Reaction system for detecting nucleic acid of infected schistosome in oncomelania

Abstract

The invention provides a reaction system and a detection method for detecting nucleic acid of infected schistosome in oncomelania. Specifically, the invention provides an LAMP amplification color developing agent with an optimized proportion, a reaction system containing the color developing agent, a kit containing the color developing agent, and an LAMP detection method using the color developing agent. Experiments show that by adjusting the ratio of calcein to Mn < 2 + > in the color developing agent, the detection accuracy can be remarkably improved, and the oncomelania in-vivo schistosome infection condition can be rapidly, simply and conveniently detected.

Description

[0001] The present application is a divisional application of the invention patent application with the application date of December 23, 2015, the application number of 201510981625.5 and the invention name of “A reaction system for detecting nucleic acid of Schistosoma japonicum infection in snails”. Technical Field

[0002] The invention relates to the field of detection, and in particular to a reaction system for detecting nucleic acid of schistosoma japonicum infected in Oncomelania snails. Background Art

[0003] Schistosomiasis has always been an important parasitic disease that seriously endangers people's health and hinders the social and economic development of my country and many countries in the world. However, the existing experimental methods cannot meet the early warning monitoring under low infection conditions. For example, the snail crushing method combined with microscopic examination is easy to miss detection under low infection conditions; the sentinel mouse infection method experimental monitoring of the infected water environment takes a long time, more than 35 days, and the detection is delayed and cannot provide early warning. It is very necessary and important to develop sensitive and practical infectious snail detection reagents.

[0004] In recent years, molecular biological methods based on PCR technology, such as classical PCR and real-time PCR, have shown their advantages of high sensitivity and strong specificity in the detection of Oncomelania snails infected with Schistosoma japonicum. However, these methods have not been widely promoted in the field of schistosomiasis prevention and control because they require expensive experimental equipment and are cumbersome to operate. Therefore, there is an urgent need to develop a convenient, fast and highly sensitive method for detecting Schistosoma japonicum infection in Oncomelania snails. Summary of the invention

[0005] The invention provides a new reaction system and detection method for detecting schistosoma infection in Oncomelania snails.

[0006] In a first aspect of the present invention, a LAMP amplification colorimetric reagent is provided, wherein the colorimetric reagent comprises (a) calcein, (b) Mn 2+ , and (c) optionally a compatible solvent;

[0007] And the calcein and Mn 2+ The molar concentration ratio is 1:(10-15), preferably 1:12.

[0008] In another preferred embodiment, the molar concentration of calcein is 1.0-1.5 mmol / L, preferably 1.25 mmol / L.

[0009] In another preferred embodiment, the Mn 2+ The molar concentration is 10-20mmol / L, preferably 15mmol / L.

[0010] In another preferred embodiment, the miscible solvent is a C2-C6 diol or polyol.

[0011] In another preferred embodiment, the polyol is glycerol.

[0012] In another preferred embodiment, the content of glycerol is 40%-60%, preferably 45%-55%, more preferably 50%, based on the total weight of the developer.

[0013] The second aspect of the present invention provides a LAMP reaction system, which comprises (A) the color developer described in the first aspect of the present invention, (B) primers and enzymes for LAMP amplification, and (C) a buffer system.

[0014] In another preferred embodiment, the content of the developer in the reaction system is 3%-5%, preferably 4%, based on the total volume of the reaction system.

[0015] In another preferred embodiment, the molar concentration of calcein in the reaction system is 0.03-0.08 mmol / L, preferably 0.05 mmol / L.

[0016] In another preferred embodiment, the reaction system contains Mn 2+ The molar concentration is 0.3-0.8mmol / L, preferably 0.6mmol / L.

[0017] In another preferred embodiment, the enzyme is Bst DNA polymerase.

[0018] In another preferred embodiment, the primers for LAMP amplification include primers selected from the following group:

[0019] First primer pair:

[0020] F3:GCTTTGTCCTTCGGGCATTA(SEQ ID NO.:1)

[0021] B3:GGTTTCGTAACGCCCAATGA(SEQ ID NO.:2)

[0022] Second primer pair:

[0023] FIP: ACGCAACTGCCAACGTGACA TACTGGTCGGCTTGTTACTAGC(SEQ ID NO.:3)

[0024] BIP: TGGTAGACGATCCACCTGACCCCTCGCGCACATGTTAAACTC (SEQ ID NO.: 4).

[0025] In another preferred embodiment, the molar concentration ratio of the first primer pair to the second primer pair in the reaction system is 1:(6-10), preferably 1:(7-9), and more preferably 1:8.

[0026] In another preferred embodiment, the reaction system further comprises a DNA template to be tested.

[0027] In another preferred embodiment, the DNA template to be tested is a crude extract of Oncomelania hupensis DNA.

[0028] In another preferred embodiment, the DNA template to be tested is a crude DNA extract of 1-50 snails.

[0029] In another preferred embodiment, the buffer contains 1.6 M betaine, 2.5 M dNTP, and 0.8 M magnesium sulfate.

[0030] The third aspect of the present invention provides a LAMP detection kit, which comprises (A) the color developer described in the first aspect of the present invention, and (B) primers and enzymes for LAMP amplification.

[0031] In another preferred embodiment, the kit further comprises (C) a buffer system

[0032] In another preferred embodiment, the kit is used for detecting nucleic acid of Schistosoma japonicum infection in Oncomelania hupensis.

[0033] In another preferred embodiment, the kit further comprises a positive control DNA, wherein the positive control DNA is a 28S ribsomal plasmid DNA fragment with a length of 250-350 bp.

[0034] In another preferred embodiment, the positive control DNA is a 28S ribsomal plasmid DNA fragment with a length of 300 bp.

[0035] A fourth aspect of the present invention provides a non-diagnostic and non-therapeutic method for detecting Schistosoma japonicum infection in Oncomelania hupensis, comprising the following steps:

[0036] (i) providing a snail DNA sample to be tested;

[0037] (ii) performing a LAMP amplification reaction on the snail DNA sample to be tested in the presence of the color developing agent described in the first aspect of the present invention;

[0038] (iii) Observe the color change of the reaction system to determine the infection status of Schistosoma japonicum in the snail.

[0039] In another preferred embodiment, in step (iii), if the color of the reaction system turns green, it means that the test sample contains schistosome DNA; if the color of the reaction system is brown-yellow, it means that the test sample does not contain schistosome DNA.

[0040] In another preferred embodiment, the method further comprises the step of keeping the reaction system warm before step (iii).

[0041] In another preferred embodiment, in step (iii), the insulation temperature is 60-65°C, preferably 63-65°C.

[0042] In another preferred embodiment, in step (iii), the insulation time is 0.5-42 h, preferably 1-2 h.

[0043] The fifth aspect of the present invention provides a use of the color developer described in the first aspect of the present invention, wherein the color developer is used to prepare a preparation, and the preparation is used for the detection of schistosomes.

[0044] In another preferred embodiment, the preparation is used for the detection of Schistosoma japonicum

[0045] In another preferred embodiment, the preparation is used for detecting Schistosoma japonicum infection in Oncomelania hupensis.

[0046] In another preferred embodiment, the preparation is used for detecting nucleic acid of Schistosoma japonicum infection in Oncomelania hupensis.

[0047] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The LAMP test results of different mixed ratios of positive and negative snails are shown.

[0049] Figure 2 The results of different laboratories using the LAMP detection reagent of the present invention are shown. Figure 2 A shows the test results of Shanghai Center for Disease Control and Prevention. Figure 2 B shows the test results of the Institute of Parasitic Diseases of Hubei Provincial Center for Disease Control and Prevention. Figure 2 C shows the standard reference result. DETAILED DESCRIPTION

[0050] After extensive and in-depth research, the inventors unexpectedly discovered a reaction system and a detection method for detecting nucleic acid of Schistosoma japonicum in Oncomelania hupensis through a large number of screening and exploration. Experiments show that by using the LAMP detection method, by adjusting the calcein and Mn in the color developer, the 2+ The ratio can significantly improve the accuracy of detection and quickly and easily detect schistosoma japonicum infection in Oncomelania snails.

[0051] Loop-mediated isothermal amplification

[0052] Loop-mediated isothermal amplification (LAMP) is a novel isothermal nucleic acid amplification method. This method uses four specific primers for six target sequences and a DNA polymerase (Bst) with strand displacement activity to achieve large-scale amplification of nucleic acids under isothermal conditions (around 60-65°C) for 1 to 2 hours. The color change of the amplified product can be observed with the naked eye to determine whether there is a specific DNA amplification fragment in the sample.

[0053] Since its invention, the LAMP method has been widely used in the detection of various parasitic pathogens due to its advantages of sensitivity, rapidity and the requirement of no special instruments and equipment.

[0054] Schistosoma

[0055] Schistosoma, also known as schistosoma, is a flatworm that parasitizes in the veins of its host. The most harmful schistosoma to humans are Mansoniae, Haematobium, and Japonicum.

[0056] The life cycle of Schistosoma japonicum is relatively complex, including the alternation of sexual generations in the definitive host and asexual generations in the intermediate host Oncomelania snail. The life cycle is divided into seven stages: worm, egg, miracidium, mother sporocyst, daughter sporocyst, cercariae, and juvenile worm. Adult Schistosoma japonicum parasitizes the portal-mesenteric venous system of humans and various mammals. Female worms lay eggs in the distal end of the veins, and the eggs are mainly distributed in the liver and colon wall tissues. After the eggs mature, the miracidium eggs contained in the intestinal mucosa fall into the intestinal cavity and are excreted from the body with feces. Feces containing eggs pollute the water body, and under suitable conditions, the miracidium in the eggs hatch. The miracidium encounters a suitable intermediate host Oncomelania snail in the water, invades the snail body and gradually develops. First, a bag-shaped mother sporocyst is formed, and the embryonic cells in its body can produce many daughter sporocysts. The daughter sporocysts escape and enter the liver of the Oncomelania snail. The embryonic cells in its body proliferate one after another, forming many cercariae in batches. After the cercariae mature, they leave the snail and are often distributed on the surface of the water. When people or animals come into contact with water containing cercariae, the cercariae are infected through the skin. The cercariae invade the skin, shed their tails, and develop into larvae. The larvae penetrate into the small veins or lymphatic vessels, and are carried to the right heart and lungs with the blood flow or lymph, and pass through the small blood vessels of the alveoli to the left heart and are transported throughout the body. Most of the larvae then enter the small veins and flow along the blood into the branches of the portal vein system in the liver, where they stay temporarily and continue to develop. When the sexual organs are initially differentiated, when they encounter larvae of the opposite sex, they begin to embrace and migrate to the portal-mesenteric veins to live, gradually maturing into adults and mating and laying eggs.

[0057] Calcein

[0058] Calcein is also known as 3,3'-bis(methylaminediacetic acid)fluorescein and fluorescein complex hydrazone. Calcein is a calcium ion fluorescent indicator with an excitation wavelength of 495nm and an emission wavelength of 515nm. When its concentration is greater than 100mM, the green fluorescence of calcium yellow is self-quenched. It is often used as a complex indicator to titrate EDTA-chelated calcium ions and to determine calcium ion concentration by fluorescence detection.

[0059] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0060] General Materials and Methods

[0061] 1. Preparation of color developer

[0062] Calcein and Mn in the color developer 2+ The molar concentration ratio is 1:12, and glycerol (final concentration is 50%) is added to facilitate freezing. When used, 1 μL of color developer is added to every 25 μL reaction system.

[0063] 2. Amplification Primers

[0064] The ribosomal gene of Schistosoma japonicum (28S ribsomal DNA, Sj28S) was selected.

[0065] A pair of outer primer sequences:

[0066] F3:GCTTTGTCCTTCGGGCATTA(SEQ ID NO.:1)

[0067] B3:GGTTTCGTAACGCCCAATGA(SEQ ID NO.:2)

[0068] One pair of inner primer sequences:

[0069] FIP: ACGCAACTGCCAACGTGACATACTGGTCGGCTTGTTACTAGC(SEQ ID NO.:3)

[0070] BIP: TGGTAGACGATCCACCTGACCCCTCGCGCACATGTTAAACTC (SEQ ID NO.:4)

[0071] The present invention mixes four primers at high concentrations, wherein the molar concentrations of FIP and BIP are 40 μmol / L, and the molar concentrations of F3 and B3 are 5 μmol / L. When used, 1 μL of the primer mixture is added to every 25 μL of the reaction system.

[0072] 3.2×LAMP buffer

[0073] The final concentration is 1.6M betaine (Betanine), 2.5M dNTP, 0.8M magnesium sulfate (MgSO4). When used, add 12.5μL buffer for every 25μL reaction system.

[0074] 4. Positive Control

[0075] A 300 bp fragment of 28S ribsomal DNA was constructed into the pGEM-T vector, and the recombinant plasmid DNA was extracted as a positive control for amplification.

[0076] 5. Enzymes

[0077] The enzyme used in the examples is Bst DNA polymerase, purchased from New England Biolabs.

[0078] 6. LAMP detection method

[0079] 6.1 Reaction system preparation: Loop-mediated isothermal amplification (LAMP) reaction was performed according to a 25 μl reaction system. According to the design, a sterile 0.2 mL PCR reaction tube was taken and 2.0 μl of DNA template, 12.5 μl of 2×LAMP reaction buffer, 1.0 μl of target sequence amplification primer solution, 1.0 μl of BstDNA polymerase (Bst), 1.0 μl of colorimetric reagent (Calcein), and 7.5 μl of nuclease-free water (H2O) were added. At the same time, one tube of positive control (PC-DNA) and one tube of negative control (NC) should be set up for each experiment.

[0080] 6.2 Isothermal amplification reaction: Place the reaction tube on the buoy and incubate in a 65°C water bath for 60 to 90 minutes.

[0081] 6.3 Result determination: Observe the color change of the liquid in the reaction tube with the naked eye. If the liquid turns green, it is determined to be positive; if it turns negative, it is (brown) yellow. If the liquid in the negative control reaction tube shows green, it means that the laboratory or the detection system may be contaminated by other DNA and needs to be retested.

[0082] The LAMP detection system is described in the following table

[0083]

[0084] Example 1

[0085] Detection sensitivity experiment

[0086] The positive snails and negative snails are mixed at a ratio of 1:5, 1:10, 1:20, 1:50, 1:80 and 1:160, and the color developer of the present invention is used for LAMP detection. After the color developer is added to the reaction tube, the reaction tube turns green for positive and brown for negative.

[0087] The results are as follows Figure 1 As shown, when the ratio of positive snails to negative snails is 1:5, 1:10, 1:20, and 1:50, the reaction system is green, showing a positive reaction, indicating that 1 positively infected snail among 50 snails can be detected, and the detection method of the present invention has high sensitivity.

[0088] Example 2

[0089] Field sample collection and testing experiments

[0090] The developer of the present invention was used to perform LAMP detection on 232 mixed samples of Oncomelania snails collected from 5 provinces with schistosomiasis prevalence, each mixed sample containing about 50 Oncomelania snails. The above 232 mixed samples of Oncomelania snails were detected by microscopic detection, and the detection results of the two were compared. At the same time, the above samples were detected by PCR detection method with reliable results to evaluate the reliability of LAMP detection and microscopic detection results.

[0091] The results are shown in the following table. The positive rate of LAMP detection is 6.47%, which is close to the sensitivity of PCR method at 6.03%, indicating that the detection results of the present invention are reliable and accurate. The microscopic examination method only detected one positive sample, and the positive rate of detection was only 0.04%, which is very low in sensitivity. The positive rate of detection of the present invention is much higher than that of the microscopic examination method, and the accuracy and sensitivity of the detection results are very high. At the same time, the detection method is simple, the requirements for instruments and equipment are low, and it is easy to promote.

[0092]

[0093] Example 3

[0094] Test results of the detection reagent of the present invention in some provincial laboratories

[0095] The LAMP detection reagent and nucleic acid reference products of the present invention were distributed to four provincial laboratories across the country to carry out inter-laboratory comparison experiments.

[0096] The results are shown in the following table. The test results reported by the four provincial reference laboratories are completely consistent with the reference results. Figure 2 The results show that the detection reagent of the present invention has high accuracy.

[0097] Provincial Reference Laboratory LAMP detection compliance rate (%) Shanghai Center for Disease Control and Prevention 100％ Institute of Parasitic Diseases, Hubei Provincial Center for Disease Control and Prevention 100％ Hunan Provincial Schistosomiasis Control Institute 100％ Anhui Schistosomiasis Control Institute 100％

[0098] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A LAMP amplification colorimetric reagent for detecting Schistosoma japonicum infection in Oncomelania hupensis, characterized in that: The color developer comprises (a) calcein, (b) Mn 2+ , and (c) a compatible solvent; The molar concentration of calcein is 1.0-1.5 mmol / L, and the Mn 2+ The molar concentration is 10-20mmol / L; And the calcein and Mn 2+ The molar concentration ratio is 1:12; The miscible solvent is a C2-C6 diol or polyol.

2. The developer according to claim 1, characterized in that The molar concentration of the calcein is 1.25 mmol / L.

3. The developer according to claim 1, characterized in that The Mn 2+ The molar concentration is 15mmol / L.

4. The developer according to claim 1, characterized in that The polyol is glycerol.

5. The developer according to claim 1, characterized in that The content of the glycerol is 40%-60%, preferably 45%-55%, more preferably 50%, based on the total weight of the developer.

6. A LAMP reaction system for detecting Schistosoma japonicum infection in Oncomelania hupensis, characterized in that: The reaction system comprises (A) the color developing agent according to claim 1, (B) primers and enzymes for LAMP amplification, and (C) a buffer system; The content of the developer in the reaction system is 3%-5%, based on the total volume of the reaction system; The primers for LAMP amplification include primers selected from the following group: First primer pair: F3:GCTTTGTCCTTCGGGCATTA(SEQ ID NO.:1) B3:GGTTTCGTAACGCCCAATGA(SEQ ID NO.:2) Second primer pair: FIP: ACGCAACTGCCAACGTGACA TACTGGTCGGCTTGTTACTAGC(SEQ ID NO.:3) BIP: TGGTAGACGATCCACCTGACCCCTCGCGCACATGTTAAAACTC (SEQ ID NO.: 4).

7. The reaction system according to claim 6, characterized in that The content of the developer in the reaction system is 4%, based on the total volume of the reaction system.

8. A LAMP detection kit for detecting nucleic acid of Schistosoma japonicum infection in Oncomelania hupensis, characterized in that: The kit comprises (A) the color developing agent according to claim 1, and (B) primers and enzymes for LAMP amplification; The primers for LAMP amplification include primers selected from the following group: First primer pair: F3:GCTTTGTCCTTCGGGCATTA(SEQ ID NO.:1) B3:GGTTTCGTAACGCCCAATGA(SEQ ID NO.:2) Second primer pair: FIP: ACGCAACTGCCAACGTGACA TACTGGTCGGCTTGTTACTAGC(SEQ ID NO.:3) BIP: TGGTAGACGATCCACCTGACCCCTCGCGCACATGTTAAACTC (SEQ ID NO.: 4); The kit also contains a positive control DNA, which is a 28Sribsomal plasmid DNA fragment with a length of 250-350 bp.

9. A non-diagnostic and non-therapeutic method for detecting Schistosoma japonicum infection in Oncomelania hupensis, characterized in that: The following steps are involved: (i) providing a snail DNA sample to be tested; (ii) performing a LAMP amplification reaction on the snail DNA sample to be tested in the presence of the developer according to claim 1; (iii) Observe the color change of the reaction system to determine the infection status of Schistosoma japonicum in the snail.

10. Use of the developer according to claim 1, characterized in that: The color developer is used to prepare a preparation, and the preparation is used for the detection of schistosoma japonicum. Preferably, the preparation is used for the detection of schistosoma japonicum infection in Oncomelania hupensis. More preferably, the preparation is used for the detection of nucleic acid of schistosoma japonicum infection in Oncomelania hupensis.

Images