Antisense oligonucleotides targeting particle protein precursors

Abstract

The present invention provides antisense oligonucleotides for altering the splicing pattern of granulin precursors, and their use in the treatment of nervous system disorders. The antisense oligonucleotides are modified to better increase upregulation or expression recovery of exon 1-exon 2 granula protein precursor splice variants in a cell.

Description

Technical Field

[0001] The present invention relates to antisense oligonucleotides that change the splicing pattern of progranulin, and their use in treating nervous system disorders. Such antisense oligonucleotides can upregulate or restore the expression of exon 1-exon 2 progranulin splicing variants in cells. Background Art

[0002] Progranulin (PGRN) is a highly conserved secretory protein expressed in a variety of cell types, both in the CNS and peripheral tissues.

[0003] Deficiency of the secretory protein progranulin in the central nervous system causes the neurodegenerative disease frontotemporal dementia (FTD). Pathogenic progranulin mutations result in an approximately 50% loss of progranulin levels through haploinsufficiency and lead to aggregation of TDP-43 protein within neurons. Progranulin plays both supportive and protective roles in a number of processes within the brain, both cell-autonomous and non-autonomous, including neurite outgrowth, synaptic biology, responses to exogenous stressors, lysosomal function, neuroinflammation, and angiogenesis.

[0004] Progranulin regulates lysosomal function, cell growth, survival, repair, and inflammation, both directly and through conversion to granulin. Progranulin plays a major role in regulating microglial responses associated with lysosomal function in the CNS. Autosomal dominant mutations in the progranulin gene that result in haploinsufficiency of the protein are associated with familial frontotemporal dementia, with neuropathic frontotemporal lobar degeneration (FTLD), associated with accumulation of TAR-DNA binding protein of 43kDA (TDP-43) inclusions (FTLD-TDP). Homozygous GRN mutations are associated with neuronal ceroid lipofuscinosis (NCL) (Townley, et al., Neurology, 2018 Jun 12; 90(24): 1127).

[0005] Recently, mutations in the progranulin gene have been identified as the cause of approximately 5% of all FTD, including some sporadic cases. Recent studies using mouse models have elucidated the expression of progranulin in the brain (Petkau et al., 2010). Progranulin is expressed late in neurodevelopment and is localized using markers of mature neurons. Progranulin is expressed in neurons in most brain regions, with the highest levels in the thalamus, hippocampus, and cerebral cortex. Microglia also express progranulin, and expression levels are upregulated by microglial activation. Approximately 70 different progranulin gene mutations have been identified in FTD, and all mutations reduce progranulin levels or result in loss of progranulin function.

[0006] Therefore, there is a pressing need for therapeutic agents that can increase the expression and / or activity of progranulin.

[0007] For inter-gated antisense oligonucleotides, methylsulfonylphosphoramidate modification has been shown to improve the therapeutic index and duration of action (Anderson et al., Nucleic acids research, 2021), while inter-gated antisense oligonucleotide methylsulfonylphosphoramidate modification has also been shown to greatly reduce both immunostimulation and cytotoxicity (Anderson et al., Nucleic acids research, 2021). Methylsulfonylphosphoramidate bond modifications may include methylsulfonylphosphoramidate internucleotide bonds, in which, unlike other phosphoramidate and alkylphosphonate bonds, the negative charge is retained on the phosphate backbone.

[0008] Methylsulfonyl phosphoramidate oligonucleotides can also act as splice switching agents. However, previous studies have not shown improved splice switching, as evaluation of the splice switching activity of methylsulfonyl phosphoramidate oligonucleotides in fibroblasts derived from patients with spinal muscular atrophy showed no significant difference in splice switching efficacy between 2′-MOE methylsulfonyl oligonucleotides and the corresponding thiophosphate (nusinersen) oligonucleotides (Hammond et al., Nucleic Acid Therapeutics, 2021). Summary of the invention

[0009] A splice variant of progranulin that retains the 5' portion of intron 1 is expressed in the brain, such as in neurons or microglia (Capell et al. The Journal of Biological Chemistry, 2014, 289(37), 25879-25889). This splice variant includes the 5' terminal 271 nucleotides of intron 1, which totals 3823 nucleotides. The 271 nucleotide fragment of intron 1 includes two AUG sites upstream of the classic downstream AUG (open reading frame) in exon 2. Translation from these two upstream AUG sites will not encode progranulin protein, and due to premature termination codons, the transcript may undergo nonsense-mediated mRNA decay (NMD).

[0010] WO2020 / 191212 describes specific oligonucleotides that can target progranulin mRNA.

[0011] Previously, the inventors have determined that reducing the splice variant that retains the 5' portion of intron 1 increases the exon 1 and exon 2 splice variants and further increases the expression of progranulin protein. This led to the invention of antisense oligonucleotides for progranulin. These antisense oligonucleotides are capable of altering the splicing pattern of progranulin, in particular, the antisense oligonucleotides can upregulate the expression of the exon 1-exon 2 progranulin splice variant, reduce the production of the progranulin intron 1-exon 2 splice variant that retains the 5' portion of intron 1, and increase the expression of progranulin protein. These antisense oligonucleotides can be described as regulators of progranulin splicing, or as agonists of progranulin exon 1-exon 2, and can be used to restore or enhance the expression of the progranulin exon 1-exon 2 splice variant in cells.

[0012] The inventors have now surprisingly determined that this effect can be increased by including one or more methylsulfonylphosphoramidate internucleotide linkages within the antisense oligonucleotide or its contiguous nucleotide sequence.

[0013] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary, such as fully complementary, to a splicing regulatory site of a pre-mRNA transcript of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0014] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide has a length of 8 to 40 nucleotides and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary, such as fully complementary, to the splicing regulatory sites of exon 1, intron 1 and exon 2 sequences of the mRNA precursor transcript of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0015] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary to, such as fully complementary to, a human progranulin pre-mRNA transcript comprising exon 1, intron 1 and exon 2 sequences of a human progranulin pre-mRNA transcript (SEQ ID NO: 1), wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0016] The pregranulin exon 1, intron 1 and exon 2 sequences are shown below as SEQ ID NO: 1. The pregranulin exon 1 sequence (in capital letters) corresponds to the genomic Ensemble (www.ensemble.org) chromosome 17 position 44,345,123; to position 44,345,334. Intron 1 corresponds to the genomic Ensemble chromosome 17 position 44,345,335 to 44,349,157, and the exon 2 sequence (in capital letters) corresponds to the genomic Ensemble chromosome 17 position 44,349,158 to position 44,349,302.

[0017] Exon 1, intron 1 and exon 2 sequence of human progranulin mRNA precursor (SEQ ID NO: 1):

[0018]

[0019]

[0020] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least 12 nucleotides in length, which is complementary, such as fully complementary, to a splicing regulatory site of a human progranulin mRNA precursor, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0021] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 12 to 16 nucleotides in length, which is complementary, such as fully complementary, to the splicing regulatory site of the mRNA precursor of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0022] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 12 to 16 nucleotides in length and comprises a contiguous nucleotide sequence of 12 to 16 nucleotides in length, which is complementary, such as fully complementary, to a splicing regulatory site of the mRNA precursor of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0023] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 12 to 18 nucleotides in length, which is complementary, such as fully complementary, to the splicing regulatory site of the mRNA precursor of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0024] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 12 to 18 nucleotides in length and comprises a contiguous nucleotide sequence of 12 to 18 nucleotides in length, which is complementary, such as fully complementary, to the splicing regulatory site of the mRNA precursor of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0025] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length, which is complementary to, such as fully complementary to, the splicing regulatory site of human progranulin mRNA precursor, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0026] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary, such as fully complementary, to the nucleotide sequence contained in SEQ ID NO: 1, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0027] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary, such as fully complementary, to the nucleotide sequence contained within nucleotides 449 to 466 of SEQ ID NO: 1, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds.

[0028] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary to SEQ ID NO: 39, such as fully complementary, wherein the contiguous nucleotide sequence comprises one or more methylsulfonylphosphoramidate internucleotide bonds.

[0029] SEQ ID NO: 39 is a target site having the following sequence: ACCACACCATTCTTGACC

[0030] The antisense oligonucleotide can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0031] In some embodiments, the antisense oligonucleotide is 8 to 40, 12 to 40, 12 to 20, 10 to 20, 14 to 18, 12 to 18, or 16 to 18 nucleotides in length.

[0032] The length of the contiguous nucleotide sequence can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides.

[0033] In some embodiments, the contiguous nucleotide sequence has a length of at least 12 nucleotides, such as a length of 12 to 16 nucleotides or 12 to 18 nucleotides.

[0034] In some embodiments, the length of the contiguous nucleotide sequence is the same as the length of the antisense oligonucleotide.

[0035] In some embodiments, the antisense oligonucleotide consists of a contiguous nucleotide sequence.

[0036] In some embodiments, the antisense oligonucleotide is a contiguous nucleotide sequence.

[0037] In some embodiments, the contiguous nucleotide sequence is completely complementary to the nucleotide sequence contained within SEQ ID NO:1.

[0038] In some embodiments, the contiguous nucleotide sequence is fully complementary to the nucleotide sequence contained within nucleotides 449 to 466 of SEQ ID NO:1.

[0039] In some embodiments, the contiguous nucleotide sequence is fully complementary to SEQ ID NO:39.

[0040] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 8 consecutive nucleotides thereof.

[0041] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 9 consecutive nucleotides thereof.

[0042] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 10 consecutive nucleotides thereof.

[0043] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 11 consecutive nucleotides thereof.

[0044] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 12 consecutive nucleotides thereof.

[0045] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 13 consecutive nucleotides thereof.

[0046] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 14 consecutive nucleotides thereof.

[0047] In some embodiments, the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, ID NO: 37 and SEQ ID NO: 38, or at least 15 consecutive nucleotides thereof.

[0048] In some embodiments, the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, NO:37 and SEQ ID NO:38.

[0049] In some embodiments, the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37.

[0050] In some embodiments, the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NO:11, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:28, SEQ ID NO:31, and SEQ ID NO:35.

[0051] In some embodiments, the contiguous nucleotide sequence is SEQ ID NO:11.

[0052] In some embodiments, the contiguous nucleotide sequence is SEQ ID NO:15.

[0053] In some embodiments, the contiguous nucleotide sequence is SEQ ID NO:16.

[0054] In some embodiments, the contiguous nucleotide sequence is SEQ ID NO:28.

[0055] In some embodiments, the contiguous nucleotide sequence is SEQ ID NO:31.

[0056] In some embodiments, the contiguous nucleotide sequence is SEQ ID NO:35.

[0057] In some embodiments, the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or more methylsulfonylphosphoramidate internucleotide linkages.

[0058] In some embodiments, the contiguous nucleotide sequence comprises 1 or more methylsulfonylphosphoramidate internucleotide linkages.

[0059] In some embodiments, the contiguous nucleotide sequence comprises 2 or more methylsulfonylphosphoramidate internucleotide linkages.

[0060] In some embodiments, the contiguous nucleotide sequence comprises 3 or more methylsulfonylphosphoramidate internucleotide linkages.

[0061] In some embodiments, the contiguous nucleotide sequence comprises 4 or more methylsulfonylphosphoramidate internucleotide linkages.

[0062] In some embodiments, the contiguous nucleotide sequence comprises 5 or more methylsulfonylphosphoramidate internucleotide linkages.

[0063] In some embodiments, the contiguous nucleotide sequence comprises 6 or more methylsulfonylphosphoramidate internucleotide linkages.

[0064] In some embodiments, the contiguous nucleotide sequence comprises 7 or more methylsulfonylphosphoramidate internucleotide linkages.

[0065] In some embodiments, the contiguous nucleotide sequence comprises 8 or more methylsulfonylphosphoramidate internucleotide linkages.

[0066] In some embodiments, the contiguous nucleotide sequence comprises 9 or more methylsulfonylphosphoramidate internucleotide linkages.

[0067] In some embodiments, the contiguous nucleotide sequence comprises 10 or more methylsulfonylphosphoramidate internucleotide linkages.

[0068] In some embodiments, the contiguous nucleotide sequence comprises 11 or more methylsulfonylphosphoramidate internucleotide linkages.

[0069] In some embodiments, the contiguous nucleotide sequence comprises 12 or more methylsulfonylphosphoramidate internucleotide linkages.

[0070] In some embodiments, the contiguous nucleotide sequence comprises 13 or more methylsulfonylphosphoramidate internucleotide linkages.

[0071] In some embodiments, the contiguous nucleotide sequence comprises 14 or more methylsulfonylphosphoramidate internucleotide linkages.

[0072] In some embodiments, the contiguous nucleotide sequence comprises 15 or more methylsulfonylphosphoramidate internucleotide linkages.

[0073] In some embodiments, the contiguous nucleotide sequence comprises 16 or more methylsulfonylphosphoramidate internucleotide linkages.

[0074] In some embodiments, the contiguous nucleotide sequence comprises 17 or more methylsulfonylphosphoramidate internucleotide linkages.

[0075] In some embodiments, the contiguous nucleotide sequence comprises one or more phosphorothioate internucleotide linkages.

[0076] In some embodiments, the contiguous nucleotide sequence comprises a plurality of phosphorothioate internucleotide linkages, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages.

[0077] In some embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the internucleotide linkages of a contiguous nucleotide sequence are modified.

[0078] In some embodiments, all internucleotide linkages between nucleotides of a contiguous nucleotide sequence are modified.

[0079] In some embodiments, all internucleotide linkages present in the antisense oligonucleotide are selected from phosphorothioate internucleotide linkages and methylsulfonylphosphoramidate internucleotide linkages.

[0080] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises one or more modified nucleosides.

[0081] In some embodiments, the contiguous nucleotide sequence comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0082] In some embodiments, the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2′-O-methoxyethyl-RNA (2′-MOE) nucleosides.

[0083] In some embodiments, the contiguous nucleotide sequence comprises at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% 2′-O-methoxyethyl-RNA (2′-MOE) nucleosides.

[0084] In some embodiments, the nucleosides of the contiguous nucleotide sequence are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0085] The present invention provides an isolated, purified or manufactured antisense oligonucleotide.

[0086] In some embodiments, the antisense oligonucleotide is or comprises a mixed or full polymer of antisense oligonucleotides.In some embodiments, the contiguous nucleotide sequence is a mixed or full polymer.

[0087] The invention provides a conjugate comprising an antisense oligonucleotide according to the invention and at least one conjugate moiety covalently linked to the antisense oligonucleotide.

[0088] The present invention provides antisense oligonucleotides covalently linked to at least one conjugate moiety.

[0089] The present invention provides a pharmaceutically acceptable salt of an antisense oligonucleotide according to the invention or a conjugate according to the invention.

[0090] The present invention provides an antisense oligonucleotide according to the present invention, wherein the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.

[0091] In some embodiments, the pharmaceutically acceptable salt is a sodium salt, a potassium salt, or an ammonium salt.

[0092] The present invention provides a pharmaceutically acceptable sodium salt of an antisense oligonucleotide according to the invention or a conjugate according to the invention.

[0093] The present invention provides a pharmaceutically acceptable potassium salt of an antisense oligonucleotide according to the invention or a conjugate according to the invention.

[0094] The present invention provides a pharmaceutically acceptable ammonium salt of an antisense oligonucleotide according to the invention or a conjugate according to the invention.

[0095] The present invention provides a pharmaceutical composition comprising: the antisense oligonucleotide of the present invention, or the conjugate of the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0096] The present invention provides a pharmaceutical composition comprising: the antisense oligonucleotide of the present invention, or the conjugate of the present invention, and a pharmaceutically acceptable salt. For example, the salt may comprise a metal cation, such as a sodium salt, a potassium salt or an ammonium salt.

[0097] The present invention provides a pharmaceutical composition according to the present invention, wherein the pharmaceutical composition comprises: the antisense oligonucleotide of the present invention or the conjugate of the present invention, or the pharmaceutically acceptable salt of the present invention, and an aqueous diluent or solvent.

[0098] The invention provides a solution of the antisense oligonucleotide of the invention or the conjugate of the invention, or a pharmaceutically acceptable salt of the invention, such as phosphate buffered saline. Suitably, the solution of the invention, such as phosphate buffered saline solution, is a sterile solution.

[0099] The present invention provides a method for enhancing the expression of exon 1-exon 2 progranulin splice variant in a cell expressing progranulin, the method comprising administering to the cell an effective amount of an antisense oligonucleotide of the present invention or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention. In some embodiments, the method is an in vitro method. In some embodiments, the method is an in vivo method.

[0100] In some embodiments, the cell is a human cell or a mammalian cell.

[0101] The present invention provides a method for treating or preventing progranulin haploinsufficiency or a related disorder, comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the pharmaceutical composition of the present invention to a subject suffering from or susceptible to progranulin haploinsufficiency or a related disorder.

[0102] The present invention provides a method for treating or preventing a nervous system disease, comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention to a subject suffering from or susceptible to a nervous system disease. In one embodiment, the nervous system disease may be a TDP-43 pathological condition.

[0103] The present invention provides an antisense oligonucleotide of the present invention for use as a medicament.

[0104] The present invention provides an antisense oligonucleotide of the present invention for use in therapy.

[0105] The present invention provides an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention for use as a medicament.

[0106] The present invention provides an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention for use in therapy.

[0107] The present invention provides an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention for use in treating a nervous system disease. In one embodiment, the nervous system disease may be a TDP-43 pathological condition.

[0108] The present invention provides an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention for use in treating or preventing progranulin haploinsufficiency or related disorders.

[0109] The present invention provides the use of the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the pharmaceutical composition of the present invention for preparing a medicament for treating or preventing a nervous system disease. In one embodiment, the nervous system disease may be a TDP-43 pathological condition.

[0110] The present invention provides use of the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the pharmaceutical composition of the present invention for preparing a medicament for treating or preventing progranulin haploinsufficiency or related disorders.

[0111] In some embodiments, the methods, uses or antisense oligonucleotides for use of the invention are used to treat frontotemporal dementia (FTD), neuropathic frontotemporal lobar degeneration or neuroinflammation. In other embodiments, the methods, uses or antisense oligonucleotides for use of the invention are used to treat amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine disease, spinocerebellar ataxia type 3, myopathy or chronic traumatic encephalopathy.

[0112] In one aspect, the invention includes an oligonucleotide progranulin agonist having the following structure:

[0113]

[0114] In one aspect, the invention includes an oligonucleotide progranulin agonist having the following structure:

[0115]

[0116] In one aspect, the invention includes an oligonucleotide progranulin agonist having the following structure:

[0117]

[0118] In one aspect, the invention includes an oligonucleotide progranulin agonist having the following structure:

[0119]

[0120] In one aspect, the invention includes an oligonucleotide progranulin agonist having the following structure:

[0121]

[0122] In one aspect, the invention includes an oligonucleotide progranulin agonist having the following structure:

[0123]

[0124] On the other hand, the present invention includes an antisense oligonucleotide, wherein the oligonucleotide is an oligonucleotide compound GGTCAAGAATGGTGTGGT (SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31 or SEQ ID NO: 35), wherein all nucleosides are 2′-O-methoxyethyl-RNA (2′-MOE) nucleosides, C is 5-methylcytosine, and all nucleoside bonds are selected from thiophosphate nucleoside bonds and methylsulfonylphosphoramidate nucleoside bonds.

[0125] In another aspect, the present invention includes an antisense oligonucleotide, wherein the oligonucleotide is an oligonucleotide compound GGTCAAGAATGGTGTGGT (SEQ ID NO: 2), wherein all nucleosides are 2′-0-methoxyethyl-RNA (2′-MOE) nucleosides, C is 5-methylcytosine, and all internucleoside bonds are methylsulfonylphosphoramidate internucleoside bonds. BRIEF DESCRIPTION OF THE DRAWINGS

[0126] Figure 1a: ddPCR data quantifying the abundance of 5′UTR splice variants with intron 1 retention in GRN mRNA after 5 days of stripping in microglia relative to PBS-treated cells. Grey bars quantify the abundance of splice variants with intron 1 retention (Int1-Ex2) after treatment with 3 μM, and black bars quantify the abundance of splice variants with intron 1 retention (Int1-Ex2) after treatment with 10 μM.

[0127] Figure 1b : ddPCR data quantifying the abundance of 5′UTR Exon1-Exon2 splice variants in GRN mRNA after 5 days of stripping in microglia relative to PBS-treated cells. The gray bar quantifies the abundance of splice variants Exon1-Exon2 (Ex1-Ex2) after treatment with 3 μM, and the black bar quantifies the abundance of splice variants Exon1-Exon2 (Ex1-Ex2) after treatment with 10 μM.

[0128] definition

[0129] Oligonucleotides

[0130] As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides as generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0131] Oligonucleotides are usually prepared in the laboratory by solid phase chemical synthesis followed by purification and isolation. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of covalently linked nucleotides or nucleobase portions of nucleosides or modifications thereof.

[0132] The oligonucleotides of the present invention are man-made and chemically synthesized, and are generally purified or isolated.

[0133] The oligonucleotides of the invention may comprise one or more modified nucleosides, such as 2'-MOE nucleosides, and may further comprise one or more additional or additional modified nucleosides, such as 2' sugar modified nucleosides.

[0134] The oligonucleotides of the invention may comprise one or more modified internucleoside linkages, such as one or more methylsulfonylphosphoramidate internucleoside linkages and one or more phosphorothioate internucleoside linkages.

[0135] Antisense Oligonucleotides

[0136] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of modulating the expression of a target gene by hybridizing to a target nucleic acid, particularly to a contiguous sequence on the target nucleic acid.

[0137] Antisense oligonucleotides are not double-stranded in nature and are therefore not siRNAs or shRNAs.

[0138] The antisense oligonucleotides of the invention may be single-stranded. It will be appreciated that single-stranded oligonucleotides of the invention may form hairpin or intermolecular duplex structures (a duplex between two molecules of the same oligonucleotide) as long as the degree of self-complementarity within or between them is less than about 50% across the entire length of the oligonucleotide.

[0139] In some cases, the antisense oligonucleotides of the present invention may be referred to as oligonucleotides.

[0140] In some embodiments, the single-stranded antisense oligonucleotides of the invention may be free of RNA nucleosides.

[0141] Advantageously, the antisense oligonucleotides of the invention comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides. Furthermore, in some antisense oligonucleotides of the invention, it may be advantageous that the unmodified nucleosides are DNA nucleosides.

[0142] Continuous nucleotide sequence

[0143] The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid, which may be or may include an oligonucleotide motif sequence. In this article, the term is used interchangeably with "contiguous nucleobase sequence".

[0144] In certain embodiments, all nucleosides of oligonucleotide constitute continuous nucleotide sequence.Continuous nucleotide sequence is the sequence of nucleotides in oligonucleotide of the present invention, and it is complementary to target nucleic acid or target sequence or target site sequence, and in some cases is completely complementary.Term " target nucleic acid ", " target sequence " and " target site sequence " can be used interchangeably to refer to the sequence that is combined by continuous nucleotide sequence.

[0145] In some embodiments, the target sequence is SEQ ID NO:1.

[0146] SEQ ID NO: 1 is the sequence of exon 1, intron 1 and exon 2 of the human progranulin pre-mRNA transcript.

[0147] In some embodiments, the target sequence is or comprises nucleotide 449 to nucleotide 466 of SEQ ID NO:1.

[0148] In some embodiments, the target sequence is or comprises SEQ ID NO:39.

[0149] In some embodiments, the target sequence is SEQ ID NO:39.

[0150] In some embodiments, the target sequence comprises SEQ ID NO:39.

[0151] In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence and may optionally comprise additional one or more nucleotides, such as a nucleotide linker region that can be used to attach a functional group (eg, a conjugate group) to the contiguous nucleotide sequence.

[0152] The nucleotide linker region may be complementary or non-complementary to the target nucleic acid.It is understood that the contiguous nucleotide sequence of the oligonucleotide cannot be longer than the oligonucleotide itself, and the oligonucleotide cannot be shorter than the contiguous nucleotide sequence.

[0153] Splicing regulatory sites

[0154] As used herein, the term "splicing regulatory site" is defined as a site within a pre-mRNA transcript that affects the splicing of the pre-mRNA.

[0155] In some embodiments, the splicing regulatory site can regulate the splicing of one or more of exon 1, intron 1, and exon 2 of the human progranulin pre-mRNA transcript.

[0156] Nucleotides and nucleosides

[0157] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a core base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0158] Modified nucleotides

[0159] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications to the sugar moiety or the (nucleo)base moiety.

[0160] The antisense oligonucleotide of the present invention may comprise a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides.

[0161] The antisense oligonucleotides of the invention may comprise a contiguous nucleotide sequence comprising one or more further or additional modified nucleosides comprising a modified sugar moiety.

[0162] The term modified nucleosides is also used herein interchangeably with the terms "nucleoside analogs" or modified "units" or modified "monomers." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides.

[0163] Nucleosides with modifications in the base region of a DNA or RNA nucleoside are generally still referred to as DNA or RNA if they permit Watson Crick base pairing.

[0164] Exemplary modified nucleosides that can be used in the compounds of the invention include LNA, 2'-O-MOE, and morpholino nucleoside analogs.

[0165] Methylsulfonylphosphoramidate internucleotide linkage

[0166] The contiguous nucleotide sequence of the antisense oligonucleotide of the present invention comprises one or more modified internucleoside linkages, which are methylsulfonylphosphoramidate internucleoside linkages.

[0167] One of the non-bridging oxygen atoms in the phosphodiester bond of the methylsulfonylphosphoramidate internucleoside linkage is replaced with a methylsulfonylamino group, and this linkage differs from other phosphoramidate and alkylphosphonate linkages in that it retains the negative charge on the phosphate backbone but lacks the negatively charged sulfur atom, which is the primary pharmacophore for ASO-protein interactions.

[0168] In the literature, the methylsulfonyl phosphoramidate internucleoside bond may also be referred to as methylsulfonyl phosphoramidate, methylsulfonyl phosphoramidate or N-methylsulfonyl phosphoramidate, where methylsulfonyl is an abbreviation for methylsulfonyl, and "N-" specifies that the position of the methylsulfonyl group is on nitrogen. These terms may be used interchangeably herein.

[0169] In some embodiments, at least 50% of the internucleoside bonds in the antisense oligonucleotide or its contiguous nucleotide sequence are methylsulfonyl groups, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 90%, such as at least 95% or more of the internucleoside bonds in the antisense oligonucleotide or its contiguous nucleotide sequence are methylsulfonyl groups.

[0170] In some embodiments, the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or more methylsulfonylphosphoramidate internucleotide linkages.

[0171] In some embodiments, the contiguous nucleotide sequence comprises 1 or more methylsulfonylphosphoramidate internucleotide linkages.

[0172] In some embodiments, the contiguous nucleotide sequence comprises 2 or more methylsulfonylphosphoramidate internucleotide linkages.

[0173] In some embodiments, the contiguous nucleotide sequence comprises 3 or more methylsulfonylphosphoramidate internucleotide linkages.

[0174] In some embodiments, the contiguous nucleotide sequence comprises 4 or more methylsulfonylphosphoramidate internucleotide linkages.

[0175] In some embodiments, the contiguous nucleotide sequence comprises 5 or more methylsulfonylphosphoramidate internucleotide linkages.

[0176] In some embodiments, the contiguous nucleotide sequence comprises 6 or more methylsulfonylphosphoramidate internucleotide linkages.

[0177] In some embodiments, the contiguous nucleotide sequence comprises 7 or more methylsulfonylphosphoramidate internucleotide linkages.

[0178] In some embodiments, the contiguous nucleotide sequence comprises 8 or more methylsulfonylphosphoramidate internucleotide linkages.

[0179] In some embodiments, the contiguous nucleotide sequence comprises 9 or more methylsulfonylphosphoramidate internucleotide linkages.

[0180] In some embodiments, the contiguous nucleotide sequence comprises 10 or more methylsulfonylphosphoramidate internucleotide linkages.

[0181] In some embodiments, the contiguous nucleotide sequence comprises 11 or more methylsulfonylphosphoramidate internucleotide linkages.

[0182] In some embodiments, the contiguous nucleotide sequence comprises 12 or more methylsulfonylphosphoramidate internucleotide linkages.

[0183] In some embodiments, the contiguous nucleotide sequence comprises 13 or more methylsulfonylphosphoramidate internucleotide linkages.

[0184] In some embodiments, the contiguous nucleotide sequence comprises 14 or more methylsulfonylphosphoramidate internucleotide linkages.

[0185] In some embodiments, the contiguous nucleotide sequence comprises 15 or more methylsulfonylphosphoramidate internucleotide linkages.

[0186] In some embodiments, the contiguous nucleotide sequence comprises 16 or more methylsulfonylphosphoramidate internucleotide linkages.

[0187] In some embodiments, the contiguous nucleotide sequence comprises 17 or more methylsulfonylphosphoramidate internucleotide linkages.

[0188] Advantageously, all internucleoside bonds in a contiguous nucleotide sequence of an antisense-oligonucleotide may be methylsulfonyl groups, or all internucleoside bonds of an antisense-oligonucleotide may be methylsulfonyl bonds.

[0189] Modified internucleoside bonds

[0190] The continuous nucleotide sequence of antisense-oligonucleotide of the present invention can comprise one or more modified internucleoside bonds.It is obvious to the technician that, because the continuous nucleotide sequence of antisense-oligonucleotide of the present invention must comprise one or more methylsulfonylphosphoramidate internucleoside bonds, alternatively modified internucleoside bonds will be other modified internucleoside bonds.

[0191] As is generally understood by those skilled in the art, the term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that can covalently link two nucleosides together.

[0192] In some embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the internucleotide linkages of a contiguous nucleotide sequence are modified.

[0193] In some embodiments, all internucleotide linkages between nucleotides of a contiguous nucleotide sequence are modified.

[0194] In some embodiments, the contiguous nucleotide sequence comprises one or more phosphorothioate internucleotide linkages.

[0195] In some embodiments, the contiguous nucleotide sequence comprises a plurality of phosphorothioate internucleotide linkages, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages.

[0196] In some embodiments, all internucleotide linkages present in the antisense oligonucleotide are selected from phosphorothioate internucleotide linkages and methylsulfonylphosphoramidate internucleotide linkages.

[0197] Nucleobase

[0198] The term nucleobase includes purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine) present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses modified nucleobases that are different from naturally occurring nucleobases but functional during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Supplement 371.4.1.

[0199] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2′-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0200] The nucleobase moiety may be represented by a letter code for each corresponding nucleobase, such as A, T, G, C or U, wherein each letter may optionally include a functionally equivalent modified nucleobase. For example, in an exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C and 5-methylcytosine. Optionally, a 5-methylcytosine LNA nucleoside may be used in the LNA spacer.

[0201] Modified oligonucleotides

[0202] The antisense oligonucleotide of the present invention may be a modified oligonucleotide.

[0203] The term modified oligonucleotide describes a kind of oligonucleotide, and it comprises one or more sugar-modified nucleosides and / or the internucleoside bond of modification.Term " chimeric oligonucleotide " is the term used in the literature to describe the oligonucleotide comprising sugar-modified nucleosides and DNA nucleosides.In certain embodiments, it may be advantageous that antisense oligonucleotide of the present invention is a chimeric oligonucleotide.

[0204] Complementarity

[0205] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U).

[0206] It will be understood that oligonucleotides may contain nucleosides with modified nucleobases, for example 5-methylcytosine is often used in place of cytosine, and thus the term complementarity includes Watson Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 371.4.1).

[0207] As used herein, the term "complementarity percentage" refers to the ratio of nucleotides (expressed as a percentage) of a continuous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence or sequence motif), which spans a continuous nucleotide sequence. Therefore, the number of aligned nucleobases that are complementary (forming Watson Crick base pairs) between the two sequences (when aligned with the oligonucleotide sequences of the target sequence 5'-3' and 3'-5') is divided by the total number of nucleotides in the oligonucleotide and then multiplied by 100 to calculate the percentage of complementarity. In such comparisons, nucleobases / nucleotides that are not aligned (forming base pairs) are called mismatches. Insertions and deletions are not allowed in the calculation of the % complementarity of continuous nucleotide sequences. It should be understood that when determining complementarity, as long as the functional ability of the nucleobases forming Watson Crick base pairing is retained, the chemical modification of the nucleobase is not considered (e.g., when calculating the percentage of complementarity, 5'-methylcytosine is considered to be the same as cytosine).

[0208] In the present invention, the term "complementary" requires that the antisense oligonucleotide is at least about 80% complementary to the pre-mRNA transcript of human progranulin, or at least about 90% complementary. In some embodiments, the antisense oligonucleotide may be at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% complementary to the pre-mRNA transcript of human progranulin. In other words, for some embodiments, the antisense oligonucleotide of the present invention may include one, two, three or more mismatches, wherein a mismatch is a nucleotide within the antisense oligonucleotide of the present invention that does not base-pair with its target.

[0209] The term "fully complementary" refers to 100% complementarity.

[0210] The antisense oligonucleotides of the present invention are complementary to the pre-mRNA of human progranulin. The antisense oligonucleotides of the present invention are advantageously complementary to the intron 1 sequence of the pre-mRNA transcript of human progranulin. The sequence of exon 1, intron 1 and exon 2 of the pre-mRNA transcript of human progranulin is exemplified herein as SEQ ID NO: 1. SEQ ID NO: 1 provided herein is a reference sequence, and it is understood that the target progranulin nucleic acid can be an allelic variant of SEQ ID NO: 1, such as an allelic variant comprising one or more polymorphisms in the human progranulin nucleic acid sequence.

[0211] Identity

[0212] As used herein, the term "identity" refers to the proportion (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (eg, an oligonucleotide) that are identical to a reference sequence (eg, a sequence motif) across the contiguous nucleotide sequence.

[0213] Therefore, the percentage of identity is calculated by counting the number of aligned nucleobases that are identical (matched) in the two sequences (in the continuous nucleotide sequence of the compound of the present invention and in the reference sequence), dividing the number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, the percentage of identity = (number of matches x 100) / length of the alignment region (e.g., continuous nucleotide sequence). Insertions and deletions are not allowed in the calculation of the percentage of identity of continuous nucleotide sequences. It should be understood that when determining identity, chemical modifications of nucleobases are not considered (e.g., when calculating the percentage of identity, 5-methylcytosine is considered to be the same as cytosine).

[0214] Hybridization

[0215] As used herein, the term "hybridizing" (hybridizing / hybridizes) should be understood as the formation of hydrogen bonds between base pairs on opposite strands of two nucleic acid chains (e.g., an antisense oligonucleotide and a target nucleic acid), thereby forming a duplex. The binding affinity between two nucleic acid chains is the strength of the hybridization. It is usually described by the melting temperature (Tm), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, Tm and affinity are not strictly proportional (Mergny and Lacroix, 2003, Oligonucleotides 13: 515-537). The standard state Gibbs free energy ΔG° is a more accurate expression of the binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG°=-RTln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction in which the aqueous concentration is 1 M, the pH is 7, and the temperature is 37°C. The hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and the ΔG° of a spontaneous reaction is less than zero. ΔG° can be measured experimentally, for example, by utilizing an isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov. Today. The skilled person will know that commercial equipment can be used for ΔG° measurements. ΔG° can also be estimated numerically by using the nearest neighbor model as described by Santa Lucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465, using as appropriate the derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34: 11211-11216 and McTigue et al., 2004, Biochemistry 43: 5388-5405.

[0216] In some embodiments, antisense oligonucleotides of the invention hybridize to target nucleic acids with estimated ΔG° values ​​of less than -10 kcal for oligonucleotides of 10 to 30 nucleotides in length.

[0217] In some embodiments, the degree or intensity of the hybridization is measured by the standard state Gibbs free energy ΔG °. For oligonucleotides of 8 to 30 nucleotides in length, the oligonucleotide can be hybridized with the target nucleic acid at an estimated ΔG ° value of less than -10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In some embodiments, the oligonucleotide hybridizes with the target nucleic acid at an estimated ΔG ° value of -10 to -60 kcal, such as -12 to -40 kcal, such as -15 to -30 kcal or -16 to -27 kcal, such as -18 to -25 kcal.

[0218] High affinity modified nucleosides

[0219] A high affinity modified nucleoside is a modified nucleoside that, when incorporated into the oligonucleotide, can enhance the affinity of the oligonucleotide for its complementary target, as measured by the melting temperature (Tm). The high affinity modified nucleosides of the present invention preferably increase the melting temperature of each modified nucleoside by between +0.5°C and +12°C, more preferably between +1.5°C and +10°C and most preferably between +3°C and +8°C. Many high affinity modified nucleosides are known in the art, and include, for example, many 2' substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier & Altmann, 1997, Nucl. Acid Res., 25, 4429-4443 and Uhlmann, 2000, Curr. Opinion in Drug Development, 3 (2), 293-213).

[0220] Sugar modification

[0221] A number of modified nucleosides having a ribose moiety have been produced, primarily for the purpose of improving certain properties of the oligonucleotide, such as affinity and / or nuclease resistance.

[0222] The present invention relates to the modification of the present invention. These modifications include such modifications, wherein the ribose ring structure is modified, such as substituted with a hexose ring (HNA) or a bicyclo, which usually has a bicyclo of a diradicle bridge (biradicle bridge) between the C2 and C4 carbon atoms on the ribose ring (LNA), or usually lacks the unconnected ribose ring (such as UNA) of a key between the C2 and C3 carbon atoms. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO201 1 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which sugar moieties are substituted with non-sugar moieties, such as with regard to peptide nucleic acids (PNA) or morpholino nucleic acids.

[0223] Sugar modifications also include modifications by changing the substituents on the ribose ring to groups other than hydrogen or the 2'-OH group naturally present in DNA and RNA nucleosides. For example, substituents may be introduced at the 2', 3', 4' or 5' positions.

[0224] 2′ sugar-modified nucleosides

[0225] A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or contains a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon atom in the ribose ring, such as an LNA (2'-4' diradical bridged) nucleoside.

[0226] In fact, the development of 2' sugar substituted nucleosides has received extensive attention, and many 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2' modified sugar can provide enhanced binding affinity to the oligonucleotide and / or increased nuclease resistance.

[0227] Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann, 1997, Nucl. Acid Res., 25, 4429-4443 and Uhlmann, 2000, Curr. Opinion in Drug Development, 3 (2), 293-213, and Deleavey and Damha, 2012, Chemistry and Biology, 19, 937. Below are schematic diagrams of some 2' substituted modified nucleosides.

[0228]

[0229] With respect to the present invention, 2'-substituted sugar modified nucleosides do not include 2' bridged nucleosides like LNA.

[0230] Locked Nucleoside Nucleosides (LNA Nucleosides)

[0231] "LNA nucleosides" are 2'-modified nucleosides that contain a diradical (also referred to as a "2'-4' bridge") linking the C2' and C4' ribose sugar rings of the nucleoside, which constrains or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNAs are incorporated into oligonucleotides for complementary RNA or DNA molecules, locking the conformation of the ribose is associated with increased hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0232] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., 2010, J. Org. Chem., Vol. 75(5), pp. 1569-81, and Mitsuoka et al., 2009, Nucleic Acids Research, 37(4), 1225-1238, and Wan and Seth, 2016, J. Medical Chemistry, 59, 9645-9667.

[0233] By way of further non-limiting illustration, exemplary LNA nucleosides are disclosed in Scheme 1.

[0234] Scenario 1:

[0235]

[0236] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET), and ENA.

[0237] A particularly advantageous LNA is β-D-oxy-LNA.

[0238] Morpholino oligonucleotides

[0239] In some embodiments, the antisense oligonucleotides of the invention comprise or consist of morpholino nucleosides (i.e., are morpholino oligomers and as phosphodiamidate morpholino oligomers (PMOs)). Splicing-modulating morpholino oligonucleotides have been approved for clinical use - see, for example, eteplirsen, a 30nt morpholino oligonucleotide targeting a frameshift mutation in DMD, for the treatment of Duchenne muscular dystrophy. Morpholino oligonucleotides have a nucleobase attached to a six-membered morpholine ring instead of a ribose, such as a methylene morpholine ring connected by a phosphodiamidate group, for example, as illustrated by the following 4 consecutive morpholino nucleotides:

[0240]

[0241] In some embodiments, a morpholino oligonucleotide of the invention can be, for example, 20 to 40 morpholino nucleotides in length, such as 25 to 35 morpholino nucleotides in length.

[0242] RNase H activity and recruitment

[0243] The RNase H activity of an antisense oligonucleotide refers to the ability to recruit RNase H when the antisense oligonucleotide is in a duplex with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Generally, an oligonucleotide is considered to be able to recruit RNase H if, when provided with a complementary target nucleic acid sequence, the oligonucleotide has an initial rate (as measured in pmol / l / min) of at least 5%, such as at least 10%, at least 20% or more than 20% of the initial rate determined when using a modified oligonucleotide having the same base sequence as the tested oligonucleotide, but only containing DNA monomers with phosphorothioate bonds between all monomers in the oligonucleotide, and using the methods provided in Examples 91 to 95 of WO01 / 23613 (hereby incorporated by reference). For use in determining RHase H activity, recombinant RNase H1 from Lubio Science GmbH, Lucerne, Switzerland is available.

[0244] It is known that DNA oligonucleotides can effectively recruit RNase H, as do gapmer oligonucleotides, which comprise a region of DNA nucleosides (usually at least 5 or 6 consecutive DNA nucleosides) flanked 5' and 3' by regions comprising 2' sugar-modified nucleosides (usually high affinity 2' sugar-modified nucleosides, such as 2-O-MOE and / or LNA). For efficient regulation of splicing, degradation of pre-mRNA is undesirable, and therefore, RNase H degradation of the target is preferably avoided. Therefore, the antisense oligonucleotides of the present invention are not RNase H recruiting gapmer oligonucleotides.

[0245] RNase H recruitment can be avoided by limiting the number of consecutive DNA nucleotides in the oligonucleotide, so that a full-polymer design can be used.

[0246] Polymers and Polymers

[0247] For splicing regulation, it is usually advantageous to use antisense oligonucleotides that do not raise RNase H. Since RNase H activity requires a continuous sequence of DNA nucleotides, the RNase H activity of antisense oligonucleotides can be achieved by designing antisense oligonucleotides that do not include more than 3 or more than 4 continuous DNA nucleosides. This can be achieved by using antisense oligonucleotides or their continuous nucleoside regions (which include sugar-modified nucleosides, such as 2' sugar-modified nucleosides) and short DNA nucleoside regions (such as 1, 2 or 3 DNA nucleosides) with a mixed polymer design. Mixed polymers are illustrated in this article by "every two" design (wherein nucleosides alternate between 1 LNA and 1 DNA nucleosides, such as LDLDLDLDLDLDLDLL, with 5' end and 3' end LNA nucleosides) and "every three" design (such as LDDLDDLDDLDDLDDL, wherein every three nucleosides are LNA nucleosides).

[0248] Holopolymers are antisense oligonucleotides or contiguous nucleotide sequences thereof that contain no DNA or RNA nucleosides, and may, for example, contain only 2'-O-MOE nucleosides, such as full MOE phosphorothioate, e.g., MMMMMMMMMMMMMMMMMMMM, where M=2'-O-MOE, which is reported as a potent splicing modulator for therapeutic use.

[0249] Alternatively, the mixed polymer may comprise a mixture of modified nucleosides, such as MLMLMLMLMLMLMLMLMLMLML, wherein L=LNA and M=2'-O-MOE nucleosides. Advantageously, the internucleosides in the mixed polymer and the full polymer may include one or more phosphorothioate internucleotide bonds and one or more methylsulfonyl phosphoramidate internucleotide bonds, or the majority of the nucleoside bonds in the mixed polymer may be phosphorothioate internucleotide bonds and methylsulfonyl phosphoramidate internucleotide bonds. The mixed polymer and the full polymer may comprise other internucleoside bonds, such as phosphodiester or phosphorothioate (as an example).

[0250] Region D' or D" in an oligonucleotide

[0251] In some embodiments, the antisense oligonucleotides of the present invention may comprise or consist of a continuous nucleotide sequence of an oligonucleotide that is complementary to a target nucleic acid (such as a full polymer region) and additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be complementary to the target nucleic acid, such as fully complementary. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0252] For the purpose of joining a contiguous nucleotide sequence (such as a full polymer) to a conjugate moiety or another functional group, the added region D′ or D″ can be used. When used to join a contiguous nucleotide sequence to a conjugate moiety, it can be used as a biocleavable linker. Alternatively, it can be used to provide exonuclease protection or for synthesis or manufacturing.

[0253] Region D' or D" may independently contain or have 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, such as DNA or RNA or base-modified versions thereof. The D' or D" region can be used as a nuclease-sensitive, biocleavable linker (see the definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked to a phosphodiester bond and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO2014 / 076195, for example, they may be phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in poly-oligonucleotide construction is disclosed in WO2015 / 113922, in which they are used to connect multiple antisense structures in a single oligonucleotide.

[0254] In one embodiment, the antisense oligonucleotide of the present invention further comprises a region D′ and / or D″ in addition to the continuous nucleotide sequence constituting the full polymer.

[0255] In some embodiments, the internucleoside bond between region D' or D" and the full polymer region is a phosphodiester bond.

[0256] Conjugate

[0257] The present invention includes an antisense oligonucleotide covalently linked to at least one conjugate moiety. In some embodiments, this may be referred to as a conjugate of the present invention.

[0258] As used herein, the term "conjugate" refers to an antisense oligonucleotide covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety can be covalently linked to the antisense oligonucleotide, optionally via a linker (such as region D' or D") group.

[0259] Oligonucleotide conjugates and their synthesis have been reported in a comprehensive review by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Chapter 16, Marcel Dekker, Inc., 2001 and by Manoharan, 2002, Antisense and Nucleic Acid Drug Development, 12, 103.

[0260] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a drug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0261] Connectors

[0262] A bond or linker is a connection between two atoms that connects one target chemical group or segment to another target chemical group or segment via one or more covalent bonds. The conjugate moiety can be attached to the antisense oligonucleotide directly or through a linker (e.g., a linker or tether). The linker can covalently link a third region, such as a conjugate moiety (region C), to a first region, such as an oligonucleotide or a continuous nucleotide sequence complementary to the target nucleic acid (region A).

[0263] In some embodiments of the present invention, the conjugate or antisense oligonucleotide conjugate of the present invention may optionally include a linker region (second region or region B and / or region Y) located between the oligonucleotide or continuous nucleotide sequence (region A or first region) complementary to the target nucleic acid and the conjugate portion (region C or third region).

[0264] Region B refers to a biodegradable joint comprising or consisting of a physiologically unstable bond, which is cleavable under conditions commonly encountered in mammals or under conditions similar thereto. The conditions under which the physiologically unstable joint undergoes chemical transformation (e.g., cleavage) include chemical conditions, such as pH, temperature, oxidation or reduction conditions or agents, and salt concentrations found in mammalian cells or similar to those encountered in mammalian cells. Conditions within mammalian cells also include the presence of enzymatic activity (such as from proteolytic enzymes or hydrolytic enzymes or nucleases) that is commonly present in mammalian cells. In one embodiment, the biodegradable joint is susceptible to S1 nuclease cleavage. In certain embodiments, the nuclease-sensitive joint comprises 1 to 5 nucleosides, such as one or more DNA nucleosides comprising at least two continuous phosphodiester bonds. The biodegradable joint containing phosphodiester is described in more detail in WO 2014 / 076195.

[0265] Region Y refers to a linker that is not necessarily biodegradable but is primarily used to covalently link the conjugate moiety (region C or the third region) to the oligonucleotide (region A or the first region). The region Y linker may comprise a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units or aminoalkyl groups. The antisense oligonucleotide conjugates of the present invention may be composed of the following regional elements AC, ABC, ABYC, AYBC or AYC. In some embodiments, the linker (region Y) is an aminoalkyl group (such as a C2-C36 aminoalkyl group), including, for example, a C6 to C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0266] treat

[0267] As used herein, the term 'treatment' refers to the treatment of an existing condition (eg, a disease or disorder referred to herein) or the prevention (ie, prevention) of a disease. It will therefore be appreciated that in some embodiments, the treatment referred to herein may be prophylactic.

[0268] TDP-43 Pathology

[0269] TDP-43 pathology is a disease associated with decreased or abnormal expression of TDP-43, which is often associated with an increase in cytoplasmic TDP-43, particularly hyperphosphorylated and ubiquitinated TDP-43.

[0270] Diseases associated with TDP-43 pathology include amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia 3, myopathy or chronic traumatic encephalopathy. DETAILED DESCRIPTION

[0271] The inventors have determined that targeting the pre-mRNA transcript of progranulin with antisense oligonucleotides can increase expression of progranulin exon 1-exon 2 spliced ​​mRNA, decrease expression of progranulin intron 1-exon 2 spliced ​​mRNA (retaining the 271 nucleotide 5' fragment of intron 1), and / or alter the ratio of exon 1-exon 2 to intron 1-exon 2 mRNA. This is particularly the case when antisense oligonucleotides containing one or more methylsulfonyl phosphoramidate internucleotide linkages are used.

[0272] Described herein are target sites present on the mRNA precursor of human progranulin that can be targeted by antisense oligonucleotides. Antisense oligonucleotides that are complementary to these target sites, such as fully complementary, are also described.

[0273] Without wishing to be bound by theory, it is believed that the antisense oligonucleotides of the invention can increase expression of progranulin exon 1-exon 2 spliced ​​mRNA, decrease expression of progranulin intron 1-exon 1 spliced ​​mRNA and / or alter the ratio of exon 1-exon 2 to intron 1-exon 2 mRNA by binding to these regions and affecting (such as increasing) the production of exon 1-exon 2 splice variants.

[0274] Oligonucleotides such as RNase H that recruit single-stranded antisense oligonucleotides or siRNA are widely used in the art to inhibit target RNA, ie, act as antagonists of their complementary nucleic acid targets.

[0275] The antisense oligonucleotides of the invention can be described as modulators, ie they alter the expression of a specific splice variant of their complementary target, progranulin's mRNA precursor, and thereby increase the production of active progranulin protein.

[0276] Reducing expression of the progranulin intron 1-exon 2 splice variant is desirable because inclusion of an intron, such as intron 1, in the mature mRNA sequence results in nonsense-mediated mRNA decay (NMD).

[0277] It is desirable to enhance the expression of the splice variant on exon 1-exon 2 of progranulin while retaining the 5' portion of intron 1, because the exon 1-exon 2 splice variant does not include the 271 nucleotide segment of intron 1, and there are two AUG sites upstream of the canonical downstream AUG in exon 2 (open reading frame). Translation from these two upstream AUG sites will not encode progranulin protein, and the transcript may undergo nonsense-mediated mRNA decay (NMD) due to premature stop codons. Changing the splicing to the exon 1-exon 2 splice variant will result in the translation of an active version of the progranulin protein. Progranulin is a neuroprotective protein, and increasing its production can be used to treat a range of nervous system disorders, such as TDP-43 pathology.

[0278] In certain embodiments, the antisense oligonucleotides of the invention can enhance the production of the exon 1-exon 2 progranulin splice variant.

[0279] In certain embodiments, the antisense oligonucleotides of the invention can increase the production of exon 1-exon 2 pregranulin splice variant mRNA by at least about 10% relative to the production of exon 1-exon 2 pregranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can increase the production of exon 1-exon 2 pregranulin splice variant mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, or more relative to the production of exon 1-exon 2 pregranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention.

[0280] In certain embodiments, the antisense oligonucleotides of the invention can reduce the production of intron 1-exon 2 progranulin splice variant mRNA.

[0281] In certain embodiments, the antisense oligonucleotides of the invention can reduce the production of intron 1-exon 2 pregranulin splice variant mRNA by at least about 10% relative to the production of intron 1-exon 2 pregranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can reduce the production of intron 1-exon 2 pregranulin splice variant mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, or more relative to the production of intron 1-exon 2 pregranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention.

[0282] Enhanced expression of the progranulin exon 1-exon 2 splice variant should result in translation of an active version of the progranulin protein. In certain embodiments, the antisense oligonucleotides of the invention can increase the production of the progranulin protein by at least about 10% relative to the production of the progranulin protein in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can increase the production of the progranulin protein by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500% or more relative to the production of the progranulin protein in the absence of the antisense oligonucleotides of the invention.

[0283] In certain embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 to intron-exon 2 pregranulin mRNA.

[0284] In certain embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 to intron 1-exon 2 pregranulin mRNA by at least about 10% relative to the ratio of exon 1-exon 2 to intron 1-exon 2 pregranulin mRNA in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 to intron 1-exon 2 pregranulin mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, or more relative to the ratio of exon 1-exon 2 to intron 1-exon 2 pregranulin mRNA in the absence of the antisense oligonucleotides of the invention.

[0285] In certain embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 to intron 1-exon 2 pregranulin mRNA to at least about 1.2. In certain embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 to intron 1-exon 2 pregranulin mRNA to at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 2.0, or more.

[0286] In some embodiments, the antisense oligonucleotide of the invention or contiguous nucleotide sequence thereof comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides in length.

[0287] In some embodiments, the entire nucleotide sequence of the antisense oligonucleotide is a contiguous nucleotide sequence.

[0288] In an embodiment, the contiguous nucleotide sequence may be a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37. The present invention also contemplates fragments of these contiguous nucleotide sequences, including fragments of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 contiguous nucleotides thereof.

[0289] In one embodiment, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37.

[0290] It will be appreciated that the sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37 may include modified nucleobases that function as the indicated nucleobases in base pairing, for example, 5-methylcytosine may be used in place of methylcytosine. Inosine may be used as a universal base.

[0291] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 8 to 30 or 8 to 40 nucleotides in length, which has at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37.

[0292] In some embodiments, the antisense oligonucleotide can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0293] It will be appreciated that the contiguous nucleobase sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to a target nucleic acid.

[0294] The pattern of incorporating modified nucleosides (eg, high affinity modified nucleosides) into an oligonucleotide sequence is often referred to as oligonucleotide design.

[0295] The antisense oligonucleotides of the present invention are designed with modified nucleosides and DNA nucleosides. Advantageously, high affinity modified nucleosides are used.

[0296] In one embodiment, the antisense oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides.

[0297] In one embodiment, the antisense oligonucleotide comprises 1 to 10 modified nucleosides, such as 2 to 9 modified nucleosides, such as 3 to 8 modified nucleosides, such as 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described under "modified nucleosides", "high affinity modified nucleosides", "sugar modifications", "2' sugar modifications" and "locked nucleic acids (LNA)" in the "definition" section.

[0298] In one embodiment, the antisense oligonucleotide comprises one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides. Preferably, the antisense oligonucleotide of the present invention comprises one or more 2' sugar-modified nucleosides independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. It is preferred if one or more modified nucleosides are locked nucleic acids (LNA).

[0299] Examples

[0300] Example 1

[0301] hiPSC-derived microglia (iCell Microglia Kit, 01279, Catalog No. R1131) were seeded (n=1) in poly-D-lysine coated 96-well plates (Greiner Catalog No. #655946) with 20,000 cells per well, 200 μL, and treated with SEQ ID NOs 2 to 38 at concentrations of 3 μM and 10 μM for 5 days.

[0302] RNA was extracted by adding 125 μL RLT buffer (Qiagen) and using the RNeasy97 kit and protocol from Qiagen. cDNA synthesis was performed using 4 μL input RNA and the IScript Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad), and 2 μL RNA was used as input for digital droplet PCR according to the manufacturer's protocol, using ddPCRsupermix as a probe (without dUTP) (Bio-Rad). The following primers and probes (IDT) were used: GRN exon 1-exon 2 (FAM):

[0303] Primer 1: GCTGCTGCCCAAGGACCGCGGA (SEQ ID NO: 40)

[0304] Primer 2: GCCCTGCTGTTAAGGCCACCCA (SEQ ID NO: 41)

[0305] Probe / 56-FAM / GGACGCAGG / ZEN / CAGACCATGTGGACCCTG / 3IABkFQ / (SEQ ID NO: 42)

[0306] GRN intron 1-exon 2 (HEX):

[0307] Primer 1: CCAAAGCAGGGACCACACCATTCTT (SEQ ID NO: 43)

[0308] Primer 2: GCCCTGCTGTTAAGGCCACCCA (SEQ ID NO: 44)

[0309] Probe / 5HEX / CCCAGCTCC / ZEN / ACCCCTGTCGGCAGACCATG / 3IABkFQ / (SEQ ID NO: 45)

[0310] GAPDH:

[0311] GAPDH (FAM, Hs.PT.39a.22214836, IDT)

[0312] GAPDH (HEX, Hs.PT.39a.22214836, IDT)

[0313] Exon 1-exon 2 GRN mRNA and intron 1-exon 2 GRN mRNA concentrations were quantified relative to the housekeeping gene GAPDH using QuantaSoft software (Bio-Rad).

[0314] The results are Figure 1a and 1b SEQ ID NOs 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 19, 20, 21, 22, 23, 24, 25, 27, 28, 30, 31, 34, 35, 36 and 37 showed efficient and improved skipping of intron 1 retention (Int1-Ex2) and a possible slight increase in exon 1-exon 2 (Ex1-Ex2) splice variants compared to SEQ ID NO: 2 at both 3 μM and 10 μM doses. SEQ ID NO: 33 was tested twice, and thus Figure 1a and 1b There are repeated results in .

[0315] Compound Table

[0316] HELM symbol

[0317] The antisense oligonucleotides (compounds) of the invention and the antisense oligonucleotide conjugates (conjugates) of the invention are described herein using the Hierarchical Editing Language for Macromolecules (HELM) notation.

[0318] HELM is a symbol format designed for depicting the structure of macromolecules. Full details of the HELM symbol can be found at www.pistoiaalliance.org / helm-tools / , in Zhang et al., 2012, J.Chem.Inf.Model., 52, 2796-2806 (which originally described the HELM symbol) and in Milton et al., 2017, J.Chem Inf.Model., 57, 1233-1239 (which describes HELM version 2.0).

[0319] In short, a macromolecule is depicted as a "HELM string" that is divided into parts. The first part lists the molecules contained in the macromolecule. The second part lists the connections between molecules within the macromolecule. One or more currency symbols $ mark the end of a part of the HELM string.

[0320] The compounds of the invention are represented by a HELM string consisting of a single first portion defining an oligonucleotide.

[0321] Each molecule listed in the first part of the HELM string is given an identifier (e.g., "RNA1" for nucleic acid), and the structure of the molecule is defined by the symbols in curly brackets {} immediately following the identifier. The HELM symbols used to define the structure of each molecule in curly brackets {} in the first part of the HELM string of the compounds and conjugates of the invention are as follows:

[0322] [MOE](G) is 2′-O-(2-methoxy)ethyl RNA guanosine

[0323] [MOE](U) is 2′-O-(2-methoxy)ethyl RNA uridine

[0324] [MOE](A) is 2′-O-(2-methoxy)ethyl RNA adenine nucleoside

[0325] [MOE]([5meC]) stands for 2′-O-(2-methoxy)ethyl RNA 5-methylcytidine

[0326] MOE](T) is 2′-O-(2-methoxy)ethylthymidine

[0327] [sP] is a phosphorothioate backbone

[0328] [MsNP] is a methylsulfonyl phosphoramidate backbone

[0329] As mentioned above, in the context of the present invention, the second part is only used in HELM strings representing conjugates of the present invention. The second part lists the connections between the molecules listed in the first part. Each pair of connected molecules is defined by listing the identifiers of the molecules, and then defining the attachment point between them (i.e., the point where a covalent bond exists between the molecules).

[0330] Examples of HELM symbols

[0331] For example, SEQ ID NO: 2 is represented by the following HELM string (as depicted in the compound table of Example 1):

[0332] RNA1{[MOE](G)[sP].[MOE](G)[sP].[MOE](T)[sP].[MOE]([5meC])[sP].[MOE](A)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[MOE](A)[s P].[MOE](T)[sP].[MOE](G)[sP].[MOE](G)[sP].[MOE](T)[sP].[MOE](G)[sP].[MOE](T)[sP].[MOE](G)[sP].[MOE](G)[sP].[MOE](T)}$$$$V2.0

[0333] This HELM string consists of a single section, listing the oligonucleotide of SEQ ID NO 2. The initial "RNA1" indicates that the molecule is a nucleic acid (oligonucleotide). The structure of the oligonucleotide is indicated using HELM symbols in curly brackets {} after RNA1. "$$$$" marks the end of this section and the end of the entire HELM string. "V2.0" indicates that HELM version 2.0 is used.

[0334] HELM Annotation Key:

[0335] [MOE](G) is 2′-O-(2-methoxy)ethyl RNA guanosine

[0336] [MOE](U) is 2′-O-(2-methoxy)ethyl RNA uridine

[0337] [MOE](A) is 2′-O-(2-methoxy)ethyl RNA adenine nucleoside

[0338] [MOE]([5meC]) stands for 2′-O-(2-methoxy)ethyl RNA 5-methylcytidine

[0339] MOE](T) is 2′-O-(2-methoxy)ethylthymidine

[0340] [sP] is a phosphorothioate backbone

[0341] [MsNP] is a methylsulfonyl phosphoramidate backbone

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

Claims

1. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of 8 to 40 nucleotides in length, which is complementary to a splicing regulatory site of a pre-mRNA transcript of human progranulin, wherein the contiguous nucleotide sequence comprises one or more methylsulfonyl phosphoramidate internucleotide bonds. 2 . The antisense oligonucleotide according to claim 1 , wherein the human progranulin pre-mRNA transcript comprises exon 1, intron 1 and exon 2 sequences of the human progranulin pre-mRNA transcript (SEQ ID NO: 1).

3. The antisense oligonucleotide according to claim 1 or claim 2, wherein the contiguous nucleotide sequence is complementary to SEQ ID NO:

39.

4. The antisense oligonucleotide of claim 3, wherein the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 NO:35, SEQ ID NO:36, SEQ ID NO:37 and SEQ ID NO:38, or at least 8 consecutive nucleotides thereof.

5. The antisense oligonucleotide of claim 4, wherein the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37, or at least 8 consecutive nucleotides thereof.

6. The antisense oligonucleotide according to claim 5, wherein the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31 and SEQ ID NO: 35, or at least 8 consecutive nucleotides thereof. The antisense oligonucleotide according to claim 6 , wherein the contiguous nucleotide sequence is SEQ ID NO:

11. The antisense oligonucleotide according to claim 6 , wherein the contiguous nucleotide sequence is SEQ ID NO:

15.

9. The antisense oligonucleotide according to claim 6, wherein the contiguous nucleotide sequence is SEQ ID NO:

16.

10. The antisense oligonucleotide according to claim 6, wherein the contiguous nucleotide sequence is SEQ ID NO:

28. The antisense oligonucleotide according to claim 6 , wherein the contiguous nucleotide sequence is SEQ ID NO:

31.

12. The antisense oligonucleotide according to claim 6, wherein the contiguous nucleotide sequence is SEQ ID NO:

35.

13. The antisense oligonucleotide according to any one of claims 1 to 12, wherein the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or more methylsulfonylphosphoramidate internucleotide bonds.

14. The antisense oligonucleotide according to any one of claims 1 to 13, wherein the contiguous nucleotide sequence comprises one or more phosphorothioate internucleotide bonds.

15. The antisense oligonucleotide according to any one of claims 1 to 14, wherein the contiguous nucleotide sequence comprises a plurality of phosphorothioate internucleotide bonds.

16. The antisense oligonucleotide of any one of claims 1 to 15, wherein at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the internucleotide bonds of the contiguous nucleotide sequence are modified.

17. The antisense-oligonucleotide according to any one of claims 1 to 16, wherein all of the internucleotide bonds between nucleotides on the contiguous nucleotide sequence are modified.

18. The antisense oligonucleotide according to claim 17, wherein all of the internucleotide bonds present in the antisense oligonucleotide are selected from phosphorothioate internucleotide bonds and methylsulfonyl phosphoramidate internucleotide bonds.

19. The antisense oligonucleotide according to any one of claims 1 to 18, wherein the antisense oligonucleotide or a contiguous nucleotide sequence thereof comprises one or more modified nucleosides.

20. The antisense oligonucleotide of claim 19, wherein the contiguous nucleotide sequence comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

21. The antisense oligonucleotide of claim 20, wherein the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

22. The antisense oligonucleotide of any one of claims 19 to 21, wherein the contiguous nucleotide sequence comprises at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

23. The antisense oligonucleotide according to any one of claims 19 to 22, wherein all of the nucleosides of the contiguous nucleotide sequence are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

24. An antisense oligonucleotide having the following structure:

25. An antisense oligonucleotide having the following structure:

26. An antisense oligonucleotide having the following structure:

27. An antisense oligonucleotide having the following structure:

28. An antisense oligonucleotide having the following structure:

29. An antisense oligonucleotide having the following structure:

30. An antisense oligonucleotide, wherein the oligonucleotide is an oligonucleotide compound GGTCAAGAATGGTGTGGT (SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31 or SEQ ID NO: 35), wherein all nucleosides are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, C is 5-methylcytosine, and all internucleoside bonds are selected from thiophosphate internucleoside bonds and methylsulfonylphosphoramidate internucleoside bonds.

31. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 30 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

32. The antisense oligonucleotide according to any one of claims 1 to 30 or the pharmaceutical composition according to claim 31 for use in the treatment of a neurological disease.

33. The antisense oligonucleotide according to any one of claims 1 to 30 or the pharmaceutical composition according to claim 31 for use in the treatment of progranulin haploinsufficiency or a related disease.

34. An in vivo or in vitro method for enhancing the expression of an exon 1-exon 2 progranulin splice variant in a cell expressing progranulin, the method comprising administering to the cell an effective amount of an antisense oligonucleotide according to any one of claims 1 to 30 or a pharmaceutical composition according to claim 31.

Images