a sampler (40 Hz, 30 s) to make powder, add 200 μL of protein extraction buffer, mix thoroughly, and place on ice for 30 min. The protein extraction buffer formula is shown in Table 5.

[0102] Table 5 Protein extraction buffer formula

[0103]

[0104] (3) Centrifuge at 4°C, 12,000 rpm for 15 min. Pipette 15 μL of supernatant and mix with 15 μL of 2×laemmlli (containing 5% mercaptoethanol) for sample loading.

[0105] (4) Place the SDS-PAGE gel in the electrophoresis tank, pour in 1× Running buffer, take out the comb vertically, take 15 μL of sample and spot it, 80 V, 20 min, 150 V, 1 h.

[0106] The formula of 10× Running buffer is shown in Table 6.

[0107] Table 6 10× Running buffer recipe

[0108]

[0109] (5) Transfer

[0110] a. After running the gel, remove the upper concentrated gel, wash the separation gel in a glass dish filled with ddH2O, and wash the cut NC membrane (5.8×8.5cm) and filter paper (8×10cm) in 1× transfer buffer for later use.

[0111] b. Place the black side of the transfer clip downwards, and place the sponge, filter paper, separation gel, NC membrane, filter paper, and sponge in sequence. Remove excess bubbles after each placement. After fixing, place the clip in a transfer tank filled with ice packs, and add pre-cooled 1× transfer buffer.

[0112] c. Place the electrophoresis tank in an ice-water mixture and transfer the membrane at a current of 160-200 mA for 2.25 hours.

[0113] The formula of 10× transfer buffer is shown in Table 7.

[0114] Table 7 10× transfer buffer recipe

[0115]

[0116]

[0117] (6) Closed

[0118] After the transfer, the membrane was placed in blocking solution (4% skimmed milk powder) for 1.5 hours.

[0119] (7) Primary Antibody

[0120] The blocking solution was removed, and the NC membrane was transferred to the primary antibody solution (1:5000) and incubated on a horizontal shaker at room temperature for 2 h.

[0121] (8) Secondary Antibody

[0122] The primary antibody was poured out, the membrane was washed 3 times with 1×PBST, 10 min / time, the secondary antibody (1:4000) was added, and the membrane was incubated on a horizontal shaker at room temperature for 1.5 h.

[0123] (9) Pour out the secondary antibody and wash the membrane twice with 1× PBST and once with 1× PBS, each time for 10 min.

[0124] (10) Using the ECL kit, the colorimetric solution AB was mixed in equal amounts, the mixed solution was pipetted and evenly spread on the front of the NC membrane, and finally developed using a chemiluminescence instrument. The Western blot identification results of the ZmFS1 transgenic overexpressing plants are shown in Figure 2. Figure 2 shown.

[0125] 5. Identification of corn leaf spot and anthracnose by inoculation of corn leaves in vitro

[0126] (1) Growing Helicoverpa maydis and Colletotrichum graminicola, which cause corn leaf blight and anthracnose, respectively, on V8 medium and culturing in a light-proof incubator at 28°C;

[0127] (2) Preparation of spore washing solution: agar powder 0.5 g / L, Tween-20 0.5 ml / L, ddH2O to 1 L, autoclave;

[0128] (3) Add an appropriate amount of spore washing solution to the bacterial plate, scrape the bacterial plate and filter it with filter paper, count the cells under a microscope using a cell counting plate, and dilute the bacterial solution to 1×10 6 Pieces / ml;

[0129] (4) Place two layers of filter paper on a black tray, stick corn leaves on the filter paper, poke holes in the leaves, add an appropriate amount of sterilized water to the tray, and then pipette 10 μl of bacterial solution onto the holes;

[0130] (5) Seal the tray with plastic wrap to better retain moisture, keep it away from light for two days, take photos to observe the phenotype of the lesions, and use Image J to perform statistics. It was found that the ZmFS1 overexpression lines (W1-10 pos, W1-11 pos) were more susceptible to anthrax than their corresponding negative lines (W1-10neg, W1-11 neg). The identification results are as follows Figure 3 As shown in A and B in FIG; ZmFS1 overexpression lines (W1-10 pos, W1-11 pos) are more susceptible to small spot disease than their corresponding negative lines (W1-10 neg, W1-11 neg), and the identification results are shown in Figure 3 As shown in C and D.

[0131] 6. Identification of resistance to field spot disease and field spot disease

[0132] In mid-May, corn materials were planted in Qingdao, and the phenotypes of post-flowering leaf spot disease were counted in the field. The disease was graded and identified according to the severity, with a total of 9 levels (1-9). The larger the disease area, the lower the level. ZmFS1 overexpression lines (W1-10pos, W1-11pos) were more susceptible to field leaf spot disease than their corresponding negative lines (W1-10neg, W1-11neg). The identification results are as follows: Figure 4 As shown in A and B.

[0133] Corn was planted in Changchun, Jilin Province in late April, and the phenotype of post-flowering leaf spot disease was counted in the field. The disease was graded and identified according to its severity, with a total of 9 grades (1-9). The larger the disease area, the higher the grade. ZmFS1 overexpression strains (W1-10pos, W1-11pos) were more susceptible to field leaf spot disease than their corresponding negative strains (W1-10neg, W1-11neg). The identification results are as follows: Figure 4 As shown in C and D.

[0134] 7. Disease identification of corn stalk rot and seed rot

[0135] (1) Cultivating Fusarium verticillium in PDA medium, growing mycelium in the middle of PDA, and culturing in a 28°C incubator in the dark;

[0136] (2) Pick out Fusarium verticillium clumps from mung bean culture medium and culture them on a shaker at 28°C for 48 h;

[0137] (3) Filter the bacterial solution through four layers of gauze, centrifuge at 1000 g for 5 min, and discard the supernatant;

[0138] (4) Add an appropriate amount of sterilized ddH2O to completely dissolve the bacterial mass, count using a hemocytometer, and dilute to 1×10 6 Pieces / ml;

[0139] (5) Use a 1 ml syringe to draw 500 μl of bacterial solution and inject it into the third internode of corn, seal the inoculation site, and two weeks later, cut off the third node and split it in the middle to count the lesion grade. There are 5 grades in total (1-5), and the larger the disease area, the higher the grade. ZmFS1 overexpression strains are more susceptible to stem rot than their corresponding negative strains. The identification results are as follows Figure 5 As shown in A and B.

[0140] (4) Seed rot: Wash the seeds in 70% ethanol for 5 minutes, sterile water for 1 minute, 2.5% sodium hypochlorite for 10 minutes, and finally rinse with sterile water for 5 minutes*3 times. Dry the seeds and cut the wound on the embryo side with a blade. Put 4 seeds in a 20 ml bottle, inoculate 200 μL of spore suspension, vortex to evenly coat the seeds with the suspension, loosen the lid slightly, and put them in a plastic container to create a humidity chamber. Cultivate at 28°C for 3-7 days. ZmFS1 overexpression lines are more susceptible to seed rot than their negative counterparts. The identification results are as follows: Figure 5 As shown in C and D.

[0141] Example 3 Identification of ZmFS1 mutants and verification of disease resistance function

[0142] 1. Extraction of corn DNA by CTAB method

[0143] The mutants 68614 (ZmFS1-1) and 71667 (ZmFS1-2) of the ZmFS1 gene were screened and purchased from the ChinaMu corn mutant library (http: / / chinamu.jaas.ac.cn / cindex.html). Seeds of ZmFS1-1 and ZmFS1-2 mutants were sown in the field, and corn leaves were placed in a 96-well DNA extraction plate and quickly frozen in liquid nitrogen and then ground into powder. 250 μl of CTAB extraction solution was added, mixed and placed at 65°C for 30 minutes. An equal amount of chloroform was added, and the mixture was placed at room temperature for several minutes until stratification, and centrifuged at 4000 rpm for 30 minutes. 100 μl of supernatant was aspirated into a 96-well plate, an equal amount of isopropanol was added, and the mixture was placed at -20°C overnight. Centrifuged at 4000 rpm for 30 minutes, the supernatant was removed, 100 μl of 75% ethanol was added, and centrifuged for 15 minutes, and this step was repeated once. Discard the supernatant, blow dry the precipitate, add appropriate amount of ddH2O to dissolve it, and store it at 4℃ for later use.

[0144] The formula of CTAB extraction solution is shown in Table 8.

[0145] Table 8 CTAB extract formula

[0146]

[0147] 2. Identification of ZmFS1 mutants

[0148] The ZmFS1 transposon insertion sites are located at position 432 (Zmfs1-1) and position 946 (Zmfs1-2) of the SEQ ID No. 1 sequence. Primers were designed based on the insertion sites of the ZmFS1-1 and ZmFS1-2 mutants for identification. The positions of the identification primers in the ZmFS1 gene are shown in Figure 6 A in.

[0149] F1:GCACGCACGGCGCCGGCGGC (SEQ ID NO.3);

[0150] R1: GCCACTTTCTCTTTCTCCTGTC (SEQ ID NO.5);

[0151] F2: GCCCTTTCTTCGTAGACG (SEQ ID NO.6);

[0152] R2:CAGTTCACCGAGTCCTCTTTA(SEQ ID NO.7);

[0153] Mu67: GAAGCCAACGCCAWCGCCTCYATTTCGTCGAAT (SEQ ID NO. 8).

[0154] The reaction conditions are shown in Table 9.

[0155] Table 9 Reaction conditions

[0156]

[0157]

[0158] Amplification conditions were as follows:

[0159] (1) 95°C, 2 min;

[0160] (2) 98°C, 10 s;

[0161] (3) 58°C, 30 seconds;

[0162] (4) 68°C, 1 min;

[0163] (5) Step (2) to step (4), cycle 30 times;

[0164] (6) 68°C, 5 min;

[0165] (7) Store at 15℃.

[0166] After PCR was stopped, agarose gel electrophoresis was performed for identification. If FR had no bands but F+Mu67 and R+Mu67 had bands, it was homozygous; if FR had bands but F+Mu67 and R+Mu67 had no bands, it was wild type. The identification results were as follows: Figure 6 As shown in B.

[0167] After identifying ZmFS1-1 and ZmFS1-2 and their wild-type counterparts, the transcription level of ZmFS1 in the ZmFS1-1 and ZmFS1-2 mutants was measured by quantitative PCR. The content of ZmFS1 in the ZmFS1-1 and ZmFS1-2 mutants was reduced, and the results were as follows: Figure 6 As shown in C.

[0168] 3. Identification of resistance to small spot disease and large spot disease in the field

[0169] In mid-May, corn materials were planted in Qingdao, and the phenotypes of post-flowering leaf spot disease were counted in the field. The disease severity was graded and identified, with a total of 9 levels (1-9). The larger the disease area, the lower the level. The ZmFS1 mutant strain (ZmFS1-1 homo) was more resistant to field leaf spot disease than its wild type counterpart (ZmFS1-1 WT). The identification results are as follows: Figure 7 As shown in A and B.

[0170] Corn was planted in Changchun, Jilin Province in late April, and the phenotype of post-flowering large leaf spot disease was counted in the field. The disease severity was graded and identified, with a total of 9 levels (1-9). The larger the disease area, the higher the level. ZmFS1 mutant strains (ZmFS1-1homo, ZmFS1-2 homo) were more resistant to field large leaf spot disease than their wild-type counterparts (ZmFS1-1 WT, ZmFS1-2 WT). The identification results are as follows: Figure 7 As shown in C and D.

[0171] 4. Disease identification of corn stalk rot and seed rot

[0172] (1) Cultivating Fusarium verticillium in PDA medium, growing mycelium in the middle of PDA, and culturing in a 28°C incubator in the dark;

[0173] (2) Pick out the Fusarium verticillasteri fungus clumps from the mung bean culture medium, culture them on a shaker at 28°C for 2 hours, filter the bacterial solution with four layers of gauze, centrifuge at 1000 g for 5 min, discard the supernatant, add an appropriate amount of sterilized ddH2O to completely dissolve the bacterial clumps, count them with a hemocytometer, and dilute to 1×10 6 Pieces / ml;

[0174] (3) Stem rot: Use a 1 ml syringe to draw 500 μl of bacterial solution and inject it into the third internode of corn. Seal the inoculation site. After two weeks, cut off the third node and split it in the middle to count the lesion grade. There are 5 grades in total (1-5). The larger the diseased area, the higher the grade. ZmFS1 mutant strains are more resistant to stem rot than their corresponding wild-type strains. The identification results are as follows: Figure 8 As shown in A and B;

[0175] (4) Seed rot: Wash the seeds in 70% ethanol for 5 minutes, sterile water for 1 minute, 2.5% sodium hypochlorite for 10 minutes, and finally rinse with sterile water for 5 minutes*3 times. Dry the seeds and make a cut on the embryo side with a blade. Put 4 seeds in a 20 ml bottle, inoculate with 200 μL of spore suspension, vortex to evenly coat the seeds with the suspension, loosen the lid slightly, and put them in a plastic container to create a humidity chamber. Cultivate at 28°C for 3-7 days. The ZmFS1 mutant strain is more resistant to seed rot than its corresponding wild-type strain. The identification results are as follows: Figure 8 As shown in C and D.

[0176] 5. Identification of resistance to southern corn rust

[0177] Corn was planted in Hainan in November, and the phenotypes of southern rust were counted in the field after flowering. The severity of the disease was graded and identified, with a total of 9 grades (1-9). The larger the disease area, the higher the grade. Fig. 9 As shown, it can be seen that the ZmFS1 mutant lines are more resistant to southern rust than their wild-type counterparts.

[0178] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of ZmFS1 gene in corn disease prevention and control, characterized in that: The nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot.

3. The use according to claim 1, characterized in that The application is to inhibit the expression of ZmFS1 gene in corn, thereby improving the disease resistance of crops to corn diseases.

4. The use according to claim 3, characterized in that The method for inhibiting the expression of the ZmFS1 gene in corn includes one or more of transposon insertion, gene editing, gene silencing or ethyl methanesulfonate (EMS) mutagenesis.

5. The use according to claim 4, characterized in that The transposon insertion sites are located at the 432nd and 946th positions of the SEQ ID No. 1 sequence respectively.

6. Application of biomaterials related to the ZmFS1 gene in corn disease prevention and control, characterized in that: The nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1; the corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot.

7. The use according to claim 6, characterized in that The biological material is any one of the following (1) to (4): (1) a protein encoded by the ZmFS1 gene, the amino acid sequence of which is shown in SEQ ID NO.2; (2) a recombinant vector containing the ZmFS1 gene; (3) a recombinant microorganism containing the ZmFS1 gene; (4) Transgenic plant cell lines containing the ZmFS1 gene.

8. The use according to claim 7, characterized in that The vector is a plasmid, a cosmid, a phage or a virus vector; the microorganism can be a yeast, a bacterium, an algae or a fungus.

9. A method for preventing and controlling corn diseases, characterized in that: This is achieved by inhibiting the expression of the ZmFS1 gene in corn; the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1, and the corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot.

10. A corn breeding method, characterized in that: The method comprises the following steps: inhibiting the expression of ZmFS1 gene in corn, thereby making the corn resistant to small leaf spot, large leaf spot, southern rust, anthracnose, stem rot and seed rot; the nucleotide sequence of cDNA of the ZmFS1 gene is shown in SEQ ID NO.1.

Images