Genes slsgr1 and sl lcy-b1 for bidirectional regulation of lycopene content in plants and application thereof
By regulating the SlSGR1 and SlLCY-B1 proteins through gene editing technology, the activity of PSY1, the rate-limiting enzyme in the lycopene synthesis pathway, was increased. This solved the problem of lycopene synthesis and metabolic regulation, enabling the increase of lycopene content in the fruit without affecting the normal growth of other parts of the plant, and providing an efficient and safe method for germplasm creation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- XINJIANG PRODION & CONSTR CORPS NO 6 DIV AGRI SCI INST
- Filing Date
- 2024-12-04
- Publication Date
- 2026-07-14
AI Technical Summary
Current technologies lack relevant proteins that can bidirectionally regulate lycopene content in plants, making it difficult to improve lycopene synthesis and metabolic regulation in fruits without affecting the normal growth and development of other parts of the plant.
By using gene editing technology to reduce the expression level or activity of SlSGR1 and SlLCY-B1 proteins, and then using the CRISPR/Cas9 system to target and edit these genes, the activity of the rate-limiting enzyme PSY1 in the lycopene synthesis pathway can be regulated, thus blocking the metabolic pathway and achieving bidirectional regulation of lycopene.
This method increases the lycopene content in tomato fruits without affecting the normal metabolism of other parts of the plant, providing a new, efficient, and safe approach to creating high-lycopene germplasm, thus improving tomato quality and economic benefits.
Smart Images

Figure CN119351460B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the genes SlSGR1 and SlLCY-B1 that bidirectionally regulate the lycopene content in plants and their applications. Background Technology
[0002] Lycopene is a functional natural pigment with the strongest antioxidant capacity among various carotenoids. It helps protect human cells from damage caused by oxygen free radicals, protects biological membranes, and plays an important role in improving immunity, delaying cellular aging, and preventing cancer. The human body cannot synthesize lycopene and must obtain it through diet. Lycopene is widely used in food, beverages, health products, and cosmetics, and there is a huge market demand for it.
[0003] Improving lycopene content has become a hot topic in tomato quality breeding both domestically and internationally in recent years. While conventional breeding methods have made some progress in improving tomato quality, they are time-consuming and susceptible to limitations imposed by undesirable gene linkage and interspecific reproductive isolation. In recent years, with the development of molecular biology and molecular genetics, a deeper understanding has been gained of the synthesis and metabolic pathways of lycopene in plants and its related enzymes.
[0004] Currently, the lycopene content of commercially grown processing tomato varieties is generally between 8 and 12 mg / 100g. Creating high-lycopene germplasm or varieties is of great significance for the cultivation and processing of processing tomatoes and the upgrading and extension of the processing industry chain. Increasing lycopene content can be achieved by increasing synthesis or reducing metabolism. The phytoene synthase PSY1 is the first rate-limiting enzyme in the lycopene synthesis pathway, catalyzing the polymerization of two GGPP molecules into phytoene. Increasing the activity of PSY1 is beneficial for lycopene synthesis. The tomato SlSGR1 protein can inhibit the activity of SlPSY1, reducing lycopene synthesis; silencing the tomato SlSGR1 gene can increase the activity of SlPSY1. Lycopene metabolites, such as α-carotene, β-carotene, and abscisic acid, participate in tomato growth and stress responses. Completely blocking lycopene metabolism may adversely affect the normal physiological activities of the plant. SlLCY-B initiates lycopene metabolism through either the α- or β-metabolic pathway and is a key enzyme in lycopene metabolism, encoded by a gene family. SlLCY-B1 is located on chromosome 4 and is expressed in the fruit; SlLCY-B2 is located on chromosome 2 and is specifically expressed in green tissues. Lycopene synthesis is controlled by multiple genes, some encoded by gene families. Each family member has different expression patterns, such as expression site, expression time, and expression level. The expression products often have multiple functions. Regulating lycopene synthesis to increase only the amount in the fruit without affecting expression in other parts and maintaining normal plant growth and development presents a significant challenge.
[0005] Gene editing, as a novel gene manipulation technique, has been extensively studied in model plants such as Arabidopsis thaliana and maize, but relatively less so in processed tomatoes, and there are few studies on the simultaneous editing of genes that regulate different traits.
[0006] In view of this, the present invention is hereby proposed. Summary of the Invention
[0007] One of the objectives of this invention is to provide the application of SlSGR1 protein or related biological materials and SlLCY-B1 protein or related biological materials in regulating lycopene content in plants, so as to solve the technical problem of the lack of related proteins in the prior art that can bidirectionally regulate and increase lycopene content in plants.
[0008] The second objective of this invention is to provide a method for bidirectionally regulating the lycopene content in plants.
[0009] The third objective of this invention is to provide the application of the above-described method in the preparation of products for regulating the lycopene content in plants.
[0010] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:
[0011] In a first aspect, the present invention provides the following applications (a) to (d) in regulating lycopene content in plants:
[0012] (a) SlSGR1 protein;
[0013] (b) Biomaterials related to the SlSGR1 protein;
[0014] (c)SlLCY-B1 protein;
[0015] (d) Biomaterials related to SlLCY-B1 protein;
[0016] The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.
[0017] Furthermore, the expression levels and / or activity of the SlSGR1 and SlLCY-B1 proteins in the plant are reduced, while the lycopene content of the tomato is increased.
[0018] Furthermore, the biological materials related to the SlSGR1 protein are nucleic acid molecules that can inhibit or reduce the expression of the SlSGR1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic cell lines containing the nucleic acid molecules;
[0019] The biological materials related to the SlLCY-B1 protein are nucleic acid molecules that can inhibit or reduce the expression of the SlLCY-B1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic cell lines containing the nucleic acid molecules.
[0020] Secondly, the present invention provides a method for bidirectionally regulating the lycopene content in plants, comprising simultaneously inhibiting or reducing the expression level and / or activity of SlSGR1 protein and SlLCY-B1 protein to increase the lycopene content in plants; the nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.
[0021] Furthermore, this includes introducing substances into plants that inhibit or reduce the expression of genes encoding SlSGR1 and SlLCY-B1 proteins.
[0022] Furthermore, substances that inhibit or reduce the expression of SlSGR1 protein and SlLCY-B1 protein encoding genes include nucleic acid molecules that inhibit or reduce the expression of the SlSGR1 protein encoding gene and nucleic acid molecules that inhibit or reduce the expression of the SlLCY-B1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines containing the nucleic acid molecules.
[0023] Furthermore, the nucleic acid molecule that inhibits or reduces the expression of the SlSGR1 protein-encoding gene is a CRISPR / Cas9 editing tool that targets the SlSGR1 protein-encoding gene;
[0024] The nucleic acid molecule that inhibits or reduces the expression of the SlLCY-B1 protein-encoding gene is a CRISPR / Cas9 editing tool that targets the SlLCY-B1 protein-encoding gene.
[0025] Furthermore, the target sequence targeting the SlSGR1 protein encoding gene is shown in SEQ ID NO:1 and SEQ ID NO:2;
[0026] The target sequence of the gRNA targeting the SlLCY-B1 protein encoding gene is shown in SEQ ID NO:3 and SEQ ID NO:4.
[0027] Thirdly, the present invention provides the application of the above-described method in the preparation of products for regulating the lycopene content in plants.
[0028] Furthermore, the plant in question is a tomato.
[0029] The present invention relates to the application of SlSGR1 protein or related biological materials and SlLCY-B1 protein or related biological materials in regulating lycopene content in plants. Through gene editing, SlSGR1 and SlLCY-B1 proteins are inactivated, increasing SlPSY1 activity to promote synthesis, while inactivating SlLCY-B1 inhibits metabolism. Analysis of the protein-protein interaction network using the STRING online tool revealed that PSY1 interacts with phytoene dehydrogenase PDS, ζ-carotene dehydrogenase ZDS, and carotenoid isomerase CRTISO. These enzymes are also interacting proteins with SlLCY1. Therefore, SlPSY1 and SlLCY1 interact through PDS, ZDS, and CRTISO, thereby increasing lycopene content. Experiments have shown that SlPSY1 and SlLCY-B1 are expressed in fruits, and gene editing does not affect the function of other family genes in stems, leaves, or other parts. This provides a new approach for establishing efficient, safe, and high-lycopene germplasm. Attached Figure Description
[0030] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0031] Figure 1 This is a coordinate map of the coding region of the sgRNA target site of SlSGR1 provided in Embodiment 1 of the present invention;
[0032] Figure 2 This is a coordinate diagram of the coding region of the sgRNA target site of SlLCY-B1 provided in Embodiment 1 of the present invention;
[0033] Figure 3 This is a map of the dual-gene plant expression vector provided in Example 2 of the present invention;
[0034] Figure 4 This is an electrophoresis image of the PCR amplification product of the T0 generation regenerated positive plant provided in Example 3 of the present invention;
[0035] Figure 5 This is a mutation type diagram of the double-gene edited high-lycopene mutant plant provided in Example 4 of the present invention;
[0036] Figure 6 This is a diagram of mutation types in the SlLCY-B1 single-gene edited plant provided in Example 4 of the present invention;
[0037] Figure 7 This is a diagram of mutation types in SlSGR1 single-gene edited plants provided in Example 4 of the present invention;
[0038] Figure 8 Comparison of the appearance of fruits from different gene-edited plants provided in Example 4 of this invention. Detailed Implementation
[0039] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.
[0040] Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.
[0041] This invention provides, in one aspect, the following applications (a) to (d) in regulating lycopene content in plants:
[0042] (a) SlSGR1 protein;
[0043] (b) Biomaterials related to the SlSGR1 protein;
[0044] (c)SlLCY-B1 protein;
[0045] (d) Biomaterials related to SlLCY-B1 protein;
[0046] The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.
[0047] This invention utilizes gene editing to inactivate the regulatory proteins SlSGR1 and SlLCY-B1, increasing SlPSY1 activity to promote synthesis and inactivating SlLCY-B1 to inhibit metabolism. Analysis of the protein-protein interaction network using the STRING online tool revealed that SlPSY1 interacts with phytoene dehydrogenase PDS, ζ-carotene dehydrogenase ZDS, and carotenoid isomerase CRTISO. These proteins are also interacting proteins of SlLCY1. Therefore, SlPSY1 and SlLCY1 interact through PDS, ZDS, and CRTISO, increasing lycopene content. Experiments demonstrated that SlPSY1 and SlLCY-B1 are expressed in fruit, and gene editing does not affect the function of other family genes in stems, leaves, or other parts. This provides a new approach for establishing efficient, safe, and high-lycopene germplasm.
[0048] In some specific embodiments, the expression levels and / or activities of the SlSGR1 and SlLCY-B1 proteins are reduced in the plant, resulting in an increased lycopene content in the tomato. Inactivation of the SlSGR1 and SlLCY-B1 proteins increases the activity of SlPSY1, the first rate-limiting enzyme in the lycopene synthesis pathway, which is beneficial for lycopene synthesis. Inactivation of SlLCY-B1 does not affect the function of SlLCY-B2, but inhibits lycopene metabolism in the fruit, promoting lycopene accumulation. Simultaneously, it does not affect the normal production of lycopene metabolites in other parts of the plant.
[0049] In some specific embodiments, the biological material related to the SlSGR1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the SlSGR1 protein-encoding gene, or an expression cassette, recombinant vector, recombinant microorganism, or transgenic cell line containing the nucleic acid molecule; the biological material related to the SlLCY-B1 protein is a nucleic acid molecule capable of inhibiting or reducing the expression of the SlLCY-B1 protein-encoding gene, or an expression cassette, recombinant vector, recombinant microorganism, or transgenic cell line containing the nucleic acid molecule.
[0050] The expression cassette refers to DNA capable of expressing the aforementioned proteins in host cells. This DNA may include not only promoters that initiate transcription of protein-coding genes but also terminators that terminate transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Recombinant expression vectors containing the aforementioned protein-coding gene expression cassettes can be constructed using existing plant expression vectors. Specifically, recombinant microorganisms may be yeast, bacteria, algae, and fungi.
[0051] According to another aspect of the present invention, a method for bidirectionally regulating lycopene content in plants is also provided, comprising simultaneously inhibiting or reducing the expression levels and / or activity of SlSGR1 protein and SlLCY-B1 protein to increase lycopene content in plants; the nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:24.
[0052] The inhibition or reduction of the expression levels and / or activity of SlSGR1 and SlLCY-B1 proteins can be achieved through gene knockout or gene silencing. Gene knockout refers to the inactivation of a specific target gene through homologous recombination, i.e., inactivation of a specific target gene through changes in the DNA sequence. Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing requires no alteration of the DNA sequence to prevent or reduce gene expression.
[0053] Using the CRISPR-Cas9 system to inactivate SlSGR1 and SlLCY-B1 bidirectionally regulate lycopene content provides a new approach for tomato germplasm improvement and enhancing economic benefits.
[0054] In some specific implementations, this includes introducing substances into plants that inhibit or reduce the expression of genes encoding the SlSGR1 and SlLCY-B1 proteins.
[0055] In some specific embodiments, substances that inhibit or reduce the expression of SlSGR1 protein and SlLCY-B1 protein encoding genes include nucleic acid molecules that inhibit or reduce the expression of the SlSGR1 protein encoding gene and nucleic acid molecules that inhibit or reduce the expression of the SlLCY-B1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines containing the nucleic acid molecules.
[0056] In some specific embodiments, the nucleic acid molecule that inhibits or reduces the expression of the SlSGR1 protein-encoding gene is a CRISPR / Cas9 editing tool targeting the SlSGR1 protein-encoding gene; the nucleic acid molecule that inhibits or reduces the expression of the SlLCY-B1 protein-encoding gene is a CRISPR / Cas9 editing tool targeting the SlLCY-B1 protein-encoding gene.
[0057] The CRISPR-Cas9 system was used to inactivate SlSGR1 and SlLCY-B1. Inactivation of SlSGR1 increased SlPSY1 activity, promoting synthesis, while inactivation of SlLCY-B1 inhibited metabolism, thus bidirectionally regulating lycopene content. Utilizing the segregation of gene integration and editing sites, T-DNA was eliminated through self-pollination, circumventing transgenic safety concerns.
[0058] In some specific embodiments, the target sequence targeting the SlSGR1 protein encoding gene is shown in SEQ ID NO:1 and SEQ ID NO:2;
[0059] The target sequence of the gRNA targeting the LCY-B1 protein encoding gene is shown in SEQ ID NO:3 and SEQ ID NO:4.
[0060] According to another aspect of the present invention, the application of the above-described method in the preparation of products for regulating the lycopene content in plants is also provided.
[0061] In some specific implementations, the plant is a tomato.
[0062] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0063] Example 1: Design and synthesis of sgRNAs for specific targeting in the CRISPR / Cas9-specific knockout of the SlSGR1 and SlLCY-B1 genes in processed tomato.
[0064] 1. Design of sgRNAs for targeted processing of tomato SlSGR1 and SlLCY-B1 genes
[0065] The specific steps for designing sgRNAs for SlSGR1 and SlLCY-B1 using online tools are as follows:
[0066] ① Log in to the GenBank website, search for and download the SGR1 and LCY-B1 gene sequences. Their nucleotide sequences are shown in SEQ ID NO:23 and SEQ ID NO:24.
[0067] ② Open the target prediction website (https: / / crispr.dbcls.jp / ), use the online target design tool "CRISPRdirect", enter the gene sequence in the text box, select the tomato species, and you can get all the target sites of the gene sequence. Consider the scoring results, GC content, target site specificity and the distance between two target sites, and finally select a set of target sites for targeting.
[0068] ③ The core sequence of the 19nt oligonucleotide sgRNA was designed according to the GG(N)19NGG sequence.
[0069] The sgRNA target sequences 1 and 2 of SlSGR1 are located on chromosome 8 of the tomato genome, in exon 1 of the coding region, with coding coordinates of (195-213 and 222-240). Figure 1 As shown.
[0070] The target sequence of SlSGR1 sgRNA is: 5'-ACTTTGACTACTTCTCTAG-3' (SEQ ID NO: 1);
[0071] The SlSGR1 gRNA target site sequence 2 is: 5'-TCTAAGCTCAACAATGAAC-3' (SEQ ID NO:2).
[0072] The sgRNA target sites of SlLCY-B1, sequences 3 and 4, are located on chromosome 6 of the tomato genome, with coding coordinates of (279-297 and 411-429). Figure 2 As shown.
[0073] The target sequence of SlLCY-B1 sgRNA is: 5'-TGCAGGACTTGCTGTTGCA-3' (SEQ ID NO:3);
[0074] The target sequence of SlLCY-B1 sgRNA is: 5'-AGATTGTCTAGATGCTACC-3' (SEQ ID NO:4).
[0075] 2. Constructing oligonucleotides of sgRNA
[0076] Based on the selected sgRNA core sequence, positive and negative strand primers were designed, and sequences containing the AarI endonuclease recognition site were added to the 5' ends of both primers.
[0077] The 5' end of the SlSGR1 positive strand primer is augmented with the sequence ATATATGGTCTCGTTTG (SEQ ID NO:5) to complement the sticky ends of the vector plasmid; the 3' end of the SEQ ID NO:5 sequence is augmented with the sequence ACTTTGACTACTTCTCTAG (SEQ ID NO:1) for editing sites 195–213, and the 3' end of the SEQ ID NO:1 sequence is augmented with the sequence GTTTAGAGCTAGAAATAGC (SEQ ID NO:6); the 5' end of the SlSGR1 antisense strand primer is augmented with the sequence ATATCACCTGCACACAAAC (SEQ ID NO:7), the 3' end of the SEQ ID NO:7 sequence is augmented with the reverse complementary sequence GTTCATTGTTGAGCTTAGA (SEQ ID NO:8) for editing sites 222–240, and the 3' end of the SEQ ID NO:8 sequence is augmented with the sequence CAAACTACACTGTTAGATTC (SEQ ID NO:9).
[0078] The 5' end of the SlLCY-B1 positive strand primer is augmented with the sequence ATATATGGTCTCGTTTG (SEQ ID NO:5) to complement the sticky ends of the vector plasmid. Editing sites 279–297 (TGCAGGACTTGCTGTTGCA) (SEQ ID NO:3) are added to the 3' end of the SEQ ID NO:5 sequence, and GTTTAGAGCTAGAAATAGC (SEQ ID NO:6) is added to the 3' end of the SEQ ID NO:3 sequence. The 5' end of the SlLCY-B1 antisense strand primer is augmented with the sequence ATATCACCTGCACACAAAC (SEQ ID NO:7). Editing sites 411–429 (GGTAGCATCTAGACAATCT) (SEQ ID NO:10) are added to the 3' end of the SEQ ID NO:7 sequence, and CAAACTACACTGTTAGATTC (SEQ ID NO:9) is added to the 3' end of the SEQ ID NO:10 sequence.
[0079] The final obtained forward and antisense primers are shown in Table 1.
[0080] Table 1
[0081]
[0082] Example 2 Construction of plant expression vector
[0083] 1. Construction of SlSGR1 plant expression vector
[0084] Using pCBC_DT1T2_tomatoU6 as a template, primers P2 and P4 were designed on the template, with specific sequences shown in Table 1. The primers were then used to amplify sgRNA using pCBC_DT1T2_tomatoU6 as a template via P1+P2 and P3+P4 combinations, followed by gel digestion and recovery. Simultaneously, the PTX041 vector was digested with BsaI, and the vector backbone was recovered. Then, 30 ng of the recovered fragment and 100 ng of the linear vector were added for simultaneous digestion and ligation. All ligation products were transformed into E. coli (selected with kanamycin). Single clones were selected after transformation for colony PCR and sequencing verification to obtain correctly loaded vectors. The successfully constructed CRISPR / CAS9 vector was transformed into cotyledon leaves of processed tomatoes using the Agrobacterium (AGL1)-mediated tomato genetic transformation method—the leaf disc method. After tissue culture and kanamycin selection, rooted transgenic seedlings were obtained.
[0085] 2. Construction of the SlLCY-B1 plant expression vector
[0086] Using the primers shown in Table 1, sgRNA was amplified using pCBC_DT1T2_tomatoU6 as a template via P5+P2 and P3+P6 combinations. The amplified fragment was then digested with BsaI, and the vector backbone was recovered. Subsequently, 30 ng of the recovered fragment and 100 ng of the linear vector were added for simultaneous digestion and ligation. All ligation products were transformed into E. coli (selected with kanamycin). Single clones were selected after transformation for colony PCR and sequencing verification to obtain correctly loaded vectors. The successfully constructed CRISPR / CAS9 vector was transformed into cotyledon leaves of processing tomatoes using the Agrobacterium (AGL1)-mediated tomato genetic transformation method—the leaf disc method. After tissue culture and kanamycin selection, rooted transgenic seedlings were obtained.
[0087] 3. Construction of dual-gene plant expression vectors
[0088] Using the primers shown in Table 1, sgRNA (fragment sizes of 582bp, 578bp, and 597bp, respectively) was amplified using pCBC_DT1T2_tomatoU6 as a template through combinations of P1+P2, P3+P4, and P5+P6. The fragments were then digested and recovered from the gel. Simultaneously, the PTX041 vector was digested with BsaI, and the vector backbone was recovered from the gel. Subsequently, 30 ng of the recovered fragment and 100 ng of the linear vector were added for simultaneous digestion and ligation. All ligation products were transformed into E. coli (selected with kanamycin). Figure 3As shown, after transformation, single clones were selected for bacterial PCR and sequencing verification to obtain the correctly loaded vector. The tomato genetic transformation method mediated by Agrobacterium (AGL1) – leaf disc method – was used for transformation, and the successfully constructed CRISPR / CAS9 vector was transformed into the cotyledon leaves of processed tomatoes. After tissue culture and screening with Kanamycin, rooted transgenic seedlings were obtained.
[0089] Example 3: Genetic transformation of tomatoes and obtaining T0 generation gene-edited plants
[0090] The tomato seeds used in this embodiment are the Xiyuhong No. 8, a processing tomato variety bred by the Sixth Division Agricultural Research Institute.
[0091] 1. Obtaining sterile vaccines
[0092] Treat the prepared tomato seeds with 75% alcohol for 30 seconds, rinse twice with sterile water, add 10% bleach, shake on a shaker for 1 hour, remove the seeds, rinse five times with double-distilled water, refrigerate at 4°C for 12 hours, inoculate into 1 / 2 MS medium (without sucrose) and culture for 6 days to obtain sterile seedlings.
[0093] 2. Preparation of bacterial culture
[0094] The three constructed gene-editing plant expression vectors were streaked onto YEB solid medium containing 50 mg / L rifampicin and 100 mg / L kanamycin (5 g / L yeast extract, 5 g / L peptone, 5 g / L beef extract, 0.5 g / L magnesium sulfate heptahydrate, and 1 g / L sucrose). After two days of incubation at 28°C, single colonies were picked and inoculated into 5 ml of YEB liquid medium containing 50 mg / L rifampicin and 100 mg / L kanamycin. The medium was then incubated overnight at 28°C with shaking at 220 rpm. The next day, 120 μL of the incubated culture was transferred to 50 mL of liquid YEB medium (containing 50 mg / L rifampicin and 100 mg / L kanamycin) and shaken until the bacterial concentration reached OD200. 600 Centrifuge at 0.7, 5000 rpm for 10 min to collect the bacterial cells. Resuspend the collected bacterial cells in MSO liquid medium before use.
[0095] 3. Obtaining T0 generation regenerated plants
[0096] Aseptically cultured tomato cotyledons were cut and pre-cultured on a pre-culture medium for 1 day (dark conditions), and then placed in OD medium. 600 In a 0.7% Agrobacterium suspension for 15 min, then blot off excess bacterial solution with filter paper and place in a pre-culture medium for co-culturing at 28°C for 2 days (dark conditions).
[0097] The pre-culture medium was formulated as follows: MS + zeatin (1 mg / L) + indoleacetic acid (1 mg / L).
[0098] The co-cultured cotyledons were placed on a differentiation medium for the differentiation and screening of adventitious buds. When the selected resistant regenerated buds grew to 2 cm in height, they were transferred to a rooting medium. The culture conditions were: temperature 25±1℃, photoperiod 16h / d and light intensity 12000lx. The plants were cultured until they rooted to obtain T0 generation regenerated plants.
[0099] The screening method for resistant regenerated shoots is: MS + zeatin (2 mg / L) + indoleacetic acid (1 mg / L) + kanamycin (100 mg / L) + termethin (300 mg / L).
[0100] The rooting medium formula is: MS + indoleacetic acid (1 mg / L) + kanamycin (100 mg / L) + termethin (300 mg / L).
[0101] The obtained T0 generation regenerated plants were numbered from 1 to 22. 0.2g of young leaves from each plant were used to extract total genomic DNA, which was then amplified by PCR using specific primers Cas9-F and Cas9-R. The plant editing expression vector plasmid served as a positive control. Results are as follows: Figure 4 As shown, except for plants 1, 3, and 10, all other plants amplified a band of 841 bp, consistent with the positive control. Wild tomato plants (WT) did not amplify the target band, which preliminarily indicates that the Cas9 gene has been transformed into the recipient cells.
[0102] Cas9-F:CACTATCCTTCGCAAGACCC (SEQ ID NO:17);
[0103] Cas9-R:GAGATTCCCGAACAAGCCG (SEQ ID NO:18).
[0104] 4. Obtaining T0 generation gene-edited plants
[0105] The obtained T0 generation regenerated plants were numbered, and 0.2g of tender leaves from each plant were used to extract genomic DNA. PCR amplification was performed using primers targeting the SlLCY-B1 gene (SlLCY-1+SlLCY-2) and the SlSGR1 gene (SlSGR-1+SlSGR-2), respectively.
[0106] The PCR amplification system consisted of: 1 μL genomic DNA, 10 μL Premix Taq DNA polymerase Mix, 0.8 μL each of the front and rear primers, and double-distilled water to a final volume of 20 μL.
[0107] The PCR amplification conditions were as follows: 94℃ for 5 min; 94℃ for 30 s; 58℃ for 30 s; 72℃ for 30 s; 35 cycles; 72℃ for 5 min.
[0108] The size of the PCR products was determined by 1.0% agarose gel electrophoresis. The corresponding PCR products were then recovered and transformed into *E. coli* DH5α for sequencing. Sequencing results revealed the successful acquisition of three double-gene-edited plants and three single-gene-edited plants. Two of the three single-gene-edited plants were single-gene mutants of SlLCY-B1, indicating successful gene editing and the generation of T0 gene-edited plants controlling lycopene synthesis and metabolism.
[0109] SlLCY-1: ATGGATACTTTGTTGAAAACCCC (SEQ ID NO: 19);
[0110] SlLCY-2: GAGCACCACCGTTGCCTGAATAG (SEQ ID NO: 20);
[0111] SlSGR-1: TGAGCCAAACGGGCTCTTAAATA (SEQ ID NO: 21);
[0112] SlSGR-2: GAGAGTTTCTGATAGACCTCGAC (SEQ ID NO: 22).
[0113] Example 4: Obtaining gene-edited lycopene-rich mutant plants
[0114] 1. Double-gene edited high-lycopene mutant plants
[0115] The T0 generation SlSGR1 and SlLCY-B1 double-gene edited plants obtained in Example 3 were numbered GE1, GE2, and GE3, respectively. After self-pollination, GE1, GE2, and GE3 seeds were harvested and planted. Using the method in step 3 of Example 3, mutant plants lacking the T-DNA sequence were screened from the planted plants, such as... Figure 5The mutation types shown are as follows: SlLCY-B1 gene editing site: deletion of 2 nucleotides (-GG) at positions 284-285, deletion of 21 nucleotides (GAGCTGTGGTGCGCGTGTACA) at positions 421-451; SlSGR1 gene editing site: insertion of 1 nucleotide (+T) at position 212, deletion of 8 nucleotides (-AGCTCAAC) at positions 227-234 (GE1); SlLCY-B1 gene editing site: insertion of 1 nucleotide (A) at position 284, deletion of 4 bases (ATGC) at positions 423-426, and deletion of 1 nucleotide (-C) at position 210 (GE2); SlLCY-B1 gene editing site: insertion of 1 nucleotide (A) at position 284, and deletion of 11 nucleotides (ACTACTTCTCT) at positions 200-210 (GE3).
[0116] The seeds were collected to obtain a new processing tomato germplasm with high lycopene content. This germplasm was sown in a greenhouse, and the lycopene content in the fully mature fruit was measured. Wild-type tomato plants served as the control. The measurement was performed using high-performance liquid chromatography (HPLC). The results showed that the lycopene content of the double-gene-edited tomato plants reached 732.6 μg / g, while that of the wild-type tomato plants was 627.1 μg / g.
[0117] 2. Single-gene edited high-lycopene mutant plants
[0118] After self-pollination of the T0 generation SlLCY-B1 single-gene edited plants GE4 and GE5 obtained in Example 3, self-pollinated seeds were harvested and planted. Using the method in step 3 of Example 3, mutant plants without the T-DNA sequence were screened from the planted plants, such as... Figure 6 The mutation types shown are a deletion of 4 nucleotides (-GGAC) at position 284-285 of the SlLCY-B1 gene editing site (GE4) and a deletion of 7 nucleotides (-GGACTTG) at position 284-288 of the SlLCY-B1 gene editing site (GE5). The determination method was high performance liquid chromatography. The results showed that the lycopene content of the single gene-edited tomato plants could reach 687.56 μg / g, while that of the wild-type tomato plants was 627.1 μg / g.
[0119] After self-pollination of the T0 generation SlSGR1 single-gene edited plants GE4 and GE5 obtained in Example 3, self-pollinated seeds were harvested and planted. Using the method in step 3 of Example 3, mutant plants without the T-DNA sequence were screened from the planted plants, such as... Figure 7The mutation type shown is an insertion of 1 nucleotide (+T) at position 212 of the SlSGR1 gene editing site and a deletion of 8 nucleotides (-AGCTCAAC) (GE6) at positions 227-234. The determination method was high performance liquid chromatography. The results showed that the lycopene content of the single-gene-edited tomato plant could reach 695.23 μg / g, while that of the wild-type tomato plant was 627.1 μg / g.
[0120] 3. Comparison of tomato plant and fruit appearance, such as... Figure 8 As shown, A represents the fruit of a wild-type tomato plant, B represents the fruit of a tomato plant with the SlLCY-B1 single-gene edited line, C represents the fruit of a tomato plant with the SlSGR1 single-gene edited line, and D represents the fruit of a tomato plant with both SlSGR1 and SlLCY-B1 double-gene edited line. It can be seen that while knocking out SlSGR1 alone effectively increased lycopene content, it affected chlorophyll degradation, resulting in a rust-colored flesh and peel, thus impacting its marketability. Conversely, knocking out both SlSGR1 and SlLCY-B1 simultaneously resulted in a large accumulation of lycopene, producing a deep red fruit, and compared to the control, it increased lycopene content without affecting the fruit's appearance.
[0121] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. The applications of (a) and (b) below in regulating lycopene content and color of tomatoes or in the preparation of products for regulating lycopene content and color of tomatoes: (a) SlSGR1 protein or related biological materials; (b) SlLCY-B1 protein or related biological materials; The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:
24. The expression levels and / or activities of the SlSGR1 and SlLCY-B1 proteins in the plant are reduced, the lycopene content of the tomato is increased, and the tomato fruit is dark red. The biological materials related to the SlSGR1 protein are nucleic acid molecules that can inhibit or reduce the expression of the SlSGR1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic cell lines containing the nucleic acid molecules; The biological materials related to the SlLCY-B1 protein are nucleic acid molecules that can inhibit or reduce the expression of the SlLCY-B1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic cell lines containing the nucleic acid molecules.
2. A method for bidirectionally regulating lycopene content and fruit color in tomatoes, characterized in that, This includes simultaneously inhibiting or reducing the expression levels and / or activity of SlSGR1 and SlLCY-B1 proteins, increasing the lycopene content in tomatoes and making the fruit a deep red color; The nucleotide sequence of the SlSGR1 protein is shown in SEQ ID NO:23, and the nucleotide sequence of the SlLCY-B1 protein is shown in SEQ ID NO:
24.
3. The method according to claim 2, characterized in that, This includes introducing substances into plants that inhibit or reduce the expression of genes encoding SlSGR1 and SlLCY-B1 proteins.
4. The method according to claim 3, characterized in that, Substances that inhibit or reduce the expression of SlSGR1 protein and SlLCY-B1 protein encoding genes include nucleic acid molecules that inhibit or reduce the expression of the SlSGR1 protein encoding gene and nucleic acid molecules that inhibit or reduce the expression of the SlLCY-B1 protein encoding gene, or expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines containing the nucleic acid molecules.
5. The method according to claim 4, characterized in that, The nucleic acid molecule that inhibits or reduces the expression of the SlSGR1 protein-encoding gene is a CRISPR / Cas9 editing tool that targets the SlSGR1 protein-encoding gene. The nucleic acid molecule that inhibits or reduces the expression of the SlLCY-B1 protein-encoding gene is a CRISPR / Cas9 editing tool that targets the SlLCY-B1 protein-encoding gene.
6. The method according to claim 5, characterized in that, The target sequence targeting the SlSGR1 protein encoding gene is shown in SEQ ID NO:1 and SEQ ID NO:2; The target sequence of the gRNA targeting the SlLCY-B1 protein encoding gene is shown in SEQ ID NO:3 and SEQ ID NO:4.