KASP molecular marker related to identification of cellulose content of larch and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to identification of the cellulose content of larch and application of the KASP molecular marker, the KASP molecular marker is designed according to an SNP site of a larch genome, the SNP site has A / T base mutation, A: A and T: T genotypes are genotypes with low cellulose content, and A: T genotypes are genotypes with high cellulose content. The invention also discloses a primer for detecting the KASP molecular marker and a method for identifying the cellulose content of larch by using the primer, and also discloses application of a reagent, the primer or the method for detecting the molecular marker in identifying the cellulose content of larch in a seedling stage and in larch molecular marker-assisted breeding. The primer disclosed by the invention can be used for rapidly identifying the cellulose content of larch, has the advantages of accuracy, rapidness, low cost, short identification period, simplicity and convenience in operation and the like, can be used for assisting the breeding of excellent strains of larch, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of forest tree molecular marker assisted breeding, and specifically relates to a KASP molecular marker related to identifying larch cellulose content and an application thereof. Background Art

[0002] Larix olgensis belongs to the genus Larix (Pinaceae), and has the characteristics of strong adaptability, rapid growth in early stage, fast forestation, few diseases and pests, and excellent material. Therefore, developing molecular markers closely linked to the cellulose content and using molecular markers to assist in the selection of cellulose content in larch will effectively save breeding time and land, speed up the breeding process, and have important practical significance for the selection and promotion of larch varieties. KASP (Kompetitive Allele-Specific PCR), that is, competitive allele-specific PCR, has the advantages of high throughput, low cost, high efficiency, and no need for electrophoresis detection compared with traditional PCR methods. Summary of the invention

[0003] The first object of the present invention is to provide a KASP molecular marker which is closely linked to the cellulose content of larch and a primer for detecting the KASP molecular marker.

[0004] The present invention also aims to provide a method for identifying the cellulose content of larch.

[0005] The last object of the present invention is to provide a reagent, primer or method for detecting the above KASP molecular marker and its application in identifying the high and low cellulose content phenotype of larch and its application in molecular marker-assisted breeding of larch.

[0006] The above-mentioned first object of the present invention can be achieved by the following technical scheme: a KASP molecular marker (nucleotide sequence is shown in SEQ ID NO.4) that is tightly linked to the high or low cellulose content of larch, the KASP molecular marker is designed based on a SNP site on the larch genome, the SNP site has an A / T base mutation, and the corresponding genotypes include A:A, A:T and T:T, wherein the T:T and A:A genotypes show genotypes with low cellulose content, and the A:T genotype shows a genotype with high cellulose content, and the KASP molecular marker can be obtained by amplification of primers shown in SEQ ID NO.1 to SEQ ID NO.3 respectively.

[0007] The nucleotide sequence of the KASP molecular marker is as follows:

[0008] TCGCTTTCACTTAAACTCACTCTGGAGTAGATTTTGTGGACATCTGAAAGGTAG ATAACTCCTCTTGCTCCACACATACAAACCTTTCCTTGACAAGTTCCATAAAAAAAG GCCCAAGGTTGTGACTTATCTACCTCCAATGGTTTGATC(A / T)TTCTTGGTTTTTTTGG TATTGGCACTCTCTTGATTCCATCAAATAAAAAAATATTATGTTGAAATTGGAATGGT GGAGAAAGCTTACCTTCAAATATGCTTGCATTTGTTGTCTGACACTATTAAGGAAACCACTCTAAACTACTTGGGT.

[0009] A SNP site of the present invention is heterozygous when the cellulose content is high, and is homozygous when the cellulose content is low.

[0010] The present invention also provides a set of primers for detecting KASP molecular markers that are closely linked to the high or low cellulose content of larch. The set of primers includes two specific upstream primers sca3332:283854-F1 and sca3332:283854-F2 and a universal downstream primer sca3332:283854-R, wherein the nucleotide sequence of the upstream primer sca3332:283854-F1 is as shown in SEQ ID NO.1, the nucleotide sequence of the upstream primer sca3332:283854-F2 is as shown in SEQ ID NO.2, the nucleotide sequence of the downstream primer sca3332:283854-R is as shown in SEQ ID NO.3, a FAM fluorescent label sequence is added to the 5' end of the upstream primer sca3332:283854-F1, and a VIC fluorescent label sequence is added to the 5' end of the upstream primer sca3332:283854-F2.

[0011] After the PCR products of the present invention are subjected to fluorescence detection, typing detection is performed on the PCR amplification products and the results are presented in the form of a chart; the chart is divided into an X-axis and a Y-axis, each data point represents an independent DNA sample, and samples of the same genotype are clustered together, wherein the genotype is T:T type, the fluorescent signal is blue, and the material is gathered near the Y-axis, and is determined to be a homozygous material with a low cellulose content; the genotype is A:T type, the fluorescent signal is green, and is gathered near the middle position, and is determined to be a heterozygous material with a high cellulose content; the genotype is A:A, the fluorescent signal is red, and is gathered near the X-axis, and is determined to be a homozygous material with a low cellulose content.

[0012] The last object of the present invention can be achieved by the following technical solution: use of a reagent for detecting the KASP molecular marker in identifying the high and low cellulose content phenotypes of larch.

[0013] The present invention has the following advantages:

[0014] The KASP molecular marker primers in the present invention can quickly identify the phenotype of larch with high cellulose content, and have the advantages of accuracy, rapidity, low cost, short identification cycle, simple operation, etc., can assist in the breeding of new larch strains, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the genotyping diagram of the larch population using the KASP molecular marker primer sca3332:283854 in Example 2. The genotype is T:T type, the fluorescent signal is blue, and the material is concentrated near the Y axis, which is determined to be a homozygous material with a low cellulose content; the genotype is A:T type, the fluorescent signal is green, and it is concentrated near the middle position, which is determined to be a heterozygous material with a high cellulose content; the genotype is A:A The fluorescent signal is red and concentrated near the X axis, which is determined to be a homozygous material with a low cellulose content. DETAILED DESCRIPTION

[0016] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed by the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify them according to the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0017] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0018] Example 1

[0019] In this example, 310 hybrid larch plants from 39 populations were used as materials to construct a gene pool, and RAD-seq was performed to obtain SNP sites for genome-wide association analysis of cellulose content traits, and the SNP site sca3332:283854 that was closely linked to the high and low cellulose content traits of larch was determined (as shown in Table 1).

[0020] According to the SNP site information, PrimerPicker Lite for KASPar Version 0.26 (https: / / www.biosearchtech.com / ) was used to develop KASP markers. One marker contains three primers, of which the two upstream primers sca3332:283854-F1 and sca3332:283854-F2 are specific primers designed according to the SNP site sca3332:283854, and the downstream primer sca3332:283854-R is a universal primer; the 3' end of the upstream primer is a variant base, and the 5' end is connected to the carboxyfluorescein FAM (GAAGGTGACCAAGTTCATGCT) and phosphoramidite fluorescein VIC (GAAGGTCGGAGTCAACGGATT) fluorescent signal tag sequences, respectively. The three primer sequences are as follows:

[0021] 1)sca3332:283854-F1:

[0022] 5'-GAAGGTGACCAAGTTCATGCTTTTCAGATCTGTTTGATCTTTATAAGGAC-3' (SEQ ID NO. 1), the underlined part is the sequence of fluorescein FAM.

[0023] 2)sca3332:283854-F2:

[0024] 5'-GAAGGTCGGAGTCAACGGATTACTTATCTACCTCCAATGGTTTGATCT-3' (SEQ ID NO. 2), the underlined portion is the sequence of fluorescein VIC.

[0025] 3)sca3332:283854-R:

[0026] 5'-TTCTCCACCATTCCAATTTCAACAT-3' (SEQ ID NO. 3).

[0027] The primers can also be developed into a kit for use.

[0028] Example 2

[0029] The PCR amplification of larch single plants using the above-mentioned labeled primers and the detection of PCR products include the following steps:

[0030] (1) Larch DNA extraction

[0031] The experimental material is fresh leaves of a single larch plant, and the steps for extracting genomic DNA are as follows:

[0032] ① Take a small amount of fresh leaves and put them into a 2mL centrifuge tube, add steel balls, grind them on a grinder, shake 30 times per second for 2 minutes, add 800μL of 2% CTAB extract, mix well, and place in a 65℃ water bath for 1h (shake well every 10 minutes);

[0033] ② After standing to room temperature, add 800 μL of chloroform: isoamyl alcohol (volume ratio 24:1), mix gently for 10 minutes, and then centrifuge at 12000 rpm for 15 minutes. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube;

[0034] ③ Add 2 / 3 volume of isopropanol to the supernatant, mix gently and place at -20℃ for 30min~1h;

[0035] ④12000rmp, centrifuge for 10min, discard the supernatant;

[0036] ⑤ Add anhydrous ethanol to the centrifuge tube to wash the DNA precipitate once, then wash it once with 75% (volume percentage) ethanol, and blow dry it on the clean bench;

[0037] ⑥ Add 50 μL TE (or ddH2O) to dissolve and use as larch genomic DNA.

[0038] (2) Using larch genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primers in Example 1.

[0039] PCR amplification was performed in a CFX fluorescence quantifier from BIO-RAD. The 5 μL reaction system included: 1.25 μL of genomic DNA at a concentration of 100 ng / μL, 2.5 μL of HiGeno2×ProbeMixA, 0.25 μL of each upstream primer at a concentration of 10 mM, and 0.75 μL of a downstream primer at a concentration of 10 mM.

[0040] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 61-55°C for 1 min, with the annealing temperature decreasing by 0.6°C per cycle for a total of 10 cycles, followed by denaturation at 95°C for 20 s and extension at 55°C for 1 min. After 27 cycles, the fluorescence signal was read at 25°C for 1 min.

[0041] (3) Amplification results:

[0042] The primers of Example 1 are used for PCR amplification, and the amplified products are subjected to fluorescence detection. The fluorescence signal is combined with the label information to complete the genotyping and present it in the form of a chart; Figure 1 As shown, the figure is divided into X and Y axes, each data point represents an independent DNA sample, and samples with the same genotype are clustered together.

[0043] like Figure 1 After the PCR products were read by fluorescence, there was one genotype with high cellulose content, and the fluorescence signal of the genotype "A:T" was green and concentrated near the middle position. There were two genotypes with low cellulose content, of which the fluorescence signal of the genotype "A:A" was red and concentrated near the X-axis, and the fluorescence signal of the genotype "T:T" was blue and concentrated near the Y-axis.

[0044] The results showed that when the cellulose content of larch was assisted in selection, the high cellulose content phenotype of the individual plants in the population was consistent with the band pattern amplified by the primers of the molecular marker. This example uses KASP molecular markers to achieve assisted breeding of larch based on the screening of cellulose content of larch.

[0045] Table 1 Gene location results of SNP site sca3332:283854

[0046] CHROM POS REF ALT sca3332 283854 A T

Claims

1. An application of KASP molecular markers related to identification of larch cellulose content, characterized in that The molecular marker is used to assist larch breeding; the KASP molecular marker has an A / T base mutation at position 283854 of chromosome sca3332:283854; the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.

4.

2. The use according to claim 1, characterized in that The auxiliary larch breeding is achieved by screening larch based on the larch cellulose content.

3. The use according to claim 1, characterized in that The A / T base mutation corresponds to genotypes including A:A, A:T and T:T, wherein the A:T genotype is a genotype with a high cellulose content, and the A:A and T:T genotypes are genotypes with a low cellulose content.

4. The use according to claim 1 or 2, characterized in that The auxiliary larch breeding is to select high-quality larch based on the larch cellulose content, and the specific method is as follows: 1) Obtaining DNA of larch to be tested; 2) Using primers to perform fluorescence quantitative PCR amplification; 3) Genotyping of PCR products after fluorescence detection: blue fluorescence signals are recorded as T:T genotype; green fluorescence signals are recorded as A:T genotype; red fluorescence signals are recorded as A:A genotype; 4) The A:A and T:T genotypes showed low cellulose content, while the A:T genotype showed high cellulose content.

5. The use according to claim 4, characterized in that The primers used for fluorescence quantitative PCR amplification are as follows: sca3332:283854-F1: 5’- GAAGGTGACCAAGTTCATGCT TTTCAGATCTGTTTGATCTTTATAAGGAC-3’; sca3332:283854-F2: 5’- GAAGGTCGGAGTCAACGGATT ACTTATCTACCTCCAATGGTTTGATCT-3’; sca3332:283854-R: 5'-TTCTCCACCATTCCAATTTCAACAT-3'.

6. A primer for detecting KASP molecular markers related to larch cellulose content, characterized in that The primer sequences are sca3332:283854-F1, sca3332:283854-F2 and sca3332:283854-R; the nucleotide sequence of sca3332:283854-F1 is shown in SEQ ID NO.1, the nucleotide sequence of sca3332:283854-F2 is shown in SEQ ID NO.2, and the nucleotide sequence of sca3332:283854-R is shown in SEQ ID NO.

3.

7. A kit comprising the primers according to claim 6.

Images