DCAPS molecular marker related to chieh-qua strong female character and application of dCAPS molecular marker

Abstract

The invention discloses a dCAPS molecular marker related to chieh-qua strong female characters and application of the dCAPS molecular marker, and belongs to the technical field of molecular biology. In the invention, fine positioning is carried out on the chieh-qua strong female gene based on BSA-seq, and finally, the strong female gene locus is shrunk to 51.08 Kb of Chr08, and only one gene (Bch08G003160) is contained. Sequence alignment finds that deletion of two base sites exists in a coding region of the gene, namely, G bases (Chr08, 14, 693 and 253bp) of SNP317 and C bases (Chr08, 14, 693 and 154bp) of SNP416, and the deletion of the bases at the two positions leads to early termination of codons. Meanwhile, dCAPS markers, namely Sgy317 SNP-dCAPS and Sgy416 SNP-dCAPS, for screening the strong female characters are developed at the deletion positions of the two base sites, namely, Sgy317 SNP-dCAPS and Sgy416 SNP-dCAPS. The strong female chieh-qua can be accurately screened by using two pairs of markers, so that the breeding efficiency is greatly improved.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and relates to a dCAPS molecular marker related to the strong female trait of winter melon and an application thereof. Background Art

[0002] Wax gourd, also known as hairy melon and northern melon, is a variant of the genus Wax gourd in the Cucurbitaceae family. It is widely grown in southern China. It has the characteristics of small shape, delicate flesh, light flavor, and edible fruit regardless of whether it is old or tender. It is one of my country's specialty vegetables.

[0003] The diversity of sex types of melon crops makes them an ideal model plant for studying sex differentiation traits. Among the various sex types of melon plants, winter melon is divided into monoecious, monoecious and semi-monoecious. In particular, the strong female type has a very high female rate, higher than 80%. This unique characteristic not only helps to increase yields, but also simplifies the seed production process, speeds up the breeding cycle, and reduces investment costs. Some cucurbit crops have carried out research on strong female traits, but there have been no reports on research related to strong female in winter melon. The development of molecular markers related to strong female in winter melon is of great significance to reducing the cost of hybrid breeding and improving the purity of hybrid seeds. Summary of the invention

[0004] In view of the above problems, the present invention provides a dCAPS molecular marker related to the strong female trait of zucchini and its application. The technical solution adopted by the present invention is:

[0005] A dCAPS molecular marker associated with a strong female trait of winter melon, the dCAPS molecular marker comprising Sgy_317 and Sgy_416, the SNP site used to develop Sgy_317 is at 14,693,253 bp on chromosome 8 of winter melon, and the SNP site used to develop Sgy_416 is at 14,693,154 bp on chromosome 8 of winter melon; the SNP site of Sgy_317 has a G base deletion, and the SNP site of Sgy_416 has a C base deletion.

[0006] Furthermore, if there is a G base deletion at 14,693,253bp of chromosome 8 of zucchini, or there is a C base deletion at 14,693,154bp of chromosome 8 of zucchini, it is a strong female zucchini.

[0007] Furthermore, the characteristic primer pair of Sgy_317 is Sgy_317SNP-dCAPS, and the characteristic primer pair of Sgy_416 is Sgy_416SNP-dCAPS.

[0008] Furthermore, the upstream primer sequence of the Sgy_317SNP-dCAPS is shown as SEQ ID NO.1, and the downstream primer sequence of the Sgy_317SNP-dCAPS is shown as SEQ ID NO.2.

[0009] Furthermore, the upstream primer sequence of the Sgy_416SNP-dCAPS is shown as SEQ ID NO.3, and the downstream primer sequence of the Sgy_416SNP-dCAPS is shown as SEQ ID NO.4.

[0010] The present invention also provides a method for detecting the strong female trait of Chickweed, based on any of the above-mentioned dCAPS molecular markers related to the strong female trait of Chickweed, the method comprising:

[0011] Extract the DNA of the tested wax gourd;

[0012] The DNA of the to-be-tested cucurbita oleracea is used as a template, and a PCR amplification is performed using a characteristic primer pair of Sgy_317 and a characteristic primer pair of Sgy_416 to obtain an amplified product;

[0013] The gene type of the amplified product is identified to determine whether the winter melon is a strong female winter melon.

[0014] Further, the identifying the gene type of the amplified product comprises:

[0015] The gene type of the amplified product was identified by using a 6% polyacrylamide gel.

[0016] Furthermore, the sequence of the PCR amplification product of the characteristic primer pair Sgy_317SNP-dCAPS of Sgy_317 is shown in SEQ ID NO.5.

[0017] Furthermore, the sequence of the PCR amplification product of the characteristic primer pair Sgy_416SNP-dCAPS of Sgy_416 is shown in SEQ ID NO.6.

[0018] Furthermore, the present invention also provides the application of any of the above-mentioned methods for detecting the strong female trait of winter melon in winter melon assisted breeding.

[0019] Based on the above technical scheme, the present invention has the following technical effects: The present invention provides a dCAPS molecular marker related to the strong female trait of winter melon and its application, the dCAPS marker is located at 14,693,246 and 14,693,148 on chromosome 8 of winter melon, and a G base deletion occurs at 14,693,253bp, or a C base deletion occurs at 14,693,154bp. At the same time, dCAPS markers for screening strong females in winter melon are developed at the above two locations, which are Sgy_317 and Sgy_416 respectively. The SNP site used to develop Sgy_317 is at 14,693,253bp on chromosome 8 of winter melon, and the characteristic primer pair corresponding to Sgy_317 is Sgy_317SNP-dCAPS. The SNP site used to develop Sgy_416 is at 14,693,154bp on chromosome 8 of zucchini, and the characteristic primer pair corresponding to Sgy_416 is Sgy_416SNP-dCAPS. In the present invention, the genes related to the strong female trait of zucchini are precisely located, and the G base deletion at 317 of the coding region of Bch08003160 and the C base deletion at 416 of the coding region of Bch08003160 are closely related to the strong female trait of zucchini. Two pairs of characteristic primers are used to accurately screen the strong female zucchini, thereby improving the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The male and female phenotypic characteristics of the parents include the strong female parent J16 (P1) and the strong male parent FJ5 ​​(P2);

[0022] Figure 2 This is the genetic positioning of the strong female gene in Jiegua, among which, Figure a is the BSAseq positioning of Jiegua strong female; Figure b is the preliminary positioning genetic map of Jiegua strong female; Figure c is the fine positioning map of Jiegua strong female;

[0023] Figure 3 The results of typing strong female plants in 30 F2 populations using Sgy_317SNP-dCAPS markers;

[0024] Figure 4 The results of typing strong female plants in 30 F2 populations using Sgy_416SNP-dCAPS markers;

[0025] Figure 5The typing results of 32 different cucurbitaceae materials were obtained by combining Sgy_317SNP-dCAPS and Sgy_416SNP-dCAPS markers;

[0026] Figure 6 These are the typing results of 21 different cucurbitaceae materials using Sgy_317SNP-dCAPS combined with Sgy_416SNP-dCAPS markers. DETAILED DESCRIPTION

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all belong to the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc. used in the present examples are all commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.

[0028] Example 1

[0029] Experimental materials: The inbred line J16 (P1) of zucchini was used as the female parent and FJ5 (P2) as the male parent. The F1 of J16×FJ5 was obtained by artificial isolation, and then the F1 was self-pollinated to obtain the F2 population. The female flower rate of J16 was 95.45 (±1.35)%; the female flower rate of FJ5 was 16.67 (±1.35)%. All materials were multi-generation stable inbred lines of zucchini provided by Guangzhou Academy of Agricultural Sciences. The method for calculating the female flower rate was: the number of nodes with female flowers / the total number of nodes with flowering × 100%.

[0030] The positioning of the gene for the strong female trait includes the following steps: the female flower rate of the parents, F1 and F2 plants is counted respectively. The results show that the female flower rate of the strong female parents is 95.45 (± 3.1)% on average, the female flower rate of the strong male parents is 16.67 (± 1.3)% on average, and the female flower rate of the F1 population is between the two parents, averaging 37.5 (± 2.7)%, and is generally closer to the female flower rate of the strong male parents.

[0031] In the F2 population, the traits separated and showed a bimodal distribution, indicating quantitative trait characteristics. Subsequently, 25 strains were selected to construct extreme pools, and an area above the threshold was found on Chr08 with a total length of 2.64Mb ( Figure 2 a).

[0032] According to the BSA-seq results, multiple pairs of Indel markers were designed in the interval of Sgy_3-Sgy_6. The results were verified on 363 F2 plants, and the strong female gene of zucchini was preliminarily located in the range of Sgy_3-Sgy_6 (14,554,914~15,050,000). The size of this interval is approximately equal to 495Kb ( Figure 2 b).

[0033] Subsequently, based on the preliminary positioning, Indel markers were developed to perform genotyping on 2741 F2 individuals, combining phenotypes with genotypes, and eventually narrowing the interval to a region of 51.08 Kb ( Figure 2 c), this region contains only one gene (Bch08G003160), which is annotated as MYB62. Therefore, it is speculated that Bch08G003160 is an important candidate gene for the strong female trait of zucchini.

[0034] Table 1 InDel primer pairs used for fine positioning of strong female genes in zucchini

[0035]

[0036]

[0037] Note: S_1 is the primer sequence used for Sanger sequencing

[0038] Subsequently, the cDNA sequence of the gene was extracted from the genome of the winter melon for amplification and cloning. It was found that compared with the father FJ5, the mother J16 had a C base deletion at position 416, and the dCAPS molecular marker at this position was named Sgy_416. Subsequently, a base (G) deletion was found at position 317 in another strong female material (17045), and the dCAPS molecular marker at this position was named Sgy_317. Finally, the amino acid sequence of Bch08G003160 was analyzed, and the results showed that the deletion of G base or C base led to frameshift mutation and premature formation of stop codon. According to the variable sites between the candidate genes, the dCAPS primers were developed and the endonuclease was selected using the dCAPS (http: / / helix.wustl.edu / dcaps / dcaps.html) website. According to the given upstream primers and downstream primers, the primers at the other end were designed in the Primer5.0 software for screening strong female winter melon.

[0039] As shown in Table 2, the specific primer sequences are as follows:

[0040] SEQ ID NO.1 Upstream primer sequence of Sgy_317SNP-dCAPS:

[0041] TTGCACAACATTTACCGGTAGAAC

[0042] SEQ ID NO.2 Downstream primer sequence of Sgy_317SNP-dCAPS:

[0043] GGGAGGAGTTGGAGGATTGGTC

[0044] SEQ ID NO.3 Upstream primer sequence of Sgy_416SNP-dCAPS:

[0045] AGGAGATTTTCGGACTCAGTG

[0046] SEQ ID NO.4 Downstream primer sequence of Sgy_416SNP-dCAPS:

[0047] AGTTTCCGACGTGTTCGGTA

[0048] SEQ ID NO.5 Sequence of the PCR amplification product of Sgy_317SNP-dCAPS:

[0049] TTGCACAACATTTACCGGTAGAACGGATAACGAAATCAAGAACTACTGGAGAACGAGAGTTCAAAAACAGTCACGGCAGCTTAAAGTTGAGGCAGACAGCAGGAGATTTTCGGACTCGAGTGTGCTAGAAGCCATGGACCAATCCTCCAACTCCTCCC

[0050] SEQ ID NO.6 Sequence of the PCR amplification product of Sgy_416SNP-dCAPS:

[0051] AGGAGATTTTCGGACTCAGTGTGCTAGAAGCCATGGACCAATCCTCCAACTCCTCCCTCAATTTTCCTCTCCATCTCTCCACAACACAACCTTACCGAACACGTCGGAAACT

[0052] Table 2dCAPS primer pairs

[0053]

[0054]

[0055] Note: Bold indicates mismatches.

[0056] Two pairs of dCAPS molecular markers were used to verify the strong female nature of 30 F2 plants and 53 different germplasms of wax gourd (including 11 strong female materials and 42 male materials), all of which were from Guangzhou Academy of Agricultural Sciences.

[0057] DNA was extracted using the cetyltrimethylammonium bromide method (CTAB method), the specific method is as follows:

[0058] (1) Place the leaves in a 2 mL centrifuge tube, add 700 μL CTAB lysis buffer and 2 grinding beads, and place in an automatic grinder for crushing. Set the program to 65 Hz, 120 s.

[0059] (2) After grinding, transfer the 2 mL centrifuge tube to a thermostatic metal bath and maintain it at 65°C for 25 min. During this period, mix it by inverting it once every 8 min. After mixing, centrifuge it at 4°C and 12,000 rpm for 8 min.

[0060] (3) After cooling slightly, add an equal volume of chloroform and invert.

[0061] (4) Aspirate the supernatant into a new 1.5 cm centrifuge tube, add an equal volume of isopropanol, gently invert to mix, and place at -20°C for 20 min.

[0062] (5) After centrifugation at 12,000 rpm for 5 min, discard the supernatant, add 600 μL of 75% ethanol, wash the DNA precipitate by inversion twice, and then air-dry.

[0063] (6) Add 50 μL of 1×TE to the centrifuge tube to dissolve the DNA.

[0064] (7) After the DNA is dissolved, add RNase and incubate in a 37°C metal bath for 40 min to remove residual RNA. Finally, store the DNA solution in a -20°C refrigerator.

[0065] PCR amplification using dCAPS

[0066] PCR reaction system (10 μL): 5.0 μL Mix (2×), 1.0 μL upstream primer, 1.0 μL downstream primer, 1.0 μL DNA, 2.0 μL ddH2 O

[0067] PCR program: pre-denaturation, 95°C, 3 min; denaturation, 95°C, 30S; annealing, 55-58°C, 30S; extension, 72°C, 30S; 2-4 steps 34 cycles; extension, 72°C, 5 min; storage, 12°C, ∞.

[0068] Enzyme digestion system: PCR product, 1 μL; 10×NEBuffer, 1 μL; enzyme, 0.2 μL; Nuclease-Free Water, 7.8 μL.

[0069] Enzyme digestion conditions: 37°C, 15 min; 65°C, 20 min.

[0070] This experiment uses 6% polyacrylamide gel electrophoresis to detect PCR products. The specific steps are as follows:

[0071] Gel preparation requires 80mL of 6% acrylamide solution, 640μL of 12% ammonium persulfate, and 32μL of TEMED. Mix the three quickly and pour them into the combined glass plate with agarose bottom. Insert the comb and let it stand at room temperature for about half an hour until the gel solidifies. Then, pull out the comb steadily in pure water, rinse the spotting holes under running water, fix the paired electrophoresis plates to both sides of the electrophoresis tank, pour in TBE buffer, and use a microsampler to suck 1μL of PCR product into the gel hole. The voltage of the electrophoresis instrument is set to 300V, and the corresponding electrophoresis time is set according to the size of the amplified product. After the electrophoresis is completed, take pictures and record the data.

[0072] Results: (1) The Sgy_317SNP-dCAPS marker was used to genotype 30 strong female materials in F2. The genotyping results are as follows: Figure 3 As shown, the genotypes of 30 F2 samples were different from those of the strong female material 17045, but consistent with those of the parents (FJ5 and J16).

[0073] (2) The Sgy_416SNP-dCAPS marker was used to genotype 30 strong female materials in F2. The genotyping results are as follows: Figure 4 As shown, the 30 F2 female parents (J16) had the same genotype.

[0074] (3) Figure 5 As shown, 32 gypsum materials were genotyped by combining two pairs of markers, and 3 strong female materials were screened out by Sgy_416SNP-dCAPS marker, which had the same genotype as the maternal J16.

[0075] (4) Figure 6 As shown, 21 zucchini materials were genotyped by combining two pairs of markers, and 8 strong female materials were screened out by Sgy_317SNP-dCAPS marker, which were consistent with the genotype of 17045.

[0076] The above results show that 30 F2 plants were genotyped using Sgy_416SNP-dCAPS with an accuracy of 100%; 3 of the 53 gypsum materials were consistent with the genotype of the mother parent J16, and 8 were consistent with the genotype of 17045. In summary, the combination of two pairs of specific primers Sgy_317SNP-dCAPS and Sgy_416SNP-dCAPS can screen out strong female gypsum with an accuracy of 100%. The presence of a G base deletion at 14,6932,53bp on chromosome 8 or a C base deletion at 14,693,154bp on chromosome 8 is a strong female gypsum. Using the dCPAS markers and primers developed in this study, strong female gypsum can be screened more quickly according to genotype, greatly improving breeding efficiency and having important application value.

[0077] It can be understood that the above embodiments only express the preferred implementation modes of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the patent scope of the present invention. It should be pointed out that, for ordinary technicians in this field, without departing from the concept of the present invention, the above technical features can be freely combined, and several deformations and improvements can be made, which all belong to the protection scope of the present invention. Therefore, all equivalent changes and modifications made to the scope of the claims of the present invention should belong to the scope covered by the claims of the present invention.

Claims

1. A dCAPS molecular marker associated with the strong female trait of zucchini, characterized in that: The dCAPS molecular markers include Sgy_317 and Sgy_416. The SNP site used to develop Sgy_317 is at 14,693,253 bp on chromosome 8 of cucurbita oleracea, and the SNP site used to develop Sgy_416 is at 14,693,154 bp on chromosome 8 of cucurbita oleracea. The SNP site of Sgy_317 has a G base deletion, and the SNP site of Sgy_416 has a C base deletion.

2. The dCAPS molecular marker associated with the strong female trait of Chickweed according to claim 1, characterized in that: If there is a G base deletion at 14,693,253bp of chromosome 8 of zucchini, or there is a C base deletion at 14,693,154bp of chromosome 8 of zucchini, it is a strong female zucchini.

3. The dCAPS molecular marker associated with the strong female trait of Chickweed according to claim 1, characterized in that: The characteristic primer pair of Sgy_317 is Sgy_317SNP-dCAPS, and the characteristic primer pair of Sgy_416 is Sgy_416SNP-dCAPS.

4. The dCAPS molecular marker associated with the strong female trait of Chickweed according to claim 3, characterized in that: The upstream primer sequence of the Sgy_317SNP-dCAPS is shown in SEQ ID NO.1, and the downstream primer sequence of the Sgy_317SNP-dCAPS is shown in SEQ ID NO.

2.

5. The dCAPS molecular marker associated with the strong female trait of Chickweed according to claim 3, characterized in that: The upstream primer sequence of the Sgy_416SNP-dCAPS is shown in SEQ ID NO.3, and the downstream primer sequence of the Sgy_416SNP-dCAPS is shown in SEQ ID NO.

4.

6. A method for detecting the strong female trait of winter melon, characterized in that: Based on the dCAPS molecular marker associated with the strong female trait of zucchini according to any one of claims 1 to 5, the method comprises: Extract the DNA of the tested wax gourd; The DNA of the to-be-tested cucurbita oleracea is used as a template, and a PCR amplification is performed using a characteristic primer pair of Sgy_317 and a characteristic primer pair of Sgy_416 to obtain an amplified product; The gene type of the amplified product is identified to determine whether the winter melon is a strong female winter melon.

7. The method for detecting the strong female trait of winter melon according to claim 6, characterized in that: The method for identifying the gene type of the amplified product comprises: The gene type of the amplified product was identified by using a 6% polyacrylamide gel.

8. The method for detecting the strong female trait of winter melon according to claim 6, characterized in that: The sequence of the PCR amplification product of the characteristic primer pair Sgy_317SNP-dCAPS of Sgy_317 is shown in SEQ ID NO.

5.

9. The method for detecting the strong female trait of winter melon according to claim 6, characterized in that: The sequence of the PCR amplification product of the characteristic primer pair Sgy_416SNP-dCAPS of Sgy_416 is shown in SEQ ID NO.

6.

10. Use of the method for detecting the strong female trait of winter melon according to any one of claims 6 to 9 in winter melon assisted breeding.

Images