SSR (Simple Sequence Repeat) primer and method for identifying purity of Chinese cabbage seeds for Cuiya seedling

Abstract

The invention provides an SSR primer and a method for identifying the purity of Chinese cabbage seeds for Xiai seedlings, relates to the field of hybrid seed purity identification, and aims at identifying the purity of the hybrid seeds by screening and using primers which can simultaneously show specific bands of male parents and female parents in Chinese cabbage hybrids for Xiai seedlings and have relatively strong specificity. The method can solve the problems that in the prior art, morphological identification is always adopted for identifying the seed purity, the influence of factors such as external environment, planting season, planting technology and experience is large, the workload is large, the period is long and the like, so that the seed purity of the Chinese cabbage hybrid for the Xiaoqiu seedling can be rapidly and accurately identified within one or two hours; the method has the advantages of rapidness, stability, simplicity in operation, low cost, no environmental influence and the like, can be used for efficiently detecting the seed purity of the Chinese cabbage hybrid for the Xiaoqiu seedling, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the field of hybrid seed purity identification, and in particular to an SSR primer and method for identifying the purity of Chinese cabbage seeds for small green seedlings. Background Art

[0002] Seedling Chinese cabbage (Brassica chinensis L.), also known as non-heading cabbage, is native to my country and is widely cultivated in the Yangtze River Basin of my country. It is a leaf vegetable of the genus Brassica in the family Cruciferae. Seedling Chinese cabbage has the characteristics of low production cost, simple planting and management, good flavor, high nutritional and medicinal value, and has gradually become one of the important economic vegetables in my country. Seedling Chinese cabbage likes cool weather. It is mainly cultivated in autumn and winter in southern regions, and mainly in summer and autumn in cold regions. With the development and progress of agricultural production technology, more and more high-quality, high-yield and disease-resistant seedling Chinese cabbage varieties are pouring into the market.

[0003] The breeding of Chinese cabbage for seedlings is mainly based on hybrid breeding, and self-incompatibility lines are mostly used for seed production. Therefore, in the seed production process, due to various factors such as low self-incompatibility, pollen mixing, incomplete removal of foreign plants, and insufficient seed production distance, false hybrids will appear in the harvested seeds, resulting in a decrease in seed purity, causing huge economic losses in production and sales. The traditional seed purity identification method is based on field morphological identification after sowing, and directly observes the characteristics and consistency of crops at specific growth and development stages for judgment. It has a long cycle, is labor-intensive and time-consuming, and is easily affected by environmental and seasonal factors, making it difficult to meet the needs of rapid identification in the production process.

[0004] Xiaocui Chinese cabbage for seedlings is a new hybrid first-generation Chinese cabbage variety independently cultivated by Wuxi Puwei Agricultural Technology Co., Ltd. It has a fast growth rate, an upright and compact plant shape, early maturity, and can be harvested in 20 to 25 days at a suitable temperature. The leaves are thick, the outer leaves are dark green, the petioles are light green, the leaves are hairless, and the inner leaves are light green. It has high yield, excellent commercial quality, and strong heat and moisture resistance. In order to cultivate high-quality Xiaocui Chinese cabbage for seedlings, it is necessary to identify the seed purity of Xiaocui Chinese cabbage for seedlings. Seed purity is an important indicator for the quality evaluation of Xiaocui Chinese cabbage seeds. Rapid and accurate identification of seed purity is extremely important for production and sales. This variety has always used morphological identification of seed purity. With the increase in sowing area and seed demand, it is urgent to explore a purity identification method that is fast, accurate, and not easily affected by external factors. Summary of the invention

[0005] In response to the above-mentioned problems, the present invention provides an SSR primer and method for identifying the seed purity of Chinese cabbage for small green seedlings, which can solve the problems that the prior art has always used morphological identification of seed purity, which is greatly affected by factors such as the external environment, planting season, planting technology and experience, and has a large workload and a long cycle. Therefore, the seed purity of Chinese cabbage hybrids for small green seedlings can be quickly and accurately identified within one or two hours, and has broad application prospects.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The present invention provides an SSR primer for identifying the purity of Chinese cabbage seeds for small green seedlings, comprising an upstream primer Rapa150-F and a downstream primer Rapa150-R, wherein:

[0008] The upstream primer Rapa150-F is: GATGTGCAAGCAAGGATTGA;

[0009] The downstream primer Rapa150-R is: GTCACAACAACGTGTGGCTT.

[0010] The present invention provides a method for identifying the purity of Chinese cabbage seeds for small green seedlings, comprising:

[0011] (1) Extracting genomic DNA from the parents and hybrid F1 of the Chinese cabbage sample to be tested;

[0012] (2) using the SSR primers described in claim 1 to perform PCR amplification on the genomic DNA of the Chinese cabbage parents and the hybrid F1 used in step (1);

[0013] (3) using 8% polyacrylamide gel to separate the PCR amplification product of step (2) by electrophoresis and silver staining;

[0014] (4) Statistical results, calculate the purity of hybrid Chinese cabbage for Xiaocuimiao seedlings, seed purity (%) = (total number of tested seeds - number of non-hybrid seeds - number of foreign hybrids) / total number of tested seeds × 100%;

[0015] The step (2) uses a 10 μl PCR reaction system: 5 μl 2×Taq Master Mix, 0.5 μl each of the 10 μM upstream primer Rapa150-F and the downstream primer Rapa150-R, 1.5 μl genomic DNA, and 2.5 μl of Tris-HCl at pH=8.0 and 0.1 μM;

[0016] The PCR reaction procedure uses Touch-down, which has six stages:

[0017] Stage 1: pre-denaturation at 95°C for 5 min;

[0018] The second stage: denaturation at 94°C for 45 seconds; annealing at 68-58°C for 6 cycles, decreasing by 2°C in each cycle, 1 min each time; extension at 72°C for 1 min;

[0019] The third stage: denaturation at 94℃ for 30S; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ each cycle, 1min each time; extension at 72℃ for 1min;

[0020] The fourth stage: denaturation at 94°C for 30 seconds; annealing at 50°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated 20 times;

[0021] Stage 5: extension at 72°C for 7 min;

[0022] Stage 6: Keep warm at 4°C.

[0023] The method for identifying the purity of Chinese cabbage seeds for small green seedlings provided by the present invention is preferably as follows: taking 3mm 2 Place the cotyledons in a 2 ml centrifuge tube; add a steel ball with a diameter of 3 mm and 300 μl of DNA extraction solution; place on a grinder and grind at a frequency of 50 Hz for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take out for use.

[0024] The method for identifying the purity of Chinese cabbage seeds for small green seedlings provided by the present invention is preferably that in the step (3), 8% polyacrylamide gel is used for electrophoresis detection of PCR amplification products: 1.5 μl of PCR amplification products are added to each spot well, and electrophoresis is performed, and the electrophoresis is stopped when the electrophoresis indicator is at the lower middle part of the gel, which lasts for about 2 hours;

[0025] Carefully remove the gelatin plate, pour in the staining solution, and place on a shaker and shake slowly for 3 minutes;

[0026] Pour out the staining solution, add a small amount of distilled water to quickly wash three times, then pour in the color developing solution to develop the color, shake slowly until the strips are clean, and rinse with distilled water;

[0027] Among them, the total amount of dyeing solution is 1000ml, including 1.2g of AgNO3, and the rest is made up by distilled water; the total amount of color developing solution is 1000ml, including 15g of NaOH and 15ml of formaldehyde, and the rest is made up by distilled water.

[0028] The method for identifying the purity of Chinese cabbage seeds for Xiao Cui seedlings provided by the present invention is preferably, in the step (4), the purity of hybrid Chinese cabbage for Xiao Cui seedlings is calculated: the gel obtained in the step (3) is placed on a film observation light, and the results are photographed and counted. The seeds having both parental band types are hybrid seeds, the seeds having either the paternal or maternal band types are non-hybrid seeds, and the seeds having other band types are foreign hybrids.

[0029] The above technical solution has the following advantages or beneficial effects:

[0030] The SSR primers and method for identifying the seed purity of Chinese cabbage for Xiaocui seedlings provided by the present invention can solve the problems of being greatly affected by external environment, planting season, planting technology and experience, and having a large workload and a long cycle due to the morphological identification of seed purity in the prior art, by screening and using primers with strong specificity that can simultaneously show the specific bands of the male and female parents in Chinese cabbage hybrids for Xiaocui seedlings, so that the seed purity of Chinese cabbage hybrids for Xiaocui seedlings can be quickly and accurately identified within one or two hours, and the method has the advantages of being fast, stable, simple to operate, low cost, and not affected by the environment, and can efficiently detect the seed purity of Chinese cabbage hybrids for Xiaocui seedlings, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The present invention and its features, configurations and advantages will become more apparent by reading the detailed description of non-limiting embodiments with reference to the following drawings. The same reference numerals indicate the same parts throughout the drawings. The drawings are not drawn to scale, but rather to illustrate the subject matter of the present invention.

[0032] Figure 1 It is the electrophoresis diagram of the amplified products of Rapa150 in the hybrid F1 of Chinese cabbage for small green seedlings and its parents provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but is not intended to be a limitation of the present invention. The male and female parents of Chinese cabbage for Xiaocui seedlings can be obtained from the Chinese cabbage research group of Wuxi Puwei Agricultural Technology Co., Ltd., and hybrid Chinese cabbage for Xiaocui seedlings is commercially available.

[0034] Embodiment 1:

[0035] 1. Material selection

[0036] Take 10 seeds of each of the parent cabbages for Xiao Cui seedlings and randomly select 100 seeds of the hybrid F1 of Xiao Cui seedlings for Chinese cabbage, and place them in a germination box at a constant temperature of 26°C in the dark for germination. After germination, transfer them to growth under light, and sample them after the cotyledons are completely flattened.

[0037] 2. Primer Screening

[0038] Firstly, one male and one female plant were selected to extract their DNA respectively. From 192 pairs of SSR primers of Chinese cabbage for Xiaocui seedlings, polymorphic markers that can clearly distinguish the parental band types of Chinese cabbage for Xiaocui seedlings were screened using both parents through PCR amplification and polyacrylamide gel electrophoresis. Then, 48 hybrid F1 plants were used to verify the differential markers, and the primer Rapa150 with obvious differences, clean bands and easy interpretation was screened out for the purity identification of hybrid Chinese cabbage for Xiaocui seedlings.

[0039] 3. Extraction of genomic DNA

[0040] Take cotyledons 3mm 2 Place in a 2 ml centrifuge tube; add a 3 mm diameter steel ball and 300 μl DNA extraction solution; place on a grinder at a frequency of 50 Hz and grind for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take out for use.

[0041] IV. PCR Amplification and Detection

[0042] Reaction system: 2×Taq Master Mix 5 μl, 10 μM upstream primer Rapa150-F and downstream primer Rapa150-R 0.5 μl each, genomic DNA 1.5 μl, pH=8.0, 0.1 μM Tris-HCl 2.5 μl.

[0043] The reaction procedure uses Touch-down, which has six stages:

[0044] Stage 1: pre-denaturation at 95°C for 5 min;

[0045] The second stage: denaturation at 94°C for 45 seconds; annealing at 68-58°C for 6 cycles, decreasing by 2°C in each cycle, 1 min each time; extension at 72°C for 1 min;

[0046] The third stage: denaturation at 94℃ for 30S; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ each cycle, 1min each time; extension at 72℃ for 1min;

[0047] The fourth stage: denaturation at 94°C for 30 seconds; annealing at 50°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated 20 times;

[0048] Stage 5: extension at 72°C for 7 min;

[0049] Stage 6: Keep warm at 4°C.

[0050] Detection of amplification products: add 1.5μl amplification products to each spotting well, perform electrophoresis, and stop electrophoresis when the electrophoresis indicator is at the lower middle of the gel, which takes about 2 hours. Remove the gel plate, pour in the staining solution, and place it on a shaker and shake it slowly for 3 minutes; pour out the staining solution, add a small amount of distilled water to quickly wash 3 times, then pour in the color developing solution for color development, shake slowly until the strips are clean, and rinse with distilled water; the total amount of the staining solution is 1000ml, including 1.2g of AgNO3, and the rest is made up by distilled water; the total amount of the color developing solution is 1000ml, including 15g of NaOH and 15ml of formaldehyde, and the rest is made up by distilled water.

[0051] 5. Seed purity identification

[0052] The results of PCR detection of F1 hybrids of Chinese cabbage and small green seedlings using Rapa150 are as follows: Figure 1 As shown in the figure, it can be clearly seen that Rapa150 can clearly amplify the specific bands of the father and the mother, and the hybrid shows bands with both parental specificities. According to the results, it can be identified that the seed purity of this variety is 95%.

[0053] Those skilled in the art should understand that those skilled in the art can implement the above-mentioned variations by combining the prior art and the above-mentioned embodiments, which will not be described in detail here. Such variations do not affect the essential content of the present invention, and will not be described in detail here.

[0054] The above describes the preferred embodiments of the present invention. It should be understood that the present invention is not limited to the above-mentioned specific embodiments, and the devices and structures that are not described in detail should be understood to be implemented in a common manner in the art; any technician familiar with the art can make many possible changes and modifications without departing from the technical solution of the present invention, or modify them into equivalent embodiments with equivalent changes, which does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of protection of the technical solution of the present invention.

Claims

1. An SSR primer for identifying the purity of Chinese cabbage seeds for small green seedlings, characterized in that: It includes an upstream primer Rapa150-F and a downstream primer Rapa150-R, wherein: The upstream primer Rapa150-F is: GATGTGCAAGCAAGGATTGA; The downstream primer Rapa150-R is: GTCACAACAACGTGTGGCTT.

2. A method for identifying the purity of Chinese cabbage seeds for small green seedlings, characterized in that: include: (1) Extracting genomic DNA from the parents and hybrid F1 of the Chinese cabbage sample to be tested; (2) using the SSR primers described in claim 1 to perform PCR amplification on the genomic DNA of the Chinese cabbage parents and the hybrid F1 used in step (1); (3) using 8% polyacrylamide gel to separate the PCR amplification product of step (2) by electrophoresis and silver staining; (4) Statistical results, calculate the purity of hybrid Chinese cabbage for Xiaocuimiao seedlings, seed purity (%) = (total number of tested seeds - number of non-hybrid seeds - number of foreign hybrids) / total number of tested seeds × 100%; The step (2) uses a 10 μl PCR reaction system: 5 μl 2×Taq Master Mix, 0.5 μl each of the 10 μM upstream primer Rapa150-F and the downstream primer Rapa150-R, 1.5 μl genomic DNA, and 2.5 μl of Tris-HCl at pH=8.0 and 0.1 μM; The PCR reaction procedure uses Touch-down, which has six stages: Stage 1: pre-denaturation at 95°C for 5 min; The second stage: denaturation at 94°C for 45 seconds; annealing at 68-58°C for 6 cycles, decreasing by 2°C in each cycle, 1 min each time; extension at 72°C for 1 min; The third stage: denaturation at 94℃ for 30S; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ each cycle, 1min each time; extension at 72℃ for 1min; The fourth stage: denaturation at 94°C for 30 seconds; annealing at 50°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated 20 times; Stage 5: extension at 72°C for 7 min; Stage 6: Keep warm at 4°C.

3. The method for identifying the purity of Chinese cabbage seeds for small green seedlings as claimed in claim 2, characterized in that: The specific steps of step (1) are as follows: 2 Place the cotyledons in a 2 ml centrifuge tube; add a steel ball with a diameter of 3 mm and 300 μl of DNA extraction solution; place on a grinder and grind at a frequency of 50 Hz for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take out for use.

4. The method for identifying the purity of Chinese cabbage seeds for small green seedlings as claimed in claim 2, characterized in that: In the step (3), 8% polyacrylamide gel electrophoresis is used to detect the PCR amplification product: 1.5 μl of the PCR amplification product is added to each spot well, and electrophoresis is performed. The electrophoresis is stopped when the electrophoresis indicator is at the lower middle part of the gel, which takes about 2 hours; Carefully remove the gelatin plate, pour in the staining solution, and place on a shaker and shake slowly for 3 minutes; Pour out the staining solution, add a small amount of distilled water to quickly wash three times, then pour in the color developing solution to develop the color, shake slowly until the strips are clean, and rinse with distilled water; Among them, the total amount of dyeing solution is 1000ml, including 1.2g of AgNO3, and the rest is made up by distilled water; the total amount of color developing solution is 1000ml, including 15g of NaOH and 15ml of formaldehyde, and the rest is made up by distilled water.

5. The method for identifying the purity of Chinese cabbage seeds for small green seedlings as claimed in claim 2, characterized in that: In the step (4), the purity of the hybrid Chinese cabbage for Xiao Cui seedlings is calculated by placing the gel obtained in the step (3) on a film observation light, taking photos and counting the results. The hybrids have both parental band types, the non-hybrids have either the paternal or maternal band type, and the other band types are foreign hybrids.

Images