Primer probe combination, kit and method for detecting monkey pox virus by real-time dual loop-mediated isothermal amplification method

Abstract

The invention discloses a primer probe combination, a kit and a method for detecting monkey pox virus by a real-time dual loop-mediated isothermal amplification method, and belongs to the technical field of virus detection. The primer probe combination provided by the invention comprises an LAMP primer group for detecting a monkey pox virus J2R gene, an LAMP primer group for detecting a monkey pox virus F3L-F4L gene and an assimilation probe. The LAMP primer group provided by the invention is high in sensitivity and strong in specificity. On the basis of established real-time LAMP, the assimilation probe of a specific target sequence is designed, F3L-F4L and J2R of the monkey pox virus are simultaneously detected by utilizing a real-time double LAMP method based on the assimilation probe, and the method has the advantages of simplicity, rapidness, sensitivity, specificity and accuracy.

Description

Technical Field

[0001] The present application belongs to the technical field of virus detection, and in particular, relates to a primer-probe combination, a kit and a method for detecting monkeypox virus by real-time double loop-mediated isothermal amplification. Background Art

[0002] At present, fluorescent quantitative PCR is the main detection method for monkeypox virus at home and abroad, and other diagnostic methods are less studied. However, most of the existing diagnostic methods have low sensitivity, poor specificity, and certain defects such as missed detection rate. In addition, monkeypox virus has high homology with other orthopoxviruses such as smallpox and cowpox, making it difficult to identify and distinguish. Therefore, it is urgent to establish a rapid, sensitive and accurate method for detecting monkeypox virus to provide emergency technical reserves for responding to monkeypox epidemics. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a primer probe combination, a kit and a method for detecting monkeypox virus by real-time double loop-mediated isothermal amplification. The method can detect the J2R gene fragment and the F3L-F4L gene fragment of the monkeypox virus. At the same time, the addition of specific assimilation probes can perform real-time detection. It has the advantages of simplicity, rapidity, sensitivity, specificity and accuracy, and provides a powerful technical reference for the detection of monkeypox virus.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] On the one hand, the present invention provides a primer-probe combination for detecting monkeypox virus by real-time double loop-mediated isothermal amplification, wherein the primer-probe combination comprises a LAMP primer set for detecting the J2R gene of the monkeypox virus, a LAMP primer set for detecting the F3L-F4L gene of the monkeypox virus, and an assimilation probe;

[0006] The LAMP primer set for detecting the monkeypox virus J2R gene includes an F3 primer, a B3 primer, a FIP primer, a BIP primer, a LoopF ​​primer and a LoopB primer;

[0007] The nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LoopF ​​primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LoopB primer is shown in SEQ ID NO.6;

[0008] The LAMP primer set for detecting the monkeypox virus F3L-F4L gene includes an F3' primer, a B3' primer, a FIP' primer, a BIP' primer, a LoopF' primer and a LoopB' primer;

[0009] The nucleotide sequence of the F3' primer is shown in SEQ ID NO.7, the nucleotide sequence of the B3' primer is shown in SEQ ID NO.8, the nucleotide sequence of the FIP' primer is shown in SEQ ID NO.9, the nucleotide sequence of the BIP' primer is shown in SEQ ID NO.10, the nucleotide sequence of the LoopF' primer is shown in SEQ ID NO.11, and the nucleotide sequence of the LoopB' primer is shown in SEQ ID NO.12;

[0010] The assimilation probes include a J2R-LBP probe, a F3L-F4L-LBP probe and a quenching probe;

[0011] The nucleotide sequence of the J2R-LBP probe is shown in SEQ ID NO.13, the nucleotide sequence of the F3L-F4L-LBP probe is shown in SEQ ID NO.14, and the nucleotide sequence of the quenching probe is shown in SEQ ID NO.15.

[0012] Optionally, the molar ratio of the F3 primer, the B3 primer, the FIP primer, the BIP primer, the LoopF ​​primer and the LoopB primer is: 0.2:0.2:1.2:1.2:0.8:0.8;

[0014] The molar ratio of the F3' primer, the B3' primer, the FIP' primer, the BIP' primer, the LoopF' primer and the LoopB' primer is:

[0015] 0.2:0.2:1.2:1.2:0.8:0.8.

[0016] Optionally, the 5' end of the J2R-LBP probe is labeled with a fluorescent group FAM;

[0017] The 5' end of the F3L-F4L-LBP probe is labeled with the fluorescent group VIC;

[0018] The 3' end of the quencher probe is labeled with a quencher group BHQ-1.

[0019] Optionally, the excitation wavelength of the fluorescent group FAM is 494 nm, and the emission wavelength is 518 nm;

[0020] The excitation wavelength of the fluorescent group VIC is 538 nm, and the emission wavelength is 554 nm.

[0021] In a second aspect, the present invention provides the use of the above primer-probe combination in the preparation of a kit for detecting monkeypox virus.

[0022] In a third aspect, the present invention provides a kit for detecting monkeypox virus by real-time double loop-mediated isothermal amplification, wherein the kit comprises the above-mentioned primer-probe combination.

[0023] Optionally, the kit further comprises Bst2.0 DNA polymerase, dNTP mix and reaction buffer.

[0024] Optionally, the reaction buffer contains components with the following concentrations: 8 mM MgSO4, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 0.1% Tween-20, and 0.7 M betaine.

[0025] In a fourth aspect, the present invention provides a method for detecting monkeypox virus by real-time double loop-mediated isothermal amplification, wherein the method comprises using the above-mentioned kit to perform a real-time double loop-mediated isothermal amplification reaction on the genomic DNA of the sample to be tested.

[0026] Optionally, the program of the real-time double loop-mediated isothermal amplification reaction is: 65°C, 10s; 65°C, 30s; 65°C, 30s fluorescence collection, 60 cycles.

[0027] Optionally, after the real-time double-loop-mediated isothermal amplification reaction is completed, a step of enzyme inactivation at 85° C. for 10 min is also included.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) The LAMP primer set provided by the present invention has high sensitivity and strong specificity;

[0030] (2) The kit for detecting monkeypox virus by real-time double loop-mediated isothermal amplification provided by the present invention can dual-target detect the F3L-F4L gene and J2R gene of monkeypox virus, which not only improves the accuracy but also greatly reduces the missed detection rate;

[0031] (3) Based on the established real-time LAMP, the present invention designs assimilation probes of specific target sequences and uses the real-time dual LAMP method based on assimilation probes to simultaneously detect F3L-F4L and J2R of monkeypox virus, which has the advantages of being simple, rapid, sensitive, specific and accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a result diagram of the sensitivity of detecting the monkeypox virus J2R gene by the single-gene real-time fluorescence LAMP based on the assimilation probe in Example 2 of the present invention;

[0033] Figure 2 This is a result diagram of the sensitivity of detecting the F3L-F4L gene of monkeypox virus by single-gene real-time fluorescence LAMP based on assimilation probes in Example 2 of the present invention;

[0034] Figure 3 This is an amplification curve diagram of monkeypox virus detection using dual-target real-time fluorescence LAMP based on assimilated probes in Example 2 of the present invention;

[0035] Figure 4 This is a specific detection diagram of monkeypox virus detection by dual-target real-time fluorescence LAMP based on assimilated probes in Example 2 of the present invention (Note: A represents the amplification results of the primer set of the J2R gene for real-time fluorescence LAMP detection of monkeypox virus and other viruses (Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus); B represents the specificity of real-time fluorescence LAMP detection by analyzing the amplified products of J2R by 2% agarose gel electrophoresis. Lane M: DNA Marker; Lanes 1-8: monkeypox virus J2R, Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus, NTC; C represents the amplification results of the primer set of the F3L-F4L gene for real-time fluorescence LAMP detection of monkeypox virus and other viruses (Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus); D represents the specificity of real-time fluorescence LAMP detection by analyzing the amplified products of F3L-F4L by 2% agarose gel electrophoresis. Lane M: DNA Marker Marker; Lanes 1-8: monkeypox virus F3LF4L, Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus, NTC). DETAILED DESCRIPTION

[0036] The present application is further described below in conjunction with specific embodiments. The following are only a few embodiments of the present application, and are not intended to limit the present application in any form. Although the present application discloses the following preferred embodiments, they are not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the above disclosed technical content to make some changes or modifications are equivalent to equivalent implementation cases and are within the scope of the technical solution.

[0037] Unless otherwise specified, the raw materials in the examples of the present application were purchased from commercial sources and used directly without any special treatment.

[0038] Unless otherwise specified, the analysis methods in the examples all adopt conventional settings and conventional analysis methods of instruments or equipment.

[0039] Example 1

[0040] 1. LAMP primer design:

[0041] (1) Select the monkeypox virus-specific J2R gene (GenBank, ON568298.1194,505-195,554) and F3L-F4L gene (GenBank, NC_003310.1 48048-50476) as the target genes for amplification, and determine the accuracy of the gene sequences;

[0042] (2) Based on the sequence determined in step (1), a set of specific primers was designed for the specific conserved regions of the J2R gene and the F3L-F4L gene using the LAMP primer explorer online website (http: / / primer explorer.jp / lampv5e / index.html). These primers targeted 6 to 8 different regional positions, respectively. Each set of primers included a pair of F3 / B3 outer primers, a pair of FIP / BIP inner primers, and a pair of Loop F / Loop B ring primers.

[0043] The nucleotide sequences of the LAMP primer set of the monkeypox virus J2R gene used in the present invention are as follows:

[0044] F3 is shown in SEQ ID NO.1: CTCGTATATATTGTTTCTCTCATGT

[0045] B3 is shown in SEQ ID NO.2: ATTGTGAGATGTAAAGGTATCC

[0046] FIP is shown in SEQ ID NO.3:

[0047] GCTTCTGTATTCGTTGTCTTTACA-CATAATAAACGGAAGAGATAT AGCAC

[0048] BIP is shown in SEQ ID NO.4:

[0049] TCTATGTTGTCTATCGTGTCCTCC-CCACACGGTGTACATTGT

[0050] LoopF ​​is shown in SEQ ID NO.5: CCATTGGATGGTGCATGTG

[0051] LoopB is shown in SEQ ID NO.6: GGGAACTTACGCTTTCAGATTATG

[0052] The nucleotide sequences of the LAMP primer set of the monkeypox virus F3L-F4L gene used in the present invention are as follows:

[0053] F3' is shown in SEQ ID NO.7: ATCCTCTGGTGGTTCGTCG

[0054] B3' is shown in SEQ ID NO.8: CGAACCTCCATTAGTTAGACACG

[0055] FIP' is shown in SEQ ID NO.9:

[0056] AATCCATCTCCTCCAGAATCTCCAG-GAATGTAGCTCTGATTAAC CCGTC

[0057] BIP' is shown in SEQ ID NO.10:

[0058] CCTTGTTTTCATGTATCGATTGCGT-AAACAACACTTTAAGCCTCC CA

[0059] LoopF' is shown in SEQ ID NO.11: ACCAGCATCACCTATAGAT

[0060] LoopB' is shown in SEQ ID NO.12: AACATTAAGATTGCGAAATGCTCT

[0061] 2. Construction and optimization of real-time LAMP system:

[0062] The primer concentration ratio, dNTPs concentration, Mg 2+ The concentration and reaction temperature were optimized by single factor variation, and other conditions remained unchanged. The real-time LAMP reaction was performed according to the reaction system and reaction conditions before optimization, and the appropriate reaction conditions were determined by the Ct value and the fluorescence value of the amplified product.

[0063] The reference reaction conditions were set as follows: 65°C for 10 s; 65°C for 30 s, and fluorescence collection at 65°C for 30 s, for a total of 60 cycles; after the reaction, a melting curve analysis was performed on the amplified product, and the melting curve program was set as follows: heating from 75°C to 95°C at a rate of 0.1°C / 5 s, collecting a fluorescence signal once every 0.1°C increase in temperature to generate a melting curve.

[0064] The final dual real-time LAMP reaction system (25 μL) was determined as shown in Table 1.

[0065] Table 1 Dual real-time LAMP reaction system

[0066]

[0067] The dual LAMP reaction had the same reaction volume (25 μL) as the single reaction. The concentration of the dual LAMP primer set was half of that of the single reaction, while the concentrations of other components remained unchanged.

[0068] The above reaction system also includes a reaction buffer (containing 2.5 μL buffer reagent and 5 μL other reagents), specifically including: buffer reagent (2 mM MgSO4, 20 mM Tris-HCl (pH8.8@25°C), 10 mM (NH4)2SO4, 50 mM KCl, 0.1% Tween-20), other reagents (6 mM MgSO4, 0.7 M betaine).

[0069] 1 μL each of monkeypox virus plasmid J2R and F3L-F4L DNA templates, and the blank control was replaced with an equal amount of ddH2O.

[0070] After determining the optimal system for LAMP detection, proceed to the next experiment.

[0071] Example 2

[0072] 1. Establishment of real-time fluorescence LAMP system based on assimilation probe:

[0073] The analysis and identification method of amplification products relies on real-time fluorescence curves and melting temperature curves (product △Tm is around 5°C). The primer design is very difficult and cannot ensure high specificity. Traditional multiple LAMP detection technology based on enzyme digestion or Tm value has the disadvantages of cumbersome operation, high cost, and limited amplification fragment length. Assimilation probes based on the principle of fluorescence resonance energy transfer (FRET) are a highly specific sequence analysis method that can detect more than two target molecules.

[0074] The J2R probe labeled with the fluorescent group FAM is used as the first channel, and the F3L-F4L probe labeled with the fluorescent group VIC is used as the second channel. The excitation wavelength of FAM is 494nm and the emission wavelength is 518nm; the excitation wavelength of VIC is 538nm and the emission wavelength is 554nm. Both fluorescent groups can be quenched by BHQ-1. Using assimilation probes labeled with different fluorescent colors to detect J2R and F3L-F4L plasmids can distinguish different target molecules without fluorescence background interference, so it is suitable for the simultaneous detection of two nucleic acid molecules.

[0075] The nucleotide sequences of the assimilation probes used in the present invention are as follows:

[0076] J2R-LBP is shown in SEQ ID NO.13:

[0077] 5'FAM-ACGCTGAGGACCCGGATGCGAATGCGGATGCCGGATGCCGAGGGAACTTACGCTTTTCAGATTATG

[0078] F3L-F4L-LBP is shown in SEQ ID NO.14:

[0079] 5'VIC-ACGCTGAGGACCCGGATGCGAATGCGGATGCGGATGCCGAAACATTAAGATTGCGAAATGCTCT

[0080] The quench strand (quenching probe) is shown in SEQ ID NO.15:

[0081] TCGGCATCCGCATCCGCATTCGCATCCGGGTCCTCAGCGT-BHQ-13'

[0082] Based on the real-time fluorescence LAMP system established in Example 1, the optimal probe concentration ratio was determined, and qLAMP was performed at a constant concentration of assimilation probe F chain, i.e., J2R-LBP and F3L-F4L-LBP (0.08 μM) and different concentrations of assimilation probe Q chain, i.e., quenching probe (0.12, 0.16, 0.24, 0.32 and 0.40 μM).

[0083] 2. Sensitivity detection of LAMP system based on assimilation probe:

[0084] The monkeypox virus J2R and F3L-F4L DNA plasmids were serially diluted 10-fold with nuclease-free water to determine the single / dual real-time LAMP detection sensitivity of the assimilated probes.

[0085] After absolute quantification, the copy number was selected as 10 8 ~10 0 copies / μL was used as a template to verify the analytical sensitivity, and a negative control was set to perform sensitivity analysis of single / double real-time LAMP using the probe method. Figure 1 , Figure 2 and Figure 3 As shown. Multiple repeated experiments were performed to obtain the lowest detection limits of single / dual real-time fluorescence LAMP based on assimilation probes:

[0086] J2R gene: 1 copy / μL, F3L-F4L gene: 1 copy / μL.

[0087] 3. Specific detection of LAMP system based on assimilation probe:

[0088] Using J2R and F3L-F4L of monkeypox virus and other common virus positive DNA samples, the specificity of the real-time fluorescence LAMP detection method based on assimilation probes was verified. The experimental results are as follows Figure 4 As shown. Among them, Figure 4 A in the figure indicates the amplification results of real-time fluorescence LAMP detection of monkeypox virus and other viruses (Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus) using the primer set of J2R gene; Figure 4 B in the figure indicates that the specificity of real-time fluorescent LAMP detection was verified by 2% agarose gel electrophoresis analysis of J2R amplification products. Lane M: DNA Marker; Lanes 1-8: monkeypox virus J2R, Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus, NTC; Figure 4 C in the figure indicates the amplification results of real-time fluorescence LAMP detection of monkeypox virus and other viruses (Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus) using the primer set of F3L-F4L gene; Figure 4 D in the figure indicates that the F3L-F4L amplification product was analyzed by 2% agarose gel electrophoresis to verify the specificity of real-time fluorescent LAMP detection. Lane M: DNA Marker; Lanes 1-8: monkeypox virus F3LF4L, Epstein-Barr virus, human cytomegalovirus, new coronavirus, influenza A virus, adenovirus, enterovirus, NTC. The primers of J2R and F3L-F4L only amplify monkeypox virus. Samples with other viruses are not amplified, and no cross-reaction occurs. 2% agarose gel electrophoresis shows that there are no amplified bands for other viruses.

[0089] The above are only a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A primer-probe combination for detecting monkeypox virus by real-time double loop-mediated isothermal amplification, characterized in that: The primer-probe combination includes a LAMP primer set for detecting the J2R gene of the monkeypox virus, a LAMP primer set for detecting the F3L-F4L gene of the monkeypox virus, and an assimilation probe; The LAMP primer set for detecting the monkeypox virus J2R gene includes an F3 primer, a B3 primer, a FIP primer, a BIP primer, a LoopF ​​primer and a LoopB primer; The nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LoopF ​​primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LoopB primer is shown in SEQ ID NO.6; The LAMP primer set for detecting the monkeypox virus F3L-F4L gene includes an F3' primer, a B3' primer, a FIP' primer, a BIP' primer, a LoopF' primer and a LoopB' primer; The nucleotide sequence of the F3' primer is shown in SEQ ID NO.7, the nucleotide sequence of the B3' primer is shown in SEQ ID NO.8, the nucleotide sequence of the FIP' primer is shown in SEQ ID NO.9, the nucleotide sequence of the BIP' primer is shown in SEQ ID NO.10, the nucleotide sequence of the LoopF' primer is shown in SEQ ID NO.11, and the nucleotide sequence of the LoopB' primer is shown in SEQ ID NO.12; The assimilation probes include a J2R-LBP probe, a F3L-F4L-LBP probe and a quenching probe; The nucleotide sequence of the J2R-LBP probe is shown in SEQ ID NO.13, the nucleotide sequence of the F3L-F4L-LBP probe is shown in SEQ ID NO.14, and the nucleotide sequence of the quenching probe is shown in SEQ ID NO.

15.

2. The primer-probe combination for detecting monkeypox virus by real-time double loop-mediated isothermal amplification according to claim 1, characterized in that: The molar ratio of the F3 primer, the B3 primer, the FIP primer, the BIP primer, the LoopF ​​primer and the LoopB primer is: 0.2:0.2:1.2:1.2:0.8:0.8； The molar ratio of the F3' primer, the B3' primer, the FIP' primer, the BIP' primer, the LoopF' primer and the LoopB' primer is: 0.2:0.2:1.2:1.2:0.8:0.8。 3. The primer-probe combination for detecting monkeypox virus by real-time double loop-mediated isothermal amplification according to claim 1, characterized in that: The 5' end of the J2R-LBP probe is labeled with a fluorescent group FAM; The 5' end of the F3L-F4L-LBP probe is labeled with the fluorescent group VIC; The 3' end of the quencher probe is labeled with a quencher group BHQ-1.

4. The primer-probe combination for detecting monkeypox virus by real-time double loop-mediated isothermal amplification according to claim 3, characterized in that: The excitation wavelength of the fluorescent group FAM is 494nm, and the emission wavelength is 518nm; The excitation wavelength of the fluorescent group VIC is 538 nm, and the emission wavelength is 554 nm.

5. Use of the primer-probe combination according to any one of claims 1 to 4 in preparing a kit for detecting monkeypox virus.

6. A kit for detecting monkeypox virus by real-time double loop-mediated isothermal amplification, characterized in that: The kit comprises the primer-probe combination according to any one of claims 1 to 4.

7. A kit for detecting monkeypox virus by real-time double loop-mediated isothermal amplification according to claim 6, characterized in that: The kit also includes Bst2.0 DNA polymerase, dNTP mix and reaction buffer.

8. A kit for detecting monkeypox virus by real-time double loop-mediated isothermal amplification according to claim 7, characterized in that: The reaction buffer contained the following components: 8 mM MgSO4, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 0.1% Tween-20, and 0.7 M betaine.

9. A method for detecting monkeypox virus by real-time double loop-mediated isothermal amplification, characterized in that: The method comprises using the kit described in any one of claims 6 to 8 to perform a real-time double loop-mediated isothermal amplification reaction on the genomic DNA of the sample to be tested.

10. The method for detecting monkeypox virus by real-time double loop-mediated isothermal amplification according to claim 9, characterized in that: The program of the real-time double loop-mediated isothermal amplification reaction is: 65°C, 10s; 65°C, 30s; 65°C, 30s fluorescence collection, 60 cycles; Preferably, after the real-time double loop-mediated isothermal amplification reaction is completed, a step of enzyme inactivation at 85° C. for 10 min is further included.

Images