Composition for detecting lung cancer and application thereof

Abstract

The invention provides a composition for detecting lung cancer and application thereof, the composition comprises nucleic acid for detecting the methylation state of a target gene, and the target gene is an HLX gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of the kit for detecting lung cancer.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology and relates to gene detection, and specifically to a nucleic acid composition for detecting methylation of lung cancer-related genes and its corresponding kit and use. Background Art

[0002] The incidence and mortality of lung cancer are far higher than other types of cancer and rank first. In recent years, the incidence and mortality of lung cancer have continued to increase. In clinical practice, early lung cancer can be cured, but the symptoms of early lung cancer are not obvious. When patients go to the hospital for clinical symptoms such as cough and chest pain, most lung tumors have reached the middle and late stages, and the treatment effect is not ideal. The 5-year survival rate after surgery is less than 10%. Therefore, early diagnosis and early treatment are the key to improving the survival rate of lung cancer patients.

[0003] At present, the technical means used in the early screening and diagnosis of lung cancer in clinical practice mainly include imaging examination, hematological examination and pathological examination, but these means have certain limitations: for example, obtaining lung cancer tissue for pathological examination through surgery or puncture is the gold standard for lung cancer diagnosis, but there are problems such as high difficulty in operation, high trauma to patients and heterogeneity of tissue detection; currently, imaging examination mainly uses low-dose spiral CT (LD-CT) for chest scanning. This technology can reduce the overall lung cancer mortality rate by improving the detection rate of early lung cancer, but at the same time, its high false positive rate and possible radiation damage are worrying; clinically, serological tumor markers are often used, such as the five lung cancer items (CEA, CYFRA21-1, SCC, Pro-GRP, NSE), as auxiliary diagnostic means for lung cancer, but these traditional serological tumor markers have low sensitivity for early lung cancer detection and cannot meet the requirements of early screening.

[0004] In recent years, more and more studies have shown that DNA methylation is closely related to the occurrence and development of diseases such as lung cancer. As one of the research focuses in the field of epigenetics, DNA methylation refers to the process in which the 5'-terminal cytosine in the CpG dinucleotide on the genomic DNA sequence is converted to the 5'-terminal methylcytosine under the catalysis of DNA methyltransferase. It has been confirmed that abnormal high methylation in the promoter region of tumor suppressor genes will inhibit the transcription of the corresponding tumor suppressor genes, reduce or silence gene expression, and lead to weakening or loss of the gene's tumor suppressor function, thereby promoting the occurrence and development of lung cancer. Abnormal DNA methylation usually occurs in the ultra-early stage of cancer and is the "seed" factor of tumor growth. In addition, as the course of cancer progresses, the methylation state of DNA will also change dynamically, which can directly reflect the growth of tumor lesions. Therefore, the use of DNA methylation detection for early screening and auxiliary diagnosis of lung cancer has great application potential. Summary of the invention

[0005] At present, the technology used in clinical practice for early lung cancer screening and diagnosis is mainly low-dose spiral CT (LDCT) imaging detection technology. Large-scale clinical data analysis has found that LDCT has a significant effect on reducing lung cancer mortality, but there is a high false positive rate, so there is a risk of overdiagnosis leading to overtreatment. In addition, imaging examinations have certain limitations in terms of equipment cost, operating technology, result interpretation, and radiation hazards.

[0006] Traditional serum tumor markers such as the five lung cancer items (CEA, CYFRA21-1, SCC, Pro-GRP, NSE) have low sensitivity for lung cancer detection, especially for early lung cancer detection, and cannot fully meet the requirements for early lung cancer screening.

[0007] Therefore, based on the problems existing in the existing lung cancer detection, the purpose of this application is to provide a new biomolecular marker with great diagnostic value for lung cancer, to achieve non-invasive detection of lung cancer in vitro, and to improve the detection rate of early lung cancer.

[0008] The specific technical solutions of this application are as follows:

[0009] 1. A composition for detecting lung cancer, comprising:

[0010] Nucleic acid used to detect the methylation status of the target gene,

[0011] Wherein, the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene,

[0012] Wherein, the target gene is the HLX gene.

[0013] 2. The composition according to item 1, wherein the target sequence of the HLX gene is as shown in any one of SEQ ID NOs: 1-4 or the target sequence of the HLX gene comprises a sequence as shown in any one of SEQ ID NOs: 1-4.

[0014] 3. The composition according to item 1 or 2, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0015] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene,

[0016] The fragment comprises at least one CpG dinucleotide sequence;

[0017] Preferably, the fragment of at least 9 nucleotides is the sequence of SEQ ID NO:5 and SEQ ID NO:6.

[0018] 4. The composition according to any one of items 1 to 3, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0019] A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions,

[0020] The fragment comprises at least one CpG dinucleotide sequence;

[0021] Preferably, the fragment of at least 15 nucleotides is the sequence of SEQ ID NO:7.

[0022] 5. A composition according to any one of items 1 to 4, further comprising:

[0023] A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

[0024] 6. The composition according to any one of items 1 to 5, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0025] Blockers that preferentially bind to target sequences in their unmethylated state.

[0026] 7. An oligonucleotide for detecting lung cancer, comprising:

[0027] A fragment of at least 9 nucleotides in a sequence as shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

[0028] 8. The oligonucleotide according to item 7, further comprising:

[0029] A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1-4 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

[0030] 9. The oligonucleotide according to item 7, further comprising:

[0031] Blockers that preferentially bind to target sequences in their unmethylated state.

[0032] 10. An oligonucleotide for detecting lung cancer, comprising:

[0033] Sequences of SEQ ID NO:5 and SEQ ID NO:6.

[0034] 11. The oligonucleotide according to item 10, further comprising:

[0035] Sequence of SEQ ID NO:7.

[0036] 12. A kit comprising the composition according to any one of items 1 to 6 or comprising the oligonucleotide according to any one of items 7 to 11.

[0037] 13. The kit according to item 12, further comprising at least one other component selected from the group consisting of:

[0038] Nucleoside triphosphates, DNA polymerase and buffer required for the function of the DNA polymerase.

[0039] 14. A kit according to item 12 or 13, wherein the samples used for detection in the kit include: cell lines, histological sections, tissue biopsy / paraffin-embedded tissues, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, separated blood cells, cells separated from blood, or a combination thereof.

[0040] 15. The kit according to any one of items 12-14, further comprising: instructions.

[0041] 16. Use of the composition described in any one of Items 1 to 6 or the oligonucleotide described in any one of Items 7 to 11 in the preparation of a kit for detecting lung cancer.

[0042] 17. The use according to item 16, wherein the kit for detecting lung cancer detects lung cancer by a method comprising the following steps:

[0043] 1) separating a DNA sample including a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

[0044] 2) determining the methylation status of the target sequence of the target gene;

[0045] 3) The state of the biological sample is judged by the detection result of the methylation state of the target sequence of the target gene, thereby realizing the detection of lung cancer.

[0046] 18. The use according to item 17, wherein the method comprises the following steps:

[0047] Extracting genomic DNA from the biological sample to be tested;

[0048] Treat the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases;

[0049] contacting the DNA sample treated with the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform a DNA polymerization reaction;

[0050] detecting the amplified product with a probe; and

[0051] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0052] 19. The use according to item 18, wherein the reagent is a bisulfite reagent.

[0053] 20. Use of HLX gene in preparing a kit for detecting lung cancer.

[0054] 21. The use according to item 20, wherein the target sequence of the HLX gene is as shown in any one of SEQ ID NOs: 1-4 or the target sequence of the HLX gene comprises a sequence as shown in any one of SEQ ID NOs: 1-4.

[0055] This application has the following beneficial effects:

[0056] The present application screens out the HLX gene, a related marker that can sensitively and specifically detect lung cancer, and determines the target sequence where the related marker is abnormally methylated, and can sensitively and specifically detect the methylation state of the gene. The composition described in the present application is used for screening asymptomatic people in a non-invasive manner, has the characteristics of non-invasiveness, and can achieve real-time monitoring. Therefore, the present application provides a composition, a kit, and a detection method that can be used to detect lung cancer, which can detect lung cancer conveniently, quickly, and effectively, and has important clinical application value. DETAILED DESCRIPTION

[0057] The present application is described in detail below. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0058] Unless otherwise indicated, the implementation of this application will adopt conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry and genetics techniques, which are all within the scope of conventional technical means in this area. Such techniques are described in detail in the literature such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, 1984 edition); Animal Cell Culture (RI Freshney, 1987 edition); Methods in Enzymology series (American Academic Press Co., Ltd.); Current Protocols in Molecular Biology (FM Ausubel et al., 1987 edition, and regular updates); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 edition). The primers, probes, blockers and kits used in this application can be prepared using standard techniques known in the art.

[0059] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0060] definition

[0061] The term "precancerous cell" as used herein refers to a cell that is in the early stages of transformation into a cancer cell or that is prone to transformation into a cancer cell. Such a cell may exhibit one or more phenotypic traits characteristic of a cancer cell.

[0062] "Stringent hybridization conditions" and "high stringency" in this application refer to the conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and are different in different environments. Longer sequences hybridize specifically at higher temperatures. For detailed guidance on nucleic acid hybridization, refer to Tijssen, Biochemistry and Molecular Biology Techniques - Nucleic Acid Probe Hybridization, "A Review of Hybridization Principles and Nucleic Acid Assay Strategies". Generally, stringent conditions are about 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength pH. At the temperature of Tm (at a defined ionic strength, pH and nucleic acid concentration), 50% of the probes complementary to the target hybridize to the target sequence in a balanced manner. Stringent conditions can also be achieved by adding destabilizers. For selective or specific hybridization, the positive signal is twice the background hybridization, preferably 10 times. Exemplary stringent hybridization conditions are as follows: hybridization in a solution of 50% formamide, 5x SSC and 1% SDS at 42°C, or hybridization in a solution of 5x SSC and 1% SDS at 65°C, followed by washing in a solution of 0.2x SSC and 0.1% SDS at 65°C.

[0063] Furthermore, nucleic acids that do not hybridize under stringent conditions are still substantially similar if the polypeptides encoded by the nucleic acids are substantially similar. In this case, the nucleic acids are typically hybridized under moderately stringent hybridization conditions. As an example, "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1M sodium chloride and 1% SDS at 37°C, and washing in a solution of 1x SSC at 45°C. Guidance for achieving conditions that achieve the same stringency will be readily apparent to one of ordinary skill in the art. For PCR, a temperature of around 36°C is typically suitable for low stringency amplification, while the annealing temperature ranges from 32°C to 48°C based on the length of the primers. For highly stringent PCR amplification, it is generally 62°C, while the annealing temperature for highly stringent hybridization ranges from 50°C to 65°C based on the length and specificity of the primers. Cycling conditions for high stringency and low stringency amplifications typically include a denaturation phase at 90-95° C. for 30 seconds to 2 minutes, an annealing phase for 30 seconds to 2 minutes, and an extension phase for 1 to 2 minutes at about 72° C. Tools and guidance for low and high stringency amplification reactions are available in the art.

[0064] " oligonucleotide " in the present application refers to the molecule consisting of two or more nucleotides, preferably the molecule consisting of more than three nucleotides, and its accurate size can rely on many factors, and these factors in turn are determined by the final function and purpose of the oligonucleotide. In some embodiments, oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In some embodiments, oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0065] The application's "primer" means an oligonucleotide that can be used as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid chain, i.e., in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at a suitable temperature and pH, whether it is naturally occurring or synthetically produced in a purified restriction digest. Primers can be single-stranded or double-stranded, and must be long enough to induce the synthesis of a desired extension product in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, an oligonucleotide primer typically contains at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, but it can contain fewer nucleotides or more nucleotides. Factors involved in determining the appropriate length of a primer are well known to those skilled in the art.

[0066] The "primer pair" of the present application refers to a primer pair that hybridizes to opposite strands of a target DNA molecule or to a target DNA region flanking a nucleotide sequence to be amplified.

[0067] As used herein, a "primer site" refers to a region of a target DNA or other nucleic acid to which a primer hybridizes.

[0068] The "probe" of the present application, when referring to a nucleic acid sequence, is used in its usual sense to refer to a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. The probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs, which can utilize the high accuracy of molecular denaturation, renaturation and complementary base pairing to hydrogen bond (hybridize) with complementary non-labeled single-stranded DNA or RNA in the sample to be tested to form a double-stranded complex (hybrid). It should be understood by those skilled in the art that in some cases, the probe can also be used as a primer, and the primer can be used as a probe.

[0069] "DNA methylation" of the present application refers to the addition of a methyl group to the 5th position of cytosine (C), which is usually (but not necessarily) in the case of a CpG (guanine after cytosine) dinucleotide. As a relatively stable modification state, under the action of DNA methyltransferase, it can be inherited to the newborn daughter DNA along with the replication process of DNA, which is an important epigenetic mechanism. During DNA methylation, methylation of the gene promoter region can lead to transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Abnormal methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, and loss of imprinting of certain genes, which are related to the occurrence of various tumors. As used herein, "increased methylation level" or "significant methylation level" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0070] In embodiments, a variety of different methods can be used to detect DNA methylation changes. The method for detecting DNA methylation includes, for example, utilizing southern or polymerase chain reaction (PCR) analysis of methylation-sensitive restriction endonuclease (MSRE) assay, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high resolution melting (HRM) analysis, bisulfite sequencing, pyrophosphate sequencing, methylation-specific single-stranded conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO). These determinations can be PCR analysis, quantitative analysis using fluorescent labels or southern imprint analysis.

[0071] A "methylation assay" as used herein refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0072] "Detection" in this application refers to any process of observing a marker or marker change in a biological sample (e.g., a change in the methylation state of a marker or the expression level of a nucleic acid or protein sequence), regardless of whether the marker or marker change is actually detected. In other words, the act of detecting a marker or marker change in a sample is "detection", even if the marker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation, and can be based on comparison with one or more control samples. It should be understood that detecting lung cancer disclosed herein includes detecting precancerous cells that begin to develop into lung cancer cells or are about to develop into lung cancer cells, or have an increased tendency to develop into lung cancer cells. Detecting lung cancer can also include detecting a possible probability of death or a possible prognosis of a disease condition.

[0073] "Homology", "identity" and "similarity" of the present application refer to the sequence similarity between two nucleic acid molecules. "Homology", "identity" or "similarity" can be determined by comparing the positions in each sequence, and the sequences can be aligned for the purpose of comparison. When equivalent positions in the compared sequences are occupied by the same base, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid (for example, similar in spatial properties or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the function of the number of identical or similar amino acids at the positions shared by the compared sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity with the sequences of the present application. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces identity and homology / similarity. In a specific embodiment, two or more sequences or subsequences are considered to be substantially or significantly homologous, similar or identical if their sequences are about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a specified region, as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection provided online by, for example, the National Center for Biotechnology Information (NCBI). This definition also relates to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context of the present invention, for example, if the nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, then the nucleotide sequence that is complementary to a specified target sequence or a variant thereof is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences that can encode the same or similar polypeptide products, and any allowed variants of any of the above. Circumstances in which similarity must be limited to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region that is at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region that is more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.

[0074] "Amplification" herein refers to the process of obtaining multiple copies of a specific locus of a nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0075] The "fluorescence-based real-time PCR" of this application refers to a method in which a fluorescent group is added to the PCR reaction system, the entire PCR process is monitored in real time using the accumulation of fluorescent signals, and finally the unknown template is quantitatively analyzed using a standard curve. In this PCR technology, there is a very important concept, the cycle threshold, also known as the Ct value. C stands for Cycle, t stands for threshold, and the meaning of the Ct value is: the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold. For example, the method for setting the fluorescence threshold is as follows: the fluorescent signal of the first 15 cycles of the PCR reaction is used as the fluorescent background signal, and the default (default) setting of the fluorescence threshold is 10 times the standard deviation of the fluorescent signal of 3-15 cycles.

[0076] The "cut off value of real-time PCR" in this application refers to a critical Ct value for judging the positive or negative of a sample for a certain biomarker. According to certain specific real-time methods of this application, "the critical Ct value (Cut Off value) is obtained based on a certain amount of sample data and statistical processing", and the critical Ct value may vary according to the required sensitivity or specificity requirements.

[0077] The "sensitivity" of this application refers to the proportion of cancer detected from a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancer / all cancers), while "specificity" refers to the proportion of normal detected in a certain normal human sample or a sample with a benign disease, and its calculation formula is specificity = (detected negative / total negative).

[0078] The "label" or "detectable part" of the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin or haptens and proteins that can be prepared to be detectable, for example, by incorporating a radioactive label into a peptide or for detecting antibodies that specifically react with a peptide.

[0079] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blot, Northern blot or in situ hybridization). Specifically, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying target nucleic acids can be used for PCR reactions. PCR methods generally include the following steps: obtaining a sample, separating nucleic acids (e.g., DNA, RNA or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers, which specifically hybridize with the template nucleic acid under conditions that enable template nucleic acid amplification to occur. In the presence of template nucleic acid, an amplification product is produced. The conditions for nucleic acid amplification and amplification product detection are known to those skilled in the art. A variety of improvements to basic PCR techniques have been developed, including, but not limited to, anchored PCR, RACE PCR, RT-PCR and ligase chain reaction (LCR). The primer pairs in the amplification reaction must anneal to the relative strands of the template nucleic acid, and should be kept at a suitable distance from each other so that the polymerase can effectively polymerize across the region and make it possible to easily detect the amplification product, for example, using electrophoresis. For example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to assist in designing primers with similar melting temperatures. Typically, oligonucleotide primers are 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), but oligonucleotide primers can be longer or shorter, as long as appropriate amplification conditions are used.

[0080] Detection of the amplification product or hybridization complex is usually achieved using a detectable label. The term "label", when referring to nucleic acids, is intended to include direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent directly labeled with a detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include avidin streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of indirect labeling include end-labeling of a nucleic acid with biotin, such that the nucleic acid can be detected using fluorescently labeled streptavidin.

[0081] Overview

[0082] Liquid biopsy technology uses body fluids such as blood, saliva, and urine as samples, and tumor markers as detection indicators to achieve early screening and diagnosis of cancer, auxiliary staging, prognosis and recurrence monitoring, medication guidance, etc. It has the advantages of being non-invasive, efficient, and accurate. Among them, using abnormal changes in DNA methylation levels as a marker for molecular diagnosis of tumors is one of the current research hotspots and has gradually become a consensus in the scientific and medical communities. DNA methylation is an important epigenetic modification and participates in the regulation of a variety of cellular processes, including embryonic development, gene transcription, X chromosome inactivation, genomic imprinting, chromatin structure stability, etc. Therefore, abnormal DNA methylation is closely related to the occurrence of complex human diseases. In normal cells, cytosine in CpG islands and some CG-rich sites is usually non-methylated, while cytosine bases in regions with a low CG ratio are mostly in a high methylation state. However, in many cancers, the methylation pattern is just the opposite. Many studies have shown that high methylation of CpG islands can inhibit or silence the expression of some tumor suppressor genes and DNA mismatch repair genes, while low methylation in other regions of the genome can promote the expression of oncogenes, which will give normal cells carcinogenic properties and promote the occurrence of cancer. In addition, abnormal DNA methylation usually occurs in the very early stages of cancer and is the "seed" factor for tumor growth. As the course of cancer progresses, the methylation state of DNA will also change dynamically, which can directly reflect the growth of tumor lesions. Therefore, the use of DNA methylation detection for early cancer screening and auxiliary diagnosis has great application potential.

[0083] On the one hand, the present application provides a composition for detecting lung cancer, the composition comprising a nucleic acid for detecting the methylation state within a target sequence of a target gene, wherein the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is the HLX gene.

[0084] The present application provides a group of target sequences of target genes that are abnormally methylated in lung cancer, including the target sequence of the HLX gene. The target sequence of the HLX gene is shown in any one of SEQ ID NOs: 1-4 or includes a sequence shown in any one of SEQ ID NOs: 1-4.

[0085] Those skilled in the art can also understand that the target sequence of the HLX gene is not limited to the specific sequences listed above. The target sequence of the HLX gene should include a sequence that contains one, two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-4, but is still substantially functionally the same, and also includes a sequence with 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-4, and also includes a sequence that deletes one or more nucleotides, adds one or more nucleotides, or replaces one or more nucleotides based on the nucleotide sequence shown in any one of SEQ ID NOs: 1-4 but has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence shown in any one of SEQ ID NOs: 1-4.

[0086] The target sequence of the HLX gene is as follows (5'-3'):

[0087] GAGAGACAGGCAGTATACTGGCTATTTCAGCACTTTGCGGGTAAAACCACGCTAATAAATTTCCCCATTCTCCTCCATATGGCAAAGCAGAGAGGAGCCTCTGCCGCCTTATTCAGCCTGTGTGGGTGGGTAGGGCGCTTGTTTCCACAGAGAATTTGCCTAGCGCCAAGTTCCGCGGACTAAACCACTGAAGGCTGGCGCCGCGTTTCTCTCCCTTTTGCCCGCTTCAGTCGAGAGTGGGCATAGACATCCTTGCGAGCAGTGTGTCTCCCTCGCCTTCCTGTGCCCACCCCCCCGCCCGAGGCCAAAGTCGTCAGCCCCCGGGGCAGGTCCAGGCGAGGTCCTGCTTCCAAGGGAGGCTCAGGTCATTATACCAGCCAGGGAGATTTCCCGCTTCTCTCCCTCTACTCCCTGCAAAGAGTCGTGTGGATTG(SEQ ID NO:1);

[0088] The complementary sequence of the target sequence of the HLX gene is as follows (5'-3'):

[0089] CAATCCACACGACTCTTTGCAGGGAGTAGAGGGAGAGAAGCGGGAAATCTCCCTGGCTGGTATAATGACCTGAGCCTCCCTTGGAAGCAGGACCTCGCCTGGACCTGCCCCGGGGGCTGACGACTTTGGCCTCGGGCGGGGGGGTGGGCACAGGAAGGCGAGGGAGACACACTGCTCGCAAGGATGTCTATGCCCACTCTCGACTGAAGCGGGCAAAAGGGAGAGAAACGCGGCGCCAGCCTTCAGTGGTTTAGTCCGCGGAACTTGGCGCTAGGCAAATTCTCTGTGGAAACAAGCGCCCTACCCACCCACACAGGCTGAATAAGGCGGCAGAGGCTCCTCTCTGCTTTGCCATATGGAGGAGAATGGGGAAATTTATTAGCGTGGTTTTACCCGCAAAGTGCTGAAATAGCCAGTATACTGCCTGTCTCTC(SEQ ID NO:2); The target sequence of the HLX gene after bisulfite treatment (5'-3') is as follows:

[0090] GAGAGATAGGTAGTATATTGGTTATTTTAGTATTTTGCGGGTAAAATTACGTTAATAAATTTTTTTATTTTTTTTTATATGGTAAAGTAGAGAGGAGTTTTTGTCGTTTTATTTAGTTTGTGTGGGTGGGTAGGGCGTTTGTTTTTATAGAGAATTTGTTTAGCGTTAAGTTTCGCGGATTAAATTATTGAAGGTTGGCGTCGCGTTTTTTTTTTTTTTGTTCGTTTTAGTCGAGAGTGGGTATAGATATTTTTGCGAGTAGTGTGTTTTTTTCGTTTTTTTGTGTTTATTTTTTCGTTCGAGGTTAAAGTCGTTAGTTTTCGGGGTAGGTTTAGGCGAGGTTTTGTTTTTAAGGGAGGTTTAGGTTATTATATTAGTTAGGGAGATTTTTCGTTTTTTTTTTTTTATTTTTTGTAAAGAGTCGTGTGGATTG(SEQ ID NO:3);

[0091] The complementary sequence of the target sequence of the HLX gene after bisulfite treatment (5'-3') is as follows:

[0092] TAATTTATACGATTTTTTGTAGGGAGTAGAGGGAGAGAAGCGGGAAATTTTTTTGGTTGGTATAATGATTTGAGTTTTTTTGGAAGTAGGATTTCGTTTGGATTTGTTTCGGGGGGTTGACGATTTTGGTTTCGGGCGGGGGGGTGGGTATAGGAAGGCGAGGGAGATATATTGTTCGTAAGGATGTTTATGTTTATTTTCGATTGAAGCGGGTAAAA GGGAGAGAAACGCGGCGTTAGTTTTTAGTGGTTTAGTTCGCGGAATTTGGCGTTAGGTAAATTTTTTGTGGAAATAAGCGTTTTATTTATTTATATAGGTTGAATAAGGCGGTAGAGGTTTTTTTTTGTTTTGTTATATGGAGGAGAATGGGGAAATTATTAGCGTGGTTTTATTCGTAAAGTGTTGAAATAGTTAGTATATTGTTTGTTTTTT (SEQ ID NO:4).

[0093] The target sequence and related sequences of HLX gene are shown in Table 1:

[0094] Table 1: Target sequences and related sequences of HLX genes

[0095] Target sequence name Serial Number Target sequences of HLX genes SEQ ID NO:1 Complementary sequence of the target sequence of the HLX gene SEQ ID NO:2 Target sequence of HLX gene after bisulfite treatment SEQ ID NO:3 The complementary sequence of the target sequence of the HLX gene after bisulfite treatment SEQ ID NO:4

[0096] Preferably, the nucleic acid used to detect the methylation state of the target gene includes a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if the sample DNA to be tested is converted using bisulfite, the nucleic acid used to detect the methylation state of the target gene includes a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence.

[0097] More preferably, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides in the target sequence of the target gene that hybridizes under moderate stringency or stringent conditions, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if the test sample DNA is converted using bisulfite, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides in the sequence after bisulfite conversion, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, hybridized to the target sequence of the target gene under moderate stringency or stringent conditions, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence.

[0098] Preferably, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.

[0099] The nucleic acid used to detect the methylation status of the target gene may also include a blocker that preferentially binds to DNA in an unmethylated state.

[0100] Preferably, the composition comprises primers and probes as shown in Table 2:

[0101] Table 2 Primer and probe sequences used in this application

[0102] Sequence number sequence name Specific nucleotide sequence (5'-3') SEQ ID NO:5 HLX-F CGGGTAAAAGGGAGAGAAAC SEQ ID NO:6 HLX-R TTACCTAACGCCAAATTCCG SEQ ID NO:7 HLX-P CGAACTAAACCACTAAAAACTAACGCCG

[0103] In Table 2, "F" indicates a forward primer; "R" indicates a reverse primer; and "P" indicates a probe.

[0104] Preferably, the fluorescent labeling method of the probe sequence used in this application is shown in Table 3:

[0105] Table 3 A fluorescent labeling method for the probe sequences used in this application

[0106] Sequence number sequence name 5' labeling 3' labeling SEQ ID NO:7 HLX-P FAM BHQ1

[0107] In certain embodiments, the composition further comprises an agent for converting the unmethylated cytosine base at position 5 of the gene into uracil. Preferably, the agent is bisulfite. Bisulfite modification of DNA is a known tool for assessing the methylation status of CpGs. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. In addition, during PCR amplification, the epigenetic information carried by 5-methylcytosine is completely lost. The method most commonly used to analyze the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosine is converted into uracil, which corresponds to thymine in pairing behavior; but under these conditions, 5-methylcytosine remains unmodified. Thus the original DNA is transformed in this way, so that the 5-methylcytosine that originally could not be distinguished from cytosine in its hybridization behavior can now be detected as the only remaining cytosine by conventional known molecular biology techniques, such as by amplification and hybridization. All these techniques are based on different base pairing characteristics and can now be fully utilized. Therefore, typically, the application provides the combined use of bisulfite technology and methylation assay to determine the methylation state of the CpG dinucleotide sequence in the target sequence of the target gene. In addition, the method of the application is suitable for analyzing heterogeneous biological samples, such as low-concentration tumor cells in blood or feces. Therefore, when analyzing the methylation state of CpG dinucleotide sequences in such samples, those skilled in the art can use quantitative determination methods to determine the methylation level (such as percentage, number, ratio, proportion or degree) of specific CpG dinucleotide sequences, rather than methylation state. Accordingly, the term methylation status or methylation state should also be considered to refer to the value reflecting the methylation state of the CpG dinucleotide sequence.

[0108] On the other hand, the present application provides an oligonucleotide for detecting lung cancer, comprising: a fragment of at least 9 nucleotides of a sequence shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence.

[0109] Preferably, the oligonucleotide for detecting lung cancer comprises: a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence.

[0110] The oligonucleotide for detecting lung cancer of the present application also includes: a fragment of at least 15 nucleotides hybridizing to the sequence shown in any one of SEQ ID NOs: 1-4 or its complementary sequence under moderately stringent or stringent conditions and containing at least one CpG dinucleotide sequence.

[0111] Preferably, the oligonucleotide for detecting lung cancer comprises: a fragment of at least 15 nucleotides that hybridizes to a sequence of any one of SEQ ID NOs: 1-4 or its complementary sequence after bisulfite conversion under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

[0112] The oligonucleotide for detecting lung cancer of the present application may further include: a blocker that preferentially binds to DNA in a non-methylated state.

[0113] In a specific embodiment, the oligonucleotide for detecting lung cancer includes the sequences of SEQ ID NO: 5 and SEQ ID NO: 6. It also includes the sequence of SEQ ID NO: 7.

[0114] In another aspect, the present application provides a kit comprising the composition, wherein the kit further comprises at least one other component selected from the following: nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0115] Typically, the kit also includes a container for containing a biological sample from a patient. In addition, the kit also includes instructions for use and interpretation of the test results.

[0116] The present application also relates to the use of the above composition and oligonucleotide in preparing a kit for detecting lung cancer.

[0117] The present application also relates to the use of the HLX gene in preparing a kit for detecting lung cancer.

[0118] Among them, the HLX gene has specific DNA binding activity, participates in RNA polymerase II-related cell differentiation and transcriptional regulation, and acts upstream or internally in multiple processes, including organ development, enteric nervous system development, and regulation of T helper cell differentiation.

[0119] In another aspect, the present application provides a method for detecting lung cancer, the method comprising the following steps:

[0120] 1) Isolating the target sequence or fragment thereof of the target gene in the biological sample to be tested;

[0121] 2) determining the methylation status of the target sequence of the target gene;

[0122] 3) The state of the biological sample is judged by the detection result of the methylation state of the target sequence of the target gene, thereby realizing the detection of lung cancer.

[0123] According to certain preferred embodiments, the method further comprises the following steps:

[0124] 1) Extracting genomic DNA from the biological sample to be tested;

[0125] 2) treating the DNA sample obtained in step 1) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, the unmethylated cytosine base at position 5 of the target sequence of the target gene is converted into uracil or other bases, and the converted base is different from the unmethylated cytosine base at position 5 in terms of hybridization performance and is detectable;

[0126] 3) contacting the DNA sample treated in step 2) with a DNA polymerase and a primer of the target sequence of the target gene, so that the treated target sequence of the target gene is amplified to produce an amplification product or is not amplified; if the treated target sequence of the target gene undergoes a DNA polymerization reaction, an amplification product will be produced; if the treated target sequence of the target gene does not undergo a DNA polymerization reaction, it will not be amplified;

[0127] 4) detecting the amplified product with a probe; and

[0128] 5) determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.

[0129] Preferably, a typical primer includes a fragment of the target sequence of the target gene, which contains a fragment of at least 9 nucleotides that are identical, complementary or hybridize under moderately stringent or stringent conditions to any one selected from SEQ ID NO: 1-4.

[0130] Preferably, a typical probe includes a fragment of the target sequence of the target gene, which contains a fragment of at least 15 nucleotides that are identical, complementary or hybridize under moderately stringent or stringent conditions to any one selected from SEQ ID NO: 1-4.

[0131] Preferably, the primers and probes are as shown in Table 2 above.

[0132] Furthermore, the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplification product nucleic acid molecules with detectable labels.

[0133] Preferably, the methylation state is determined by PCR, such as "fluorescence-based real-time PCR technology", methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylated CpG island amplification (MCA) and other determination methods are used to determine the methylation state of at least one CpG dinucleotide of the target sequence of the target gene. Among them, the "fluorescence-based real-time PCR" determination is a high-throughput quantitative methylation determination, which uses fluorescence-based real-time PCR (TaqMan) technology and does not require further operation after the PCR step. In short, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA, which is converted into a mixed pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard operations. Subsequently, fluorescence-based PCR is performed in a "biased" reaction (using PCR primers that overlap known CpG dinucleotides). Sequence differences can be generated at the amplification level and at the fluorescence detection amplification level. The "fluorescence-based real-time PCR" determination can be used as a quantitative test of methylation state in genomic DNA samples, wherein sequence differentiation occurs at the probe hybridization level. In this quantitative mode, in the presence of a fluorescent probe that overlaps a specific CpG dinucleotide, the PCR reaction provides a methylation-specific amplification. The non-biased control for the initial DNA amount is provided by the following reaction: neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler", etc. The TaqMan probe is a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) double-labeled, and is designed to be specific to a relatively high GC content region, so that it melts at a temperature of about 10°C higher than the forward or reverse primer in the PCR cycle. This allows the TaqMan probe to remain fully hybridized in the PCR annealing / extension step. When Taq polymerase synthesizes a new chain in PCR, it will eventually encounter the annealed TaqMan probe. The 5' to 3' endonuclease activity of the Taq polymerase will then replace the TaqMan probe by digesting it, thereby releasing the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescence detection system. Typical reagents for "fluorescence-based real-time PCR" analysis may include, but are not limited to: target sequence PCR primers for target genes; non-specific amplification blockers; TaqMan or Lightcycler probes; optimized PCR buffer and deoxynucleotides; and Taq polymerase, etc.

[0134] In certain preferred embodiments, the methylation state of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By using the method of analyzing DNA in a biological sample by real-time PCR reaction, the methylation state of the target sequence of the target gene can be conveniently detected, and whether the sample under test is positive can be quickly and conveniently determined based on the critical Ct value of the PCR reaction, thereby providing a non-invasive and rapid lung cancer detection method.

[0135] The biological sample is selected from the group consisting of cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0136] The inventors of the present application have found that there is a significant difference between the methylation state of the target sequence of the HLX gene in lung cancer tissue and the methylation state of the target sequence of the gene in normal tissue: in lung cancer tissue, the target sequence of the HLX gene is methylated, while in normal tissue, the target sequence of the HLX gene is not methylated. Therefore, the present application provides a method for detecting lung cancer by detecting the methylation state of the target sequence of the HLX gene in a sample, and the method provided by the present application can detect lung cancer non-invasively and quickly.

[0137] Example

[0138] The present application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage. The reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be obtained commercially.

[0139] Example 1 Primer and probe test

[0140] Primers and probes were designed according to the target sequence of the HLX gene. The designed primers and probe sequences are shown in Table 2 above.

[0141] The genomic DNA of the cell line of normal human white blood cells (WBC) is usually in a low / unmethylated state. Whole genome amplification of the genomic DNA will not introduce new methylation. In theory, the methylation level of the whole genome amplification product (UM) is extremely low and can be used as a negative control. The amount of DNA used in this embodiment is 20ng / reaction; the human genome DNA methyltransferase treatment product (M) is usually in a high / full methylated state and can be used as a positive control. The amount of DNA used in this embodiment is 400pg / reaction. The DNA sample is first subjected to bisulfite conversion, and the converted BisDNA is used as a template to perform real-time PCR amplification using the above-mentioned primer probe; the β-actin (ACTB) gene is used as an internal reference, and the β-actin gene amplicon is created by using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon is detected with a specific probe; each sample is subjected to at least one real-time PCR amplification. The PCR system for the primer probe test is shown in Table 4 below.

[0142] Table 4 PCR system for primer probe test

[0143] Volume (μL) Final concentration Taq DNA Polymerase(Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× Forward primer F (10 μM) 1 200nM Reverse primer R (10 μM) 1 200nM Probe P (10 μM) 0.75 150nM Internal reference gene ACTB forward primer F (10 μM) 0.25 50nM Internal reference gene ACTB reverse primer (10 μM) 0.25 50nM Internal reference gene ACTB probe P (10 μM) 0.25 50nM BisDNA 25 / water 8.4 / Total volume 50 /

[0144] Note: “F” stands for forward primer; “R” stands for reverse primer; “P” stands for probe.

[0145] The PCR amplification program used was: 94°C, 20 min; (62°C, 35 s—read the fluorescence signal; 93°C, 30 s) 45 cycles; 40°C, 10 s.

[0146] The results are shown in Table 5 below. The detection result of the whole genome amplification product (UM) of normal human WBC cell line DNA was negative, with no amplification; while the detection result of the human genome DNA methyltransferase treatment product (M) was positive, with effective amplification.

[0147] Table 5 Primer probe test results

[0148] Summary of Ct values M UM NTC in conclusion HLX methylation level 32 45 45 Available

[0149] Example 2 Lung cancer and normal peripheral blood buffy coat (WBC) test

[0150] 16 lung cancer peripheral blood buffy coat (WBC) samples (20 ng / reaction) and 24 normal human peripheral blood buffy coat (WBC) samples (20 ng / reaction) were used as samples, genomic DNA was extracted, and after being converted into BisDNA by bisulfite, the methylation of the HLX gene was detected according to the PCR reaction system and reaction procedure in Example 1.

[0151] Finally, the Ct values ​​of real-time PCR for the target gene sequence and the reference gene sequence of 16 lung cancer and 24 normal human WBC samples were measured, and ΔCt was calculated, where ΔCt = target gene Ct - reference gene Ct. According to the PCR results, the critical value of the marker ΔCt value was selected as ≤8. The results are shown in Table 6 below. The sensitivity of the HLX methylation marker for detecting lung cancer is 81.25%, and the specificity of normal human WBC is 87.5%. Therefore, the experimental results prove that the HLX methylation marker can be used for early screening of lung cancer.

[0152] Table 6 Sensitivity of HLX gene detection in peripheral blood buffy coat (WBC) of lung cancer

[0153] Sample Type Number of samples HLX positive Lung cancer WBC 16 13 Normal human WBC 24 3 Lung cancer WBC sensitivity / 81.25％ Normal human WBC specificity / 87.5％

[0154] Example 3 Lung cancer and normal peripheral blood test

[0155] Peripheral whole blood samples (200 μL) from 25 cases of lung cancer (14 cases in stage I and 11 cases in stage II), 36 cases of benign lung diseases and 42 normal subjects were used as samples. Genomic DNA was extracted and converted into BisDNA by sulfite. The methylation of the HLX gene was detected according to the PCR reaction system and reaction procedure in Example 1.

[0156] According to the PCR results, the critical value of the marker ΔCt value was selected to be ≤8. The results are shown in Table 7 below. The sensitivity of the HLX methylation marker in detecting lung cancer was 84%, of which the sensitivity for stage I lung cancer was 78.57% and the sensitivity for stage II lung cancer was 90.91%. The methylation of the target sequence of the target gene had good specificity, and its specificity for detecting benign lung diseases was 83.33%, and its specificity for normal people was 85.71%.

[0157] Table 7 Sensitivity of HLX gene detection in peripheral whole blood of lung cancer

[0158]

[0159]

[0160] The above experimental results show that methylation of the HLX gene target sequence is a marker for lung cancer. Through the target gene target sequence methylation DNA detection of this application, non-invasive detection of lung cancer in vitro can be achieved. Compared with the large amount of peripheral blood (5-10mL) required for traditional cfDNA extraction, the blood collection volume is low (only 200μL) and no complicated plasma separation process is required, which can improve the detection rate of early lung cancer.

[0161] In summary, the present application utilizes the above-mentioned compositions, nucleic acid sequences, kits and uses thereof, as well as the above-mentioned detection methods, to detect the methylated nucleic acid sequences of the target sequences of the target genes and their fragments, thereby realizing the in vitro detection of lung cancer using the target sequence methylation biomarkers of the target genes, thereby effectively improving the sensitivity and specificity of in vitro detection of lung cancer.

[0162] The above is only the preferred embodiment of the present application, and does not limit the present application in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present application without departing from the technical solution of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A composition for detecting lung cancer, comprising: Nucleic acid used to detect the methylation status of the target gene, Wherein, the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene, Wherein, the target gene is the HLX gene.

2. The composition according to claim 1, wherein The target sequence of the HLX gene is as shown in any one of SEQ ID NOs: 1-4 or the target sequence of the HLX gene includes the sequence as shown in any one of SEQ ID NOs: 1-4.

3. The composition according to claim 1 or 2, wherein The nucleic acid used to detect the methylation status of the target gene includes: A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, The fragment comprises at least one CpG dinucleotide sequence; Preferably, the fragment of at least 9 nucleotides is the sequence of SEQ ID NO:5 and SEQ ID NO:

6.

4. The composition according to any one of claims 1 to 3, wherein The nucleic acid used to detect the methylation status of the target gene includes: A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions, The fragment comprises at least one CpG dinucleotide sequence; Preferably, the fragment of at least 15 nucleotides is the sequence of SEQ ID NO:

7.

5. The composition according to any one of claims 1 to 4, further comprising: A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

6. An oligonucleotide for detecting lung cancer, comprising: A fragment of at least 9 nucleotides in a sequence as shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

7. The oligonucleotide according to claim 6, further comprising: A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1-4 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

8. A kit comprising the composition according to any one of claims 1 to 5 or the oligonucleotide according to claim 6 or 7.

9. Use of the composition according to any one of claims 1 to 5 or the oligonucleotide according to claim 6 or 7 in the preparation of a kit for detecting lung cancer.

10. Use of HLX gene in preparing a kit for detecting lung cancer.

Images