SNP (Single Nucleotide Polymorphism) marker related to body size character of large-size small-tailed Han sheep and application of SNP marker

Abstract

The invention is applicable to the technical field of genetic breeding, and provides an SNP (Single Nucleotide Polymorphism) marker related to the body size character of a large-size small-tailed Han sheep and application of the SNP marker. The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.1, wherein r in the sequence is G or A; when r is G, the genotype is GG or GA; when r is A, the genotype is AA. By performing whole genome sequencing on common small-tailed Han sheep and large-size small-tailed sheep, 148 SNP markers closely related to the growth speed and the body size of sheep are successfully screened out. On this basis, the method is particularly directed at one of the loci (Chr6: g.40293415Agt; g), establishing a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) genetic typing method. The method provides a powerful tool for marker-assisted selection of the small-tailed Han sheep, and aims to breed a new strain which is larger in body type, faster in growth speed and higher in weight, so that the breeding process of the small-tailed Han sheep is effectively accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic breeding, and in particular relates to a SNP marker related to the body size trait of a large-bodied small-tailed Han sheep and an application thereof. Background Art

[0002] With the continuous improvement of the quality of life, people's demand for mutton products is increasing, which has promoted the sheep farming industry to focus more on the optimization of sheep's meat production performance. However, most of the existing local sheep breeds in my country are dual-purpose for meat and wool or dual-purpose for skin and meat. Although they have strong fertility and good environmental adaptability, they generally have disadvantages such as light weight and small size. At present, my country's mutton farming industry relies heavily on imports, and it is necessary to introduce high-quality commercial mutton breeds from abroad to hybridize and improve domestic local breeds. However, it is worth noting that disordered or blind hybridization may lead to a decline in the production performance of excellent traits of local sheep breeds, and even the loss of genetic resources. Therefore, it is particularly important to scientifically and efficiently tap the resources of domestic local sheep breeds and cultivate new local sheep strains with large size, fast growth rate, high weight and independent intellectual property rights.

[0003] Since body size and weight are quantitative traits, they are controlled by micro-effect polygenes and are easily affected by the natural environment and feeding conditions. In addition, compared with domestic pigs, sheep have relatively fewer litters, longer generation intervals, and more difficult to measure growth performance. Therefore, traditional breeding methods often lead to long breeding cycles and low accuracy. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by single nucleotide mutations in the genome. Because of its wide distribution in the genome, high genetic stability and convenient detection, it has become an important means of marker-assisted breeding of livestock.

[0004] Small-tailed Han sheep is a famous local sheep breed in my country. It is deeply loved by farmers for its characteristics of four-season estrus, multiple births, and tolerance to roughage, and is widely raised in many provinces and cities in China. However, there is still a significant gap between the weight and growth rate of ordinary small-tailed Han sheep and foreign commercial mutton sheep breeds. In addition, there are significant differences in growth rate and weight between individuals in the small-tailed Han sheep breed. Large-bodied small-tailed Han sheep is a new group selected from ordinary small-tailed Han sheep with significantly higher weight, height and length than ordinary individuals, providing valuable breeding materials for cultivating new strains of small-tailed Han sheep with large body size and fast growth rate. However, there is currently a lack of molecular markers related to the body size traits of large-bodied small-tailed Han sheep, which makes early individual selection and seed selection and breeding difficult. To this end, the present invention proposes SNP markers related to the body size traits of large-bodied small-tailed Han sheep and their applications. Summary of the invention

[0005] The purpose of the present invention is to provide SNP markers related to the body size traits of large-bodied small-tailed Han sheep and applications thereof, aiming to solve the problems raised in the above background technology.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The SNP markers related to the body size trait of large-bodied small-tailed Han sheep correspond to the A>G polymorphic site at position 40293415 on chromosome 6 of the sheep reference genome Oar_rambouillet_v1.0;

[0008] The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, wherein r in the sequence is G or A; when r is G, the genotype is GG or GA; when r is A, the genotype is AA.

[0009] Furthermore, the primer pair used to amplify the SNP marker includes SDL-M1-F and SDL-M1-R, and the nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0010] Furthermore, the method for detecting the SNP marker comprises the following steps:

[0011] Step 1, extracting small-tail Han sheep genomic DNA;

[0012] Step 2, using the primers to perform PCR amplification on the genomic DNA obtained in step 1 to obtain a PCR amplification product;

[0013] Step 3: Perform genotyping detection on the PCR amplification product obtained in step 2, and the genotype is AA, GG or GA.

[0014] Furthermore, the PCR amplification system includes: 10 μL of 2×PCR Master Mix, 1 μL of DNA template, 0.25 μL each of SDL-M1-F and SDL-M1-R, and 8.5 μL of ddH2O.

[0015] Furthermore, the PCR amplification conditions include: pre-denaturation at 95°C for 2 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; and extension at 72°C for 5 min.

[0016] According to the above-mentioned application of the SNP marker related to the body size trait of large-bodied and small-tailed Han sheep in molecular marker-assisted breeding related to the body size trait of large-bodied and small-tailed Han sheep.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention successfully screened out 148 SNP markers closely related to the growth rate and body size of sheep by whole genome sequencing of ordinary small-tailed Han sheep and large-sized small-tailed sheep. On this basis, a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) genotyping method was established for one of the sites (Chr6: g.40293415A>G). This method provides a powerful tool for marker-assisted selection of small-tailed Han sheep, aiming to breed new strains with larger body size, faster growth rate and higher weight, thereby effectively accelerating the breeding process of small-tailed Han sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figure shows the result of PCR amplification and electrophoresis. M: DL2000 DNA Marker; 1-10: large-bodied small-tailed Han sheep; 11-17: ordinary small-tailed Han sheep.

[0020] Figure 2 The results of restriction enzyme electrophoresis of PCR products of 17 Small Tail Han sheep are shown in Figure 2.

[0021] Figure 3 These are the sequencing peak graphs of the three genotypes: AA, GA, and GG.

[0022] Figure 4 These are the genotyping results for 40 large-bodied Small-tail Han sheep.

[0023] Figure 5 These are the genotyping results of 56 ordinary small-tailed Han sheep. DETAILED DESCRIPTION

[0024] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be construed as limiting the applicable scope of the present invention.

[0025] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0026] Embodiment 1;

[0027] (1) Selection of experimental animals;

[0028] Ten large-bodied small-tailed Han sheep and seven ordinary small-tailed Han sheep were selected to collect phenotypic data. The results are shown in Table 1:

[0029] Table 1 Comparison of phenotypic data between large-bodied small-tail Han sheep and ordinary small-tail Han sheep

[0030]

[0031]

[0032] From the data results in Table 1, it can be seen that the two groups have significant differences in five traits: weight, height, body length, chest circumference and tube circumference.

[0033] (2) Genome extraction and sequencing;

[0034] Anticoagulated blood was collected from the jugular vein of 17 small-tailed Han sheep. The EasyPureBlood Genomic DNA Kit (EasyPureBlood Genomic DNA Kit) of Beijing Quanshijin Biotechnology Co., Ltd. was used for DNA extraction. The quality of DNA was tested by agarose gel electrophoresis and UV spectrophotometer, and then used for library construction and sequencing. PE150 double-end sequencing was performed using the DNBSEQ-T7 platform. The sequencing read length was PE150, and the sequencing depth of 17 individuals was about 10×. Clean Data was filtered. The MEM algorithm of BWA (v0.7.15) software was used to align the Clean Data to the sheep reference genome (Oar_rambouillet_v1.0), and then the comparison results were sorted and marked for duplication using Picard software to obtain bam files for subsequent analysis.

[0035] (3) Screening of SNP markers related to body shape and weight;

[0036] SNPs were merged and genotyped using the GATK official website recommended process, and filtered according to the minimum allele frequency (MAF>0.1) and missing rate (geno<0.1). A total of 17586982 high-quality SNP sites were identified in the genomes of 17 small-tailed Han sheep. The vcftools software was used to calculate the population Fst of ordinary small-tailed Han sheep and large-bodied small-tailed Han sheep, and a total of 261 sites with Fst values ​​greater than 0.85 were counted. Then the sequences on both sides were taken, and BLAST analysis was performed with reference to the genome (Oar_rambouillet_v1.0 and ARS-UI_Ramb_v3.0) to exclude repetitive sequence regions or low homology sequences. Finally, 148 sites with significant differences in allele frequencies in the two populations were obtained. The site information is shown in Table 2.

[0037] Table 2 SNP loci information of significant differences in body shape and weight

[0038]

[0039]

[0040]

[0041]

[0042]

[0043] (4) Primer design, PCR amplification and sequencing;

[0044] The SNP and flanking sequence restriction sites were analyzed using online restriction site analysis software, and it was found that the 40293415A>G polymorphic site on chromosome 6 (NC_040257.1) had an Mlu I restriction site. The gene frequency of the G allele in large-bodied small-tailed Han sheep was 1, while it was 0.14 in ordinary small-tailed Han sheep, with a significant difference. A pair of primers were designed using Primer 5.0, namely SDL-M1-F (5'-CTGCCATCAGACACTTTTCATCGT-3') (as shown in SEQ ID NO.2) and SDL-M1-R (5'-TGTTGTGTTAGACAGGATCAAAGC-3') (as shown in SEQ ID NO.3). PCR amplification was performed using this pair of primers to obtain a DNA fragment (347bp) containing the SNP site:

[0045] CTGCCATCAGACACTTTTCATCGT CCGATTAAAGGCCCCAGTGTGACTTGAACTA AGTGGCCAAAATCACCAGTAAGCTTCCTACCGCTGGCTGCTAGCTGCGGTCTCCGCT CAGCAGCCCCCTCTAGGGCTGCCACGC r (G / A) TGTGGAGGCACGTGGCCAGAAGGGA AGTGGGTGGAGCCAGAGGCCAGGTTTTAAGGAGCCGCACCTGTGTGGGTGGGGGAAGGGTGGCAACACGCCTGCAAGGTCAAACGAAACAAACGAGAATTCTGGTTTGTAAGCTCCGTGGCGCTAATGGATCTTGGAGAAAATTGGGCTGCGGGGCAGCTTTGATCCTGTCTAACACAACA

[0046] Note: The r marked in the sequence is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation).

[0047] Primers were synthesized by Shanghai Bioengineering Co., Ltd. The PCR amplification reaction system was 20 μL, including: 2×PCR Master Mix 10 μL, DNA template 1 μL, forward and reverse primers 0.25 μL each, and ddH2O 8.5 μL. PCR amplification conditions: 95°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, a total of 30 cycles; 72°C extension for 5 min. PCR products were detected by 2.5% agarose gel electrophoresis, and the results showed that the 17 individuals successfully amplified the 347 bp target fragment (such as Figure 1 shown).

[0048] (5) Enzyme digestion and genotype determination;

[0049] Mlu I endonuclease was used for genotyping. The enzyme digestion system was 10 μL, including: 10×buffer 1 μL, ddH2O4.5 μL, Mlu I 0.5 μL, and PCR product 4 μL. The digestion was carried out at 37°C for 3 hours. The digestion products were detected by 2.5% agarose gel electrophoresis, and the genotype of the individual could be determined based on the electrophoresis bands. When the allele is G, the amplified fragment can be cut into two fragments of 137 and 210 bp by Mlu I endonuclease. When the allele is A, the amplified fragment cannot be cut. Therefore, in agarose gel electrophoresis, GG homozygotes will produce two bands of 137 and 210 bp, GA heterozygotes will produce three bands of 347, 210 and 137 bp, and AA homozygotes will only have one band of 347 bp.

[0050] The genotypes of 10 large-bodied small-tailed Han sheep and 7 ordinary small-tailed Han sheep were determined: the results showed (such as Figure 2 As shown in the figure, all the 10 large-sized small-tail Han sheep were of AA genotype; while among the 7 ordinary small-tail Han sheep, 2 were of GA genotype and the remaining 5 were of GG genotype.

[0051] The PCR products of three genotypes (AA, GA, GG) were selected for first-generation sequencing. Figure 3 As shown, it can be seen that there are three genotypes: AA, GA, and GG, indicating that the DNA sequence of the SNP site is consistent with expectations.

[0052] (6) Population genotype analysis;

[0053] The PCR-RFLP detection method was used to perform genotyping on 40 large-bodied small-tailed Han sheep and 56 ordinary small-tailed Han sheep. Figure 4 As shown in the figure, among the 40 large-bodied small-tailed Han sheep, there are only two genotypes, AA and GA, of which 32 and 8 are AA and GA, respectively, and the frequencies of A and G alleles are 0.9 and 0.1, respectively. Figure 5As shown in the figure, in the 56 ordinary small-tailed Han sheep population, there are only two genotypes, GA and GG, of which GA and GG genotypes are 5 and 51, respectively, and the frequencies of A and G alleles are 0.04 and 0.96, respectively. This shows that the dominant allele in large-bodied small-tailed Han sheep is A, while the dominant allele in ordinary small-tailed Han sheep is G. Therefore, this locus can be used in molecular marker-assisted breeding of large-bodied small-tailed Han sheep.

[0054] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A SNP marker associated with the body size trait of large-bodied small-tailed Han sheep, characterized in that: Its SNP site corresponds to the A>G polymorphic site 40293415 on chromosome 6 of the sheep reference genome Oar_rambouillet_v1.0; The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, wherein r in the sequence is G or A; when r is G, the genotype is GG or GA; when r is A, the genotype is AA.

2. The SNP marker associated with the body size trait of large-bodied small-tailed Han sheep according to claim 1, characterized in that: The primer pair used to amplify the SNP marker includes SDL-M1-F and SDL-M1-R, and the nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.

3. The SNP marker associated with the body size trait of large-bodied small-tailed Han sheep according to claim 2, characterized in that: The method for detecting the SNP marker comprises the following steps: Step 1, extracting small-tail Han sheep genomic DNA; Step 2, using the primers to perform PCR amplification on the genomic DNA obtained in step 1 to obtain a PCR amplification product; Step 3: Perform genotyping detection on the PCR amplification product obtained in step 2, and the genotype is AA, GG or GA.

4. The SNP marker associated with the body size trait of large-bodied small-tailed Han sheep according to claim 3, characterized in that: The PCR amplification system includes: 10 μL of 2×PCR Master Mix, 1 μL of DNA template, 0.25 μL each of SDL-M1-F and SDL-M1-R, and 8.5 μL of ddH2O.

5. The SNP marker associated with the body size trait of large-bodied small-tailed Han sheep according to claim 3, characterized in that: The PCR amplification conditions include: pre-denaturation at 95° C. for 2 min; denaturation at 94° C. for 30 s, annealing at 60° C. for 30 s, and extension at 72° C. for 30 s, for a total of 30 cycles; and extension at 72° C. for 5 min.

6. Use of the SNP marker associated with the body size trait of large-bodied, small-tailed Han sheep according to any one of claims 1 to 5 in molecular marker-assisted breeding associated with the body size trait of large-bodied, small-tailed Han sheep.

Images