Method for rapidly screening herbicide-resistant rice germplasm, CAPS molecular marker and application thereof

Abstract

The invention relates to the technical field of rice screening molecular markers, in particular to a method for rapidly screening herbicide-resistant rice germplasm, a CAPS molecular marker and application of the CAPS molecular marker. The method comprises the following steps: extracting genome DNA of a rice germplasm plant to be detected; the method comprises the following steps: by taking genome DNA as a template, carrying out PCR (Polymerase Chain Reaction) and enzyme digestion by utilizing primers, detecting whether bands of 89bp, 171bp and 260bp are contained or not, when only the band of 260bp is contained, the corresponding rice germplasm to be detected is non-herbicide-resistant rice, and when the two bands of 89bp and 171bp are contained, the corresponding rice germplasm to be detected is herbicide-resistant rice; the rice herbicide resistance is identified and predicted by detecting the genotype through detecting the CAPS molecular marker, the adverse effect of environmental factors on phenotype identification is avoided, the PCR amplification is stable, and the detection accuracy is greatly improved.

Description

Technical Field

[0001] The invention relates to the technical field of rice screening molecular markers, and in particular to a method for rapidly screening herbicide-resistant rice germplasm, a CAPS molecular marker and an application thereof. Background Art

[0002] Weed infestation has always been a major limiting factor in rice production. Weeds coexist with rice, competing with rice for light, water and nutrients, and are one of the important factors affecting rice yield and quality. Manual weeding is time-consuming, labor-intensive and costly. In addition, with the intensive development of agricultural production, simplified rice farming methods such as no-tillage, seedling broadcasting and direct seeding technology are being promoted, and the weed problem is particularly prominent. Therefore, it poses a more severe challenge to weed control in rice fields.

[0003] Herbicides play an important role in agricultural production because they are relatively low-cost, highly efficient, and can successfully kill 99% of target weeds. Therefore, chemical pesticide control is still the most economical and effective way to control weeds in the field. The use of herbicides can also seriously harm the growth of rice and cause the death of rice plants, which not only greatly limits the time and space for the use of herbicides, but also poses a potential threat to rice production.

[0004] Therefore, it is urgent to cultivate herbicide-resistant rice varieties. Identifying herbicide resistance in rice and screening herbicide-resistant germplasm resources are the premise and key to herbicide-resistant rice breeding. However, the lack of herbicide-resistant germplasm resources and genes / locus has led to very few molecular markers that can effectively distinguish rice herbicide resistance.

[0005] Cleave amplified polymorphic sequences (CAPS) markers are molecular markers developed using single nucleotide polymorphisms (SNPs) on the genome. By combining PCR amplification, enzyme digestion reaction and electrophoresis typing, they can be used in plant genetic analysis, phenotypic identification and variety selection, etc. They have the advantages of strong co-dominance, high specificity, economical and simple, efficient and accurate. Therefore, it is of great significance to develop molecular markers that are easy to detect, identify rice herbicide resistance and select herbicide-resistant varieties. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a method for rapid screening of herbicide-resistant rice germplasm, CAPS molecular markers and their applications. The present invention detects genotypes by detecting CAPS molecular markers, identifies and predicts rice herbicide resistance, avoids the adverse effects of environmental factors on phenotypic identification, and the PCR amplification of the present invention is stable, and the detection accuracy is greatly improved.

[0007] To this end, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides, in an optional embodiment, a method for rapidly screening herbicide-resistant rice germplasm, comprising the following steps:

[0009] S1: Extract genomic DNA from the rice germplasm plants to be tested;

[0010] S2: using the genomic DNA as a template and using primers to perform PCR amplification to obtain a PCR product;

[0011] S3: digesting the PCR product to obtain a digestion product;

[0012] S4: Detecting whether the enzyme cleavage product contains bands of 89 bp, 171 bp and 260 bp; when the enzyme cleavage product contains only a band of 260 bp, the corresponding rice germplasm to be tested is non-herbicide-resistant rice; and when the enzyme cleavage product contains two bands of 89 bp and 171 bp, the corresponding rice germplasm to be tested is herbicide-resistant rice;

[0013] Wherein, the primers include an upstream primer and a downstream primer;

[0014] The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1;

[0015] The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.2.

[0016] Preferably, in step S2, the reaction system for PCR amplification is: 1 μL of genomic DNA template, 1 μL of upstream primer and 1 μL of downstream primer, 10 μL of 2×Phanta Mix Master Mix, and 7 μL of ddH2O.

[0017] Preferably, in step S2, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

[0018] Preferably, in step S3, the enzyme digestion reaction system is: 6 μL of PCR product, 0.3 μL of endonuclease, 1.5 μL of 10×Buffer, 7.2 μL of ddH2O; and / or,

[0019] The reaction conditions of the enzyme digestion are: digestion at 37° C. for 2 hours.

[0020] Preferably, in step S3, the endonuclease used for the enzymatic cleavage is Pst I.

[0021] Preferably, in step S4, the enzyme digestion product is detected to see whether it contains bands of 89 bp, 171 bp and 260 bp: typing is performed by 2% agarose gel electrophoresis.

[0022] In the present invention, ddH2O refers to double distilled water.

[0023] Preferably, the herbicide is an acetyl-CoA carboxylase herbicide.

[0024] In a second aspect, the present invention provides a CAPS molecular marker for rapid screening of herbicide-resistant rice in an optional embodiment, comprising a SNP site at position 6114 of the nucleotide sequence shown in SEQ ID NO.3, in which the base mutates to C, and a primer corresponding to the SNP site;

[0025] The primers include an upstream primer and a downstream primer;

[0026] The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1;

[0027] The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.2.

[0028] In a third aspect, the present invention provides, in an optional embodiment, a CAPS kit for rapid screening of herbicide-resistant rice, comprising the above-mentioned primers.

[0029] Preferably, the kit further comprises 2×Phanta Mix Master Mix, ddH2O, Pst I endonuclease, 10×Buffer and agarose gel electrophoresis.

[0030] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0031] AAACTATCCCTGCTGACCCTG.

[0032] The nucleotide sequence of SEQ ID NO.2 is as follows:

[0033] ATGGGAATGTAGACAAAGGCAG.

[0034] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0035]

[0036] Compared with the prior art, the present invention has one of the following beneficial effects:

[0037] 1. The present invention detects genotypes by detecting molecular markers, identifies and predicts rice herbicide resistance, avoids the adverse effects of environmental factors on phenotypic identification, and the PCR amplification of the present invention is stable, and the detection accuracy is greatly improved.

[0038] 2. The screening method provided by the present invention has a simple procedure, simple and easy operation steps, and can be carried out from the rice seedling stage to the mature plant stage. It is not restricted by seasons and weather, and is convenient for wide use by different units.

[0039] 3. The screening method provided by the present invention can complete the entire process from sampling to electrophoresis typing within 1-2 days, saving a lot of manpower and material resources and significantly improving efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The figure is a schematic diagram of the SNP sites and restriction endonuclease recognition site sequences of the herbicide-sensitive rice and herbicide-resistant rice materials in Example 1 of the present invention, wherein S represents the herbicide-sensitive rice and R represents the herbicide-resistant rice;

[0041] Figure 2 This is a phenotype diagram of the tested rice materials in Example 2 of the present invention after being sprayed with 8 times the field concentration of Gai Cao Neng, wherein No. 1 and No. 2 are herbicide-sensitive rice, and No. 3 and No. 4 are herbicide-resistant rice materials obtained by gene editing technology using 1 and 2 as backgrounds respectively;

[0042] Figure 3 It is an agarose gel electrophoresis diagram of the PCR amplification products and Pst I digestion products of the four rice materials in Example 2 of the present invention using CAPS labeled primers, M is Trans 2K Plus DNA Marker, and from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp, respectively. 1-4 represent four rice materials, among which No. 1 and No. 2 are herbicide-sensitive rice, and No. 3 and No. 4 are herbicide-resistant rice materials obtained by gene editing technology with 1 and 2 as background, respectively. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] This embodiment provides a method for designing CAPS molecular markers for rapid screening of herbicide-resistant rice, comprising the following steps:

[0047] (1) When a G at position 6114 of the rice herbicide resistance target gene ACC1 mutates to a C, rice can develop resistance to herbicides. The results are shown in Figure 1 ;

[0048] (2) Using the guide editing technique, the herbicide-sensitive rice NIP and NJ9108 were used as receptors to edit the G at position 6114 of ACC1 to C. The two herbicide-resistant rice materials obtained showed resistance to 12 times the field concentration of grass. The results are shown in Figure 2 ;

[0049] (3) Use the online enzyme recognition software dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html) to analyze the restriction endonuclease information caused by the SNP site mutation selected in step (1), and select a suitable endonuclease Pst I, whose enzyme recognition sequence is C↓TGCAG (↓ indicates the enzyme cutting site).

[0050] In herbicide-resistant rice, the base G at position 6114 in the ACC1 forward sequence mutated to C, forming a recognition site for Pst I, located at positions 6111 to 6116 ( Figure 1 );

[0051] (4) The designed CAPS marker of the SNP site was named CAPs-W2125C-Pst I molecular marker, and the primer sequences were designed as follows:

[0052] Upstream primer: The nucleotide sequence from the 5' end to the 3' end is shown in SEQ ID NO.1, SEQ ID NO.1 is A

[0053] AACTATCCCTGCTGACCCTG;

[0054] Downstream primer: The nucleotide sequence from the 5' end to the 3' end is shown in SEQ ID NO.2, and SEQ ID NO.2 is ATGGGAATGTAGACAAAGGCAG.

[0055] Example 2

[0056] This embodiment provides a method for rapidly screening herbicide-resistant rice germplasm, comprising the following steps:

[0057] S1: Extract genomic DNA from two herbicide-sensitive rice plants (NIP and NJ9108) and two herbicide-resistant rice plants (herbicide-resistant rice materials obtained by gene editing technology with NIP and NJ9108 as the background);

[0058] S2: The primers in Example 1 were used to amplify the DNA of herbicide-sensitive rice and herbicide-resistant rice plants, and 260 bp amplification products were obtained, indicating that the designed primers have high specificity, see Figure 1 Left;

[0059] The above PCR reaction was a 20 μL system, specifically: 1 μL of genomic DNA template, 1 μL of upstream and downstream primers, 10 μL of 2×PhantaMix Master Mix, and 7 μL of ddH2O.

[0060] The PCR amplification program of the above PCR reaction was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min;

[0061] S3: Perform Pst I restriction enzyme digestion reaction on the PCR product obtained in step S2.

[0062] The above enzyme digestion reaction is a 15 μL system, specifically: 6 μL of PCR product, 0.3 μL of Pst I restriction endonuclease, 1.5 μL of 10× Buffer, and 7.2 μL of ddH2O. The digestion is carried out at 37°C for 2 hours to obtain the digestion product;

[0063] S4: Perform 2% agarose gel electrophoresis typing test on the enzyme cleavage product obtained in step S3. If the enzyme cleavage product contains only one 260 bp fragment, the material to be tested is non-herbicide-resistant rice; if the enzyme cleavage product contains two bands of 89 bp and 171 bp, the material to be tested is herbicide-resistant rice. The results are shown in Figure 3 The identification results of this method were consistent with the herbicide resistance phenotype of rice.

[0064] In summary, this marker can be used to identify herbicide resistance in rice and has great application value.

[0065] Although the principles of the present invention are described in detail above in conjunction with the preferred embodiments of the present invention, those skilled in the art should understand that the above embodiments are merely explanations of the exemplary implementations of the present invention, and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute limitations on the scope of the present invention, and any obvious changes such as equivalent transformations, simple replacements, etc. based on the technical solution of the present invention, without departing from the spirit and scope of the present invention, fall within the protection scope of the present invention.

Claims

1. A method for rapid screening of herbicide-resistant rice germplasm, characterized in that: The following steps are involved: S1: Extract genomic DNA from the rice germplasm plants to be tested; S2: using the genomic DNA as a template and using primers to perform PCR amplification to obtain a PCR product; S3: digesting the PCR product to obtain a digestion product; S4: Detecting whether the enzyme cleavage product contains bands of 89 bp, 171 bp and 260 bp; when the enzyme cleavage product contains only a band of 260 bp, the corresponding rice germplasm to be tested is non-herbicide-resistant rice; and when the enzyme cleavage product contains two bands of 89 bp and 171 bp, the corresponding rice germplasm to be tested is herbicide-resistant rice; Wherein, the primers include an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1; The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.

2.

2. The method for rapid screening of herbicide-resistant rice germplasm according to claim 1, characterized in that: In step S2, the reaction system of the PCR amplification is: 1 μL of genomic DNA template, 1 μL of upstream primer and 1 μL of downstream primer, 10 μL of 2×PhantaMix MasterMix, and 7 μL of ddH2O.

3. The method for rapid screening of herbicide-resistant rice germplasm according to claim 1, characterized in that: In step S2, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

4. The method for rapid screening of herbicide-resistant rice germplasm according to claim 1, characterized in that: In step S3, the enzyme digestion reaction system is: 6 μL of PCR product, 0.3 μL of endonuclease, 1.5 μL of 10×Buffer, 7.2 μL of ddH2O; and / or, The reaction conditions of the enzyme digestion are: digestion at 37° C. for 2 hours.

5. The method for rapid screening of herbicide-resistant rice germplasm according to claim 1, characterized in that: In step S3, the enzyme cleavage adopts the endonuclease PstI.

6. The method for rapid screening of herbicide-resistant rice germplasm according to claim 1, characterized in that: In step S4, the enzyme digestion product is detected to see whether it contains bands of 89 bp, 171 bp and 260 bp: typing is performed by 2% agarose gel electrophoresis.

7. The method for rapid screening of herbicide-resistant rice germplasm according to claim 1, characterized in that: The herbicide is an acetyl-CoA carboxylase herbicide.

8. A CAPS molecular marker for rapid screening of herbicide-resistant rice, characterized in that: It includes a SNP site at position 6114 of the nucleotide sequence shown in SEQ ID NO.3, in which the base is mutated to C, and a primer corresponding to the SNP site; The primers include an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1; The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.

2.

9. A CAPS kit for rapid screening of herbicide-resistant rice, characterized in that: Comprising the primers described in claim 7.

10. The CAPS kit for rapid screening of herbicide-resistant rice according to claim 9, characterized in that: The kit also includes 2×Phanta Mix Master Mix, ddH2O, Pst I endonuclease, 10×Buffer and agarose gel electrophoresis.

Images