Maize saline-alkaline tolerance molecular marker and application thereof

Abstract

The invention provides a corn saline-alkaline tolerant molecular marker and application thereof. The molecular marker is located on chr2: 11471394 of a corn chromosome 2, and the nucleotide sequence of the molecular marker is SEQ ID NO. 6. The molecular marker and the detection reagent thereof can be applied to saline-alkaline tolerance breeding of corn, identification can be carried out in the period of corn seeds or the early stage of cotyledon growth, and the breeding process of saline-alkaline tolerance varieties of corn is accelerated.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically, relates to a molecular marker for corn salt-alkali tolerance and its application. Background Art

[0002] Salt-alkali stress is one of the most common abiotic stresses in nature. Due to its widespread distribution, it has a great negative impact on agricultural production (Munns & Tester, 2008; Zhu, 2016). In-depth research on the molecular mechanisms of major crops adapting to salt stress environments, identifying genes that can be used to improve crop salt-alkali tolerance, and cultivating salt-alkali tolerant crop varieties are necessary measures to ensure the sustainable development of my country's agriculture and national food security.

[0003] The salt-alkali tolerance response process mainly includes two aspects: deionization toxicity and osmotic regulation. When growing under salt stress conditions, plant roots will absorb excess Na + , while inhibiting K + absorption, resulting in K + / Na + The imbalance of Na ratio will cause ion toxicity and osmotic stress. + , K + Homeostasis is of great significance to the formation of plant salt-alkali tolerance (Munns and Tester, 2008; Yang and Guo, 2018). Maize is the most widely planted crop in my country and is sensitive to salt stress (Wang Liyan, 2005). Studies have shown that natural populations of maize have rich genetic diversity, and different maize inbred lines have different salt-alkali tolerance, indicating that there are rich genetic variations in natural populations of maize, which can be applied to genetic improvement of salt-alkali tolerance (Zhang et al., 2019; Luo et al., 2019). With the continuous application of genome-wide association analysis (GWAS) and quantitative trait genome (QTL) analysis methods in the mining of maize salt-alkali tolerance genes, a series of genetic loci related to salt-alkali tolerance variation have been mined, but so far only a few maize salt-alkali tolerance QTL genes have been cloned, and the development and application of maize salt-alkali tolerance molecular markers are relatively small. Therefore, discovering and cloning salt-alkali tolerance QTL genes and analyzing their salt-alkali tolerance mechanisms, developing new salt-alkali tolerance molecular markers and applying them to salt-alkali tolerance breeding of corn, have important genetic resource support and application value for salt-alkali tolerance corn breeding. Summary of the invention

[0004] On the one hand, the present application provides a molecular marker for salt-alkali tolerance of corn, and the nucleotide sequence of the molecular marker for salt-alkali tolerance of corn is SEQ ID NO.6.

[0005] Furthermore, the maize salt-alkali tolerance molecular marker is located on maize chromosome 2.

[0006] Further, the maize salt-alkali tolerance molecular marker is obtained by amplifying maize genomic DNA using the following primer pair: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;

[0007] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

[0008] On the other hand, the present application provides a primer pair for detecting the above-mentioned corn salt-alkali tolerance molecular marker, and the nucleotide sequence of the primer pair is:

[0009] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;

[0010] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

[0011] On the other hand, the present application provides a kit for identifying whether corn is salt-alkali tolerant, the kit comprising the above-mentioned primer pair.

[0012] On the other hand, the present application provides a method for identifying whether corn is salt-alkali tolerant, the method comprising:

[0013] (1) extracting genomic DNA of the corn to be tested;

[0014] (2) Amplify maize genomic DNA using the following primer pairs:

[0015] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;

[0016] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC;

[0017] (3) Determine whether the corn to be tested is salt-alkali tolerant based on the amplification results: if a 100 bp fragment is obtained by amplification, the corn to be tested is salt-alkali tolerant; if a 121 bp fragment is obtained by amplification, the corn to be tested is salt-alkali sensitive.

[0018] The step (2) can be performed using the above-mentioned kit.

[0019] Furthermore, the PCR system used for amplification in step (2) is a 20 μl system, including 10 μl of 2×Super MultiplexPCR Mix, 1 μl of 10 μM Primer ZmNC3-N-Marker-F1, 1 μl of 10 μM Primer ZmNC3-N-Marker-R1, 1 μl of corn genomic DNA, and 7 μl of ddH2O.

[0020] Furthermore, the PCR program used for amplification in step (2) is: first, pre-denaturation at 95°C for 5 min; then, 34 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

[0021] Furthermore, in step (3), the amplification results are observed by electrophoresis.

[0022] Furthermore, in step (1), genomic DNA of the corn to be tested is extracted from the corn to be tested.

[0023] On the other hand, the present application provides the application of the above-mentioned molecular markers, kits, and methods in salt-alkali tolerant corn breeding.

[0024] Furthermore, in the application, salt-alkali tolerant corn plants or seeds are selected for breeding.

[0025] Maize genomic DNA can be extracted using methods such as the CTAB method, or using commercially available kits. The samples used can be seeds, stems at different growth stages, leaves, fruits, and other parts.

[0026] The present invention has found a nucleic acid sequence that can be used as a molecular marker to determine whether corn is salt-alkali tolerant. Since corn salt-alkali tolerance is a quantitative trait inheritance, phenotypic analysis is time-consuming and laborious. The corn salt-alkali tolerance molecular marker, primer pair and kit of the present invention can be applied to corn salt-alkali tolerance breeding, and identification can be performed during the corn seed period or the early stage of cotyledon growth, which is time-saving and accurate, and can accelerate the breeding process of corn salt-alkali tolerant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the status of functional SNP loci and molecular marker loci in Yu82, W966, Shen137, LH38, Dan598 and Su75.

[0028] Figure 2 This is the result of PCR amplification of genomic DNA of Yu82, W966, Shen137, LH38, Dan598, and Su75 using primers ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1.

[0029] Figure 3 The Na of 121 bp and 100 bp PCR bands in 100 maize inbred lines + Content difference graph.

[0030] Figure 4 This is the linkage disequilibrium analysis between Del1213 and the ZmNC3 functional variation site SNP947. Part A shows the natural variation in the ZmNC3 gene region and the aboveground Na + Part A is the result of content association analysis; Part B is the schematic diagram of the structure of the ZmNC3 gene; Part C is the result of linkage disequilibrium analysis of natural variation in the ZmNC3 gene interval. DETAILED DESCRIPTION

[0031] Example 1 Development of molecular markers linked to the salt-alkali tolerance QTL gene ZmNC3

[0032] ZmNC3 is a salt-tolerance QTL gene identified in maize. This gene encodes a HKT family transporter that positively regulates maize salt tolerance. Subsequent analysis showed that the superior allele variation of ZmNC3 only exists in 6% of modern maize inbred lines, and the parents of major maize varieties such as Zhengdan 958 do not contain this superior allele variation. Since its functional variation site SNP947 (A / G) is a single nucleotide variation, there is currently no suitable molecular marker that can be used for molecular selection breeding based on the size of the PCR product. Therefore, the inventors identified an insertion / deletion molecular marker that is highly linked to the ZmNC3 functional variation site for molecular breeding of maize salt and alkali tolerance.

[0033] According to the functional variation site SNP947 (A / G) of ZmNC3, 116 maize inbred line materials were divided into haplotype G (salt-alkali tolerant) and haplotype A (salt-sensitive). Three materials were randomly selected from each of the two haplotypes, and it was found that there was a replacement of ATATCTTTCTCTCACTCACTCCGTCGCCTCTGTCTCTG (SEQ ID NO.1) at chr2:11471394, which was replaced by GTCTCTCTCTCTCTCTCAC (SEQ ID NO.2), resulting in a 21-bp insertion / deletion, which was named Del1213. The SNP947 site of the salt-alkali tolerant inbred lines Yu82, LH38, and Su75 is G, and contains Del1213; the SNP947 site of the salt-sensitive inbred lines W966, Shen137, and Dan598 is A, and does not contain Del1213. Figure 1 shown.

[0034] Using the Del1213 site as a molecular marker, the inventors designed a pair of primers:

[0035] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT (SEQ ID NO.3);

[0036] ZmNC3-N-Marker-R1: CATAACGTGAACTGCGATGC (SEQ ID NO. 4).

[0037] PCR amplification was performed using this pair of primers with the genomic DNA of Yu82, W966, Shen137, LH38, Dan598 and Su75 as templates.

[0038] PCR system 20μl: 2×Super Multiplex PCR Mix 10μl, 10μM Primer ZmNC3-N-Marker-F1 1μl, 10μM Primer ZmNC3-N-Marker-R1 1μl, DNA 1μl, ddH2O 7μl.

[0039] PCR program: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 34 cycles from denaturation to extension, and final extension at 72°C for 5 min.

[0040] The results showed that the primer pair could obtain a 100 bp band when the total DNA of salt-tolerant corn inbred lines Yu82, LH38, and Su75 was used as a template for PCR amplification; the primer pair could obtain a 121 bp band when the total DNA of salt-sensitive corn inbred lines W966, Shen137, and Dan598 was used as a template for PCR amplification. Figure 2 shown.

[0041] 121bp band sequence (SEQ ID NO.5)

[0042] CCTCGACCTCTCCACACTGGCAGCGGCCATCCTCGTACTCTTCGTCCTCATGATGTGAGTATATCTTTCTCTCACTCACTCCGTCGCCTCTGTCTCTGTGTGCATCGCAGTTCACGTTATG;

[0043] 100bp band sequence (SEQ ID NO.6)

[0044] CCTCGACCTCTCCACACTGGCGACGGCCATCCTCGTGCTCTTCGTCCTCATGATGTGAGTGTCTCTCTCACTCACTGTGCATCGCAGTTCACGTTATG.

[0045] Example 2 Detection of salt-alkali tolerance in corn using salt-alkali tolerance molecular markers

[0046] 100 kinds of corn inbred line materials (including some corn backbone inbred lines) were further selected, and the Del1213 locus was identified using the primer pair ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1. The detection method is as described in Example 1, and PCR amplification is performed using the corn genomic DNA to be tested as a template. The results show that 89 inbred line PCR products are large fragments with a product length of 121bp, of which 89 are salt-sensitive inbred line SNP947-A; the other 11 inbred line PCR products are small fragments with a product length of 100bp, of which 10 are salt-tolerant inbred line SNP947-G and 1 is salt-sensitive inbred line SNP947-A. The names of the inbred lines used and the identification results are shown in the following table:

[0047]

[0048]

[0049]

[0050]

[0051] Under salt stress conditions, the Na in the leaves of the material with the PCR band of 121 bp + The content is significantly higher than that of materials with a band of 100 bp, such as Figure 3 shown.

[0052] Example 3 Linkage disequilibrium analysis between Del1213 and ZmNC3 functional variation site SNP947

[0053] The genomic DNA of ZmNC3 in 513 maize inbred lines was PCR amplified and resequenced. The resequencing regions included the promoter region, CDS region and 3′-UTR region of ZmNC3 (sequencing was completed at Beijing Liuhe BGI Gene Technology Co., Ltd.). The sequencing results were aligned and differential sites were obtained using Codoncode Aligner software, and all genotype data were analyzed for candidate gene association using Tassle5 software. At the same time, linkage disequilibrium analysis of natural variation sites was performed using hapview software. The results showed that Del1213 was linked to the ZmNC3 functional site SNP947 (r 2 =0.8) and aboveground Na + The contents were significantly correlated, such as Figure 4 shown.

[0054] Therefore, the primer pair ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1 can be used for molecular assisted breeding of maize salt-alkali tolerance, and the salt-alkali tolerance molecular marker based on this primer pair is named J-Del1213. The sequences of each primer are:

[0055] Primer ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT (SEQ ID NO. 3);

[0056] Primer ZmNC3-N-Marker-R1: CATAACGTGAACTGCGATGC (SEQ ID NO. 4).

Claims

1. A molecular marker for corn salt-alkali tolerance, the nucleotide sequence of which is SEQ ID NO.

6.

2. The corn salt-alkali tolerance molecular marker according to claim 1, wherein the corn salt-alkali tolerance molecular marker is located on corn chromosome 2.

3. The salt-alkali tolerance molecular marker of maize according to claim 1, which is obtained by amplifying maize genomic DNA using the following primer pairs: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

4. The primer pair for detecting the salt-alkali tolerance molecular marker of corn according to claim 1 is characterized in that: The nucleotide sequence of the primer pair is: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

5. A kit for identifying whether corn is salt-alkali tolerant, characterized in that: The kit comprises the primer pair according to claim 4.

6. A method for identifying whether corn is salt-alkali tolerant, characterized in that: The method comprises: (1) extracting genomic DNA of the corn to be tested; (2) Amplify maize genomic DNA using the following primer pairs: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC; (3) Determine whether the corn to be tested is salt-alkali tolerant based on the amplification results: if a 100 bp fragment is obtained by amplification, the corn to be tested is salt-alkali tolerant; if a 121 bp fragment is obtained by amplification, the corn to be tested is salt-alkali sensitive.

7. The method according to claim 4, wherein the PCR system used for amplification in step (2) is a 20 μl system, comprising 10 μl of 2×Super Multiplex PCR Mix, 1 μl of 10 μM Primer ZmNC3-N-Marker-F1, 1 μl of 10 μM Primer ZmNC3-N-Marker-R1, 1 μl of corn genomic DNA, and 7 μl of ddH2O.

8. The method according to claim 6, wherein in step (3) the amplification result is observed by electrophoresis.

9. Provided is the use of the salt-alkali tolerance molecular marker for corn according to any one of claims 1 to 3, the kit according to claim 4, or the method according to any one of claims 5 to 8 in salt-alkali tolerance corn breeding.

10. The use according to claim 9, wherein salt-alkali tolerant corn plants or seeds are selected for breeding.

Images