Application of ZmSAUR22 protein and coding gene thereof in drought resistance of corn

Abstract

The invention relates to the technical field of biological gene engineering, in particular to application of ZmSAUR22 protein and a coding gene thereof in corn drought resistance, drought phenotype observation and physiological index determination are performed on a ZmSAUR22 gene overexpression plant, and results show that compared with a wild type, an in-vitro leaf of a ZmSAUR22 gene overexpression strain is quick in water loss, and the yield of the ZmSAUR22 gene overexpression strain is high. After drought treatment, leaves of an overexpressed strain of the ZmSAUR22 gene are more withered, which indicates that the gene negatively regulates and controls drought stress, and the drought resistance of corn can be remarkably reduced by overexpression of the gene. According to the invention, a ZmSAUR22 gene overexpression strain and a ZmSAUR22 gene mutant strain are obtained by adopting a genetic engineering means, the effect of the ZmSAUR22 gene in regulating the drought resistance of the corn is clarified, a basis is provided for illuminating the effect of the ZmSAUR22 gene in coping with drought stress of plants, and a gene resource is provided for cultivating drought-resistant corn.

Description

Technical Field

[0001] The invention relates to the technical field of biological gene engineering, and in particular to the application of ZmSAUR22 protein and its encoding gene in corn drought resistance. Background Art

[0002] Early auxin response genes in plants include three gene family members: auxin / indole-3-acetic acid (AUX / IAA), gretchenhagen3 (GH3) and small auxin-up RNA (SAUR). Among them, SAUR-like auxin response family protein members are the most numerous, and they play an important role in responding to auxin changes, affecting auxin synthesis and transport in plants, cell elongation, metabolism and stress. SAUR genes generally lack introns and exist in clusters. Most of their promoter upstream regions contain an AuxREs, which can respond quickly to auxin. In addition, the promoter sequence of SAUR genes also contains many cis-acting elements, such as cis-elements for light response, hormone response and stress response. SAUR proteins are mostly unstable proteins, which are highly conserved and have a SAUR-specific domain (SSD) core region, which consists of about 60 amino acids.

[0003] SAUR genes play a role in plant growth and development by regulating cell elongation. Arabidopsis SAUR19-24 proteins negatively regulate PP2C-D phosphatases and trigger plasma membrane H + -ATPase proton pump activity, resulting in exoplast acidification, promoting solute and water uptake, and thus driving cell growth. SAUR genes play an important role in plant hypocotyl elongation and root development. AtSAUR41 overexpression plants elongate hypocotyls and promote lateral root development. AtSAUR53 overexpression positively regulates cell and organ elongation, but AtSAUR53 elevation has a side effect on the normal transport of auxin. The expression of AtSAUR36 is regulated by auxin and plays a role in seed germination, light-dependent hypocotyl elongation, and apical hook formation. AtSAUR63 overexpression significantly promotes the growth of plant hypocotyls and cotyledons. CsSAUR31 overexpression promotes the elongation of cucumber roots and hypocotyls. OsSAUR10 regulates rice plant growth by promoting auxin synthesis, transport, and cell elongation. SAUR genes are also involved in plant floral organ formation and fruit development. AtSAUR8 / 10 / 16 overexpression leads to the growth of calyx and siliques in Arabidopsis plants. Overexpression of BhSAUR60 in Arabidopsis thaliana resulted in significantly longer sepals, filaments, pistils and siliques than control plants. Overexpression of Euryale ferox EuSAUR62 in rice resulted in larger spikelets and grains, and increased spikelet cell length.

[0004] SAUR genes also play a role in secondary metabolism and adverse stress. AtSAUR36 is a positive regulator that controls leaf senescence, mediates auxin-induced leaf senescence, and promotes anthocyanin accumulation. OsSAUR39 overexpressing rice plants showed reduced chlorophyll content, increased abscisic acid content, and accelerated leaf senescence. Application of exogenous auxin can restore some phenotypes. AtSAUR41 subfamily genes can improve Arabidopsis salt tolerance. SAUR41 / 40 / 71 / 72 quadruple mutant plants show hypersensitivity to salt stress during seedling formation. In poplar, WOX11 / 12a proteins bind to the SAUR36 promoter to regulate SAUR36 transcription. This binding is enhanced under salt stress, improving poplar salt tolerance. At present, there are few reports on SAUR in maize, and it is not clear whether ZmSAUR is involved in maize drought stress. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention aims to provide an application of ZmSAUR22 protein and its encoding gene in drought resistance of corn. By observing the drought phenotype and measuring physiological indicators of plants overexpressing the ZmSAUR22 gene, the results show that the detached leaves of the ZmSAUR22 gene overexpressing strain lose water faster than those of the wild type, and the leaves of the ZmSAUR22 gene overexpressing strain wilt more after drought treatment, indicating that the gene negatively regulates drought stress, and its overexpression can significantly reduce the drought resistance of corn.

[0006] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0007] Application of ZmSAUR22 protein, its encoding gene or biological material containing its encoding gene in improving drought resistance of corn, wherein the ZmSAUR22 protein has any of the following amino acid sequences:

[0008] (1) the amino acid sequence shown in SEQ ID NO.1;

[0009] (2) An amino acid sequence of a protein having the same function as the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids.

[0010] Application of ZmSAUR22 protein, its encoding gene or biological material containing its encoding gene in improving drought resistance of corn, wherein the ZmSAUR22 gene has any of the following nucleotide sequences:

[0011] (1) the nucleotide sequence shown in SEQ ID NO.2;

[0012] (2) A nucleotide sequence encoding a protein having the same function as the nucleotide sequence shown in SEQ ID NO. 2 obtained by replacing, deleting or inserting one or more nucleotides.

[0013] Preferably, negative regulation of maize drought resistance is achieved by inhibiting or reducing the expression level and / or activity of the ZmSAUR22 protein.

[0014] Preferably, the biological material is an expression cassette, a vector, a host cell or a recombinant bacterium.

[0015] The primer sequences for amplifying the ZmSAUR22 gene and constructing the overexpression vector pBCXUN-ZmSAUR22 are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0016] A method for improving drought resistance of corn, which is achieved by inhibiting or reducing the expression amount and / or activity of ZmSAUR22 protein in corn;

[0017] The ZmSAUR22 protein has any of the following amino acid sequences:

[0018] (1) the amino acid sequence shown in SEQ ID NO.1;

[0019] (2) An amino acid sequence of a protein having the same function as the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids.

[0020] Preferably, the content and / or biological activity of ZmSAUR22 protein in corn is inhibited or reduced by transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0021] Preferably, the identification primers of the ZmSAUR22 gene are shown as SEQ ID NO.6 and SEQ ID NO.7.

[0022] The beneficial effects of the present invention are:

[0023] In the examples of the present invention, genetic engineering methods were used to obtain ZmSAUR22 gene overexpression and ZmSAUR22 gene mutant strains, clarifying the role of ZmSAUR22 gene in regulating corn drought resistance, providing a basis for clarifying the role of ZmSAUR22 gene in plant response to drought stress, and providing genetic resources for breeding drought-resistant corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0025] Figure 1 The expression level detection results of ZmSAUR22 gene overexpression plants

[0026] Figure 2 Drought phenotype of ZmSAUR22 overexpression lines

[0027] Figure 3 Results of water loss rate test on detached leaves of ZmSAUR22 overexpression lines DETAILED DESCRIPTION

[0028] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0030] The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The wild-type corn used in the following examples is the corn ecotype ND101; the Agrobacterium strain is EHA105; the main reagents used include: restriction endonucleases, DNA polymerases, T4 ligases, etc. from biological companies such as NEB and Toyobo; reverse transcription kits from Thermo; RNA extraction kits from Magen; quantitative PCR reagents from Taraka; plasmid extraction kits and DNA recovery kits purchased from Tiangen; agar powder, ampicillin, kanamycin, gentamicin sulfate, rifampicin and other antibiotics purchased from Sigma; various other chemical reagents used are imported or domestic analytical reagents; primer synthesis and sequencing are completed by Qingke Biological Company.

[0031] The maize ZmSAUR22 gene involved in the present invention is available at the maizeGDB website ( https: / / maizegdb.org / )The gene number in the V3 version is: GRMZM2G045243, in the V4 version it is Zm00001d005802, and in the V5 version it is Zm00001eb100000.

[0032] The V3 version of the maize ZmSAUR22 gene genomic DNA consists of 1000 nucleotides, with only one exon, no introns, and the reading frame from bases 114 to 584.

[0033] The amino acid sequence of the ZmSAUR22 protein is shown in SEQ ID No. 1. Taking into account the degeneracy of codons, those skilled in the art can obtain a ZmSAUR22 protein mutant having the same function as the amino acid sequence shown in SEQ ID NO. 1 by replacing, deleting and / or adding one or more amino acids without affecting its activity, based on the amino acid sequence shown in SEQ ID NO. 1 and conventional technical means in the art such as conservative substitution of amino acids, and all nucleotide sequences encoding the ZmSAUR22 protein are within the protection scope of the present invention.

[0034] The gene encoding the ZmSAUR22 protein has any of the following nucleotide sequences:

[0035] (1) the nucleotide sequence shown in SEQ ID NO.2;

[0036] (2) A nucleotide sequence encoding a protein having the same function as the nucleotide sequence shown in SEQ ID NO. 2 obtained by replacing, deleting or inserting one or more nucleotides.

[0037] According to the nucleotide sequence disclosed in the present invention, the gene is overexpressed in the maize inbred line ND101 by transgenic technology.

[0038] The following examples used ecotype ND101; Agrobacterium strain EHA105; B73cDNA (SEQ ID NO. 3) as PCR template and pBCXUN and pXUE411C-BG as vectors provided by the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University.

[0039] Example 1 Obtaining plants overexpressing the ZmSAUR22 gene

[0040] 1. Construction of overexpression vector pBCXUN-ZmSAUR22

[0041] To obtain ZmSAUR22 gene overexpression plants, the full-length 471bp CDS sequence of ZmSAUR22 gene was constructed into pBCXUN vector by TA cloning. The PCR system was (50μL): 5μL 5×Phusion PCR Buffer, 4μL 2.5mM dNTPmix, 2.5μL Primer 1 (10μM), 2.5μL Primer 2 (10μM), 1μL template DNA, 1.5μL DMSO, 0.5μL Phusion DNA Polymerase (2U / μL). PCR program: 98℃ pre-denaturation for 3 minutes; 98℃ 20 seconds, 60℃ 20 seconds, 72℃ 1 minute, 35 cycles; 72℃ extension for 5 minutes, 10℃ storage of PCR products. The primers used for PCR cloning were:

[0042] Primer-F, ATGGCGAAGGGCGGGCTGAG (SEQ ID No. 4);

[0043] Primer-R, TCAGCACGCATAATACTCGACGAGC (SEQ ID No. 5).

[0044] The PCR product of the oligonucleotide chain containing the target sequence was connected to the gene editing vector pBCXUN that had been digested with enzymes using DNA ligase, and the T4 ligase was used for ligation reaction at 16°C for 8 hours; Escherichia coli DH5α was transformed by heat shock, positive clones were screened, and the plasmid was extracted and sent to a sequencing company for sequencing to ensure that the connected sequence was completely correct, and the pBCXUN-ZmSAUR22 recombinant vector was obtained.

[0045] 2. Identification of transgenic maize plants

[0046] The recombinant vector pBCXUN-ZmSAUR22 was introduced into the Agrobacterium EHA105 strain, and the recombinant bacteria were introduced into the maize inbred line ND101 by the Agrobacterium-mediated method, and the T0 generation transgenic seedlings were screened on the Basta resistance medium to obtain T0 generation transgenic plants. The seedling leaves of the T0 generation transgenic plants were taken to detect the copy number of the resistance gene Bar, and the transgenic positive plants were screened.

[0047] The identified T0 transgenic plants were self-pollinated to obtain T1 plants, and the T1 plants were self-pollinated to obtain T2 plants. The T2 transgenic plants were self-pollinated again to obtain T3 transgenic plant seeds; in each generation, the positive transgenic plants were identified by PCR amplification, and strict self-pollination was performed to obtain the next generation of seeds. In order to detect the expression efficiency of the ZmSAUR22 gene in the T3 transgenic lines, RNA was extracted from the leaves of the recipient ND101 and the three transgenic lines OE1, OE2, and OE3 at the seedling stage, reversed transcribed into the corresponding cDNA, and fluorescent quantitative PCR experiments were performed to detect its expression level. RT-qPCR primers were selected to detect the expression level of the ZmSAUR22 gene, and the primer sequences were:

[0048] Primer-F, GCGCTCCTCGCACGACGT (SEQ ID No. 6);

[0049] Primer-R, AGAGCGGTCGAGGAGGTTC (SEQ ID No. 7).

[0050] The results are as follows Figure 1 As shown, compared with the wild-type material WT, the transcription levels of three independent overexpression lines OE1, OE2, and OE3 were significantly overexpressed. T3 generation transgenic homozygous seeds were used for subsequent experiments.

[0051] Example 2 Detection of drought phenotype and survival rate statistics of ZmSAUR22 overexpressing plants

[0052] The wild type and ZmSAUR22 gene overexpressing plants were sown in a soil mixture of imported soil, peat soil and vermiculite in equal proportions, with 170g per small pot, and 4 seeds were planted in each pot. When the seedlings grew to the one-leaf and one-heart stage, thinning was carried out, and 3 plants with relatively consistent growth size and status were retained in each pot, and the seedlings continued to grow in the greenhouse. At the two-leaf and one-heart stage, water was added to the tray, and after the water was fully absorbed, all the small pots were transferred to another dry tray. At this time, the planted wild type and mutant plants were divided into a control group and a drought treatment group, respectively. The control group continued to be cultivated normally and watered on time, while the drought group plants were no longer watered and subjected to drought stress treatment. They were observed regularly every day, and photographed and recorded for about 7 days (at this time, they were in the three-leaf and one-heart stage). Figure 2 As shown, the left side is the normal watering condition, and the right side is the drought treatment condition. From the two, we can see that under normal watering conditions, there is no significant difference in the growth of overexpressed plants and wild-type plants. Under drought treatment conditions, when the leaves of wild-type plants are stretched, the leaves of ZmSAUR22 gene overexpressed plants show obvious wilting performance, with obvious drought-sensitive phenotype, indicating that ZmSAUR22 gene negatively regulates the drought resistance of corn.

[0053] Example 3 Detection of water loss rate of detached leaves of plants overexpressing ZmSAUR22 gene

[0054] The wild-type and ZmSAUR overexpressing plants were grown in a greenhouse (temperature 26°C, humidity 40%) to the V4 stage. The 4th fully expanded leaf was placed on the greenhouse table for 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 hours, and then weighed with a 1 / 10,000 balance. The water loss rate was calculated as follows: water loss rate = (initial weight - weight after water loss) / initial weight × 100%. Each experiment was repeated 9 times for each strain. A water loss curve was made based on the water loss rate and time. Figure 3 As shown, starting from the 4th hour, the water loss rate of leaves of the ZmSAUR22 gene overexpression line was significantly faster than that of the wild type (**P<0.01).

[0055] The contents not described in detail in this specification belong to the prior art known to professional and technical personnel in this field.

[0056] Finally, it should be noted that the above description is only a preferred example of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of ZmSAUR22 protein, its encoding gene or biological material containing its encoding gene in improving drought resistance of corn, wherein the ZmSAUR22 protein has any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) An amino acid sequence of a protein having the same function as the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids.

2. Application of ZmSAUR22 protein, its encoding gene or biological material containing its encoding gene in improving drought resistance of corn, wherein the ZmSAUR22 gene has any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence encoding a protein having the same function as the nucleotide sequence shown in SEQ ID NO. 2 obtained by replacing, deleting or inserting one or more nucleotides.

3. The use according to claim 1 or 2, characterized in that: Negative regulation of corn drought resistance is achieved by inhibiting or reducing the expression level and / or activity of ZmSAUR22 protein.

4. The use according to claim 1 or 2, characterized in that: The biological material is an expression cassette, a vector, a host cell or a recombinant bacterium.

5. The primer sequences for amplifying the ZmSAUR22 gene are shown in SEQ ID NO.4 and SEQ ID NO.

5.

6. A method for improving drought resistance of corn, characterized in that: This is achieved by inhibiting or reducing the expression level and / or activity of ZmSAUR22 protein in corn; The ZmSAUR22 protein has any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) An amino acid sequence of a protein having the same function as the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids.

7. The method for improving drought resistance of corn according to claim 6, characterized in that: The content and / or biological activity of ZmSAUR22 protein in corn is inhibited or reduced by transgenic, hybridization, backcrossing, selfing or asexual reproduction.

8. The method for improving drought resistance of corn according to claim 6, characterized in that: The identification primers of the ZmSAUR22 gene are shown in SEQ ID NO.6 and SEQ ID NO.7.

Images