Novel polyspora spirospora strain with siderophore-producing capacity and application of novel polyspora spirospora strain as biocontrol bacterium in prevention and treatment of plant diseases

Abstract

The invention discloses a novel strain of conostachys hainanensis HNU01 with siderophore producing capacity and an application of the novel strain of conostachys hainanensis HNU01 as a biocontrol bacterium in prevention and treatment of plant diseases. The novel strain of conostachys hainanensis HNU01 has the siderophore producing capacity. According to the invention, a strain of fungus Clonostachys Hainanensis HNU01 which is extremely strong in siderophore producing capacity and has an antibacterial effect on various pathogenic bacteria is separated and identified from rhizosphere soil in a Chinese avocado producing area, and through identification, the fungus is a new strain of spiropolyspora sp, has broad-spectrum antibacterial capacity, can inhibit the growth of various plant pathogenic bacteria, and has a good application prospect. The strain has a great prospect of being used as a biocontrol microbial agent for preventing and treating avocado root rot, and is expected to provide a new biocontrol choice for preventing and treating plant diseases.

Description

Technical Field

[0001] The invention relates to the technical field of microorganism and plant disease prevention and control, and in particular to a new strain of Polysporus spiralis with the ability to produce siderophores and the application of the strain as a biocontrol bacterium in preventing and controlling plant diseases. Background Art

[0002] Avocado (Persea americana Mill.), also known as avocado, belongs to the genus Alligator of the Lauraceae family. It is a fast-growing evergreen woody fruit tree in tropical and subtropical areas that can be used as a woody oil-bearing tree species. It originated in Central America and Mexico. The planting area of ​​avocado is second only to mango among tropical fruits in the world. It is one of the rare fruit trees with significant economic benefits in tropical areas of China. Avocado has multiple uses such as food, fruit, oil, and medicine. It has high nutritional value. It has the characteristics of high unsaturated fatty acids, high protein, high calories and low sugar. It is rich in vitamins and mineral elements such as calcium, magnesium, sodium, and various amino acids. It is a high-energy, low-sugar, and easy-to-digest health food. China began to introduce avocados in 1918. In 1975, my country selected avocado varieties suitable for my country's climate from multiple domestic and foreign strains through introduction experiments, regional experiments, and variety comparison experiments. Avocado trees are light-loving, warm and humid climates, and are not cold-resistant or waterlogged. Shallow-rooted fruit trees.

[0003] Root rot is caused by a variety of pathogens and is a soil-borne disease of a fungus and oomycete complex. Soil-borne pathogens infect plant roots, triggering the release of toxic mobile metabolites, leading to imbalanced plant hormone levels, affecting the plant photosynthesis system and causing disease. Avocado root rot first infects the root tip of avocados, then gradually spreads to the lateral roots, taproots and stem base, causing the roots to turn black and rot, damaging the plant root tissue, causing water shortage in the aboveground parts, yellowing of leaves, blackening of leaf margins, and eventually causing the entire plant to wither and die. Root rot has a long incubation period, and factors such as moist soil, poor drainage, and a large temperature range are closely related to the occurrence of avocado root rot. Generally, the occurrence of root rot will be more serious after heavy rain or in the soil of low-lying areas. Once it breaks out, it will spread rapidly, causing the death of a large number of trees, which may significantly reduce the yield of avocado trees around the world and restrict the development of the avocado industry. The pathogens that have been reported to cause avocado root rot at home and abroad are mainly Pythium spp., Phytophthora spp., and Fusaritun spp., among which Phytophthora root rot is the main factor limiting the productivity of avocado orchards. Phytophthora cinnamomi is a soil-borne, semi-biotrophic plant pathogenic oomycete. It is the pathogen of root rot, canker and dieback of thousands of plants worldwide. It has a very wide host range and can cause root rot diseases of thousands of woody plants worldwide. In recent years, researchers have found that brown root rot caused by harmful red dermatophyte (Pyrrhoderma noxium) is the key to the death of young avocado plants. At present, the damage caused by harmful red dermatophyte has been reported in economic crops such as loquat, longan, litchi, wax apple, camphor tree, etc.

[0004] Although chemical pesticides can effectively control the pathogens of root rot, chemical control methods are prone to cause pesticide residues, leading to environmental pollution, which in turn causes environmental problems and food safety issues, leading people to pay attention to finding alternative measures. Biological control is very friendly to the sustainable development of agriculture and is a measure worthy of extensive promotion and development. However, there are currently few commercialized microbial preparations in my country and even in the world, and microbial preparations for the pathogens of avocado root rot are even rarer. In order to promote the green development of agriculture, strengthen the research and development of green production technologies, and achieve fertilizer and pesticide control, the use of environmentally friendly and economical biological resources for disease control is a breakthrough point in disease prevention and control. Actively discovering and screening new biocontrol bacteria and their metabolites are of great significance for the prevention and control of avocado root rot and other plant-related diseases. Many effective antagonistic substances are only expressed under specific conditions, and blind intervention of foreign microorganisms may harm other beneficial microorganisms in local or natural habitats. Therefore, it is necessary to discover new biocontrol bacteria from healthy avocado tissues and their production areas to provide new options for biological control of avocado root rot. Summary of the invention

[0005] The purpose of the present invention is to solve the above problems and provide a new strain of Polysporus spiralis with the ability to produce siderophores and its application as a biocontrol bacterium in preventing and controlling plant diseases.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a new strain of Clonostachys Hainanensis HNU01, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration with a deposit registration number of CGMCC No.41461.

[0008] The second aspect of the present invention provides the use of the above-mentioned Clonostachys Hainanensis HNU01 or its fermentation broth in any of the following:

[0009] (1) Application in inhibiting root rot pathogens or preventing and controlling plant root rot;

[0010] (2) Application in the preparation of products for inhibiting root rot pathogens or preventing and treating plant root rot.

[0011] Preferably, in the application technology scheme, the plants include avocado, loquat, longan, lychee, wax apple, and camphor tree.

[0012] Preferably, in the application technology scheme, the root rot pathogens include harmful red dermatophyte Pyrrhoderma noxium and Phytophthora cinnamomi.

[0013] The third aspect of the present invention provides the use of the above-mentioned Clonostachys Hainanensis HNU01 or its fermentation liquid in inhibiting plant pathogenic fungi or in preventing and controlling plant diseases caused by the plant pathogenic fungi, wherein the plant pathogenic fungi include Phytophthora infestans, Phytophthora capsici, Peronophthora litchii, Colletotrichum acutatum, Colletotrichum fragariae, Fusarium oxysporum f.sp, Fusarium oxysporum (Schl.) F.sp cucumerinum Owen.anamorph, and Curvularia fallax.

[0014] The fourth aspect of the present invention provides a product for inhibiting plant pathogens or preventing and controlling plant diseases, wherein the active ingredient comprises any one of the following:

[0015] (1) Clonostachys Hainanensis HNU01 mentioned above;

[0016] (2) Fermentation broth of Clonostachys Hainanensis HNU01.

[0017] In the product technical scheme, the plant pathogens include harmful red dermatophyte Pyrrhodermanoxium, Phytophthora cinnamomi, Phytophthora infestans, Phytophthora capsici, Peronophthora litchii, Colletotrichum cutatum, Colletotrichum fragariae, Fusarium oxysporum f.sp, Fusarium oxysporum (Schl.) F.sp cucumerinum Owen.anamorph, and Curvularia fallax, the pathogen of banana long spot disease.

[0018] In the product technical solution, the plants include avocado, loquat, longan, lychee, wax apple, camphor tree, potato, tomato, pepper, mango, strawberry, banana and cucumber.

[0019] The beneficial effects of the present invention are:

[0020] The present invention isolates and identifies a fungus Clonostachys Hainanensis HNU01 from rhizosphere soil of a healthy avocado production area in China, which has a strong ability to produce siderophores and has an antibacterial effect on a variety of pathogenic bacteria. Through research, it is found that the fungus Clonostachys Hainanensis HNU01 is a new species of spiral polysporus (Clonostachys). Experiments have confirmed that Clonostachys Hainanensis HNU01 has a broad-spectrum antibacterial ability, can inhibit the growth of a variety of plant pathogens, has a strong growth ability, has a strong salt and alkali resistance, can utilize a variety of carbon sources and nitrogen sources, has the ability to produce siderophores, and can chelate Fe by producing iron-binding ligands of siderophores. 2+The membrane-bound protein receptor specifically recognizes and absorbs the iron carrier-Fe-complex, which makes the pathogen unable to obtain iron, thereby reducing the infection of plant pathogens. It is a broad-spectrum biocontrol bacterium with significant inhibitory effect on pathogens. The fungus Clonostachys Hainanensis HNU01 of the present invention has great prospects as a biocontrol bacterium for preventing and controlling avocado root rot, and is expected to provide a new biocontrol option for the prevention and control of plant diseases, reduce the use of chemical pesticides, and protect the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a phylogenetic tree constructed based on the TEF gene sequence of Polysporidium spiralis HNU01, with Trichoderma as the outgroup, using the neighbor-joining method.

[0022] Figure 2 The ANI values ​​of the strain HNU01 were calculated based on the alignment of the Scaffold sequence of Polyporus spiralis with other species identified similarly by KmerFinder (using the OrthoANI algorithm and BLAST calculations performed using the ANI tool OAT software).

[0023] Figure 3 These are the results of the antagonistic activity experiment of Clonostachys Hainanensis HNU01 against the pathogens of avocado root rot, Pyrrhoderma noxium A20 and Phytophthora cinnamomi YLPC0321.

[0024] Figure 4 This is a scanning electron micrograph of a Clonostachys Hainanensis HNU01 plate confronting avocado root rot pathogens Pyrrhoderma noxium A20 and Phytophthora cinnamomi YLPC0321.

[0025] Figure 5These are the morphological pictures of Clonostachys Hainanensis HNU01 cultured on potato medium at 26°C in the dark for different days and the pictures of mycelium and spores observed under a microscope: a. Mycelium and spores observed under a 10×100-fold microscope after 3 days of dark culture on PDA medium at 26°C, b. Mycelium and spores observed under a 10×40-fold microscope after 7 days of dark culture on PDA medium at 26°C, c. Mycelium and spores observed under a 10×100-fold microscope after 7 days of dark culture on PDA medium at 26°C, d. Fungal morphology after 3 days of dark culture on PDA medium at 26°C, e. Fungal morphology after 7 days of dark culture on PDA medium at 26°C, f. Morphology of mature fungi cultured under a 20-day dark culture on PDA medium at 26°C.

[0026] Figure 6 These are the results of the temperature resistance experiment of Clonostachys Hainanensis HNU01.

[0027] Figure 7 These are the results of the acid-base tolerance experiment of Clonostachys Hainanensis HNU01.

[0028] Figure 8 These are the results of an experiment on the carbon and nitrogen source utilization ability of Clonostachys Hainanensis HNU01.

[0029] Fig. 9 These are the results of an experiment on the ability of Clonostachys Hainanensis HNU01 to produce siderophores.

[0030] Fig.10 This is the result of the broad-spectrum antibacterial experiment of Clonostachys Hainanensis HNU01. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0033] Main reagent sources:

[0034] Unless otherwise specified, the culture media used in the examples are conventional culture media in the art.

[0035] Example 1: Isolation, identification and antagonistic activity of Clonostachys Hainanensis HNU01 strain

[0036] 1. Isolation of strain HNU01:

[0037] In November 2022, we went to the avocado germplasm resource garden of Hainan University Danzhou Campus in Hainan Province and the avocado plantation in Chengmai County, Hainan Province to collect avocado root tissues and rhizosphere soil with different degrees of disease. More than 300 endophytes were isolated from avocado tissues, including 70 representative fungi and bacteria. The gradient dilution method and confrontation culture method were used to isolate and screen the potential biocontrol fungal strain HNU01, which has a strong inhibitory effect on Phytophthora cinnamomi and harmful red dermatophyte. After the endophytic fungus was inoculated and cultured for 5 days, a 5mm bacterial cake was punched along the edge of the colony and transferred to a new PDA medium. After multiple transfers, purification and culture were performed to obtain the purified strain HNU01, which was preserved in a -20℃ refrigerator glycerol preservation method and a 4℃ refrigerator test tube preservation method.

[0038] 2. Identification of strain HNU01:

[0039] DNA extraction: Use a sterile key to scrape 0.1 g of fresh mycelium, and use a fungal DNA extraction kit (OMEGA BIO-TEK) to extract genomic DNA. Use the TEF gene sequence for fungal PCR amplification. The amplification system and program are appropriately adjusted according to the program and system of the universal primer sequence for fungal PCR amplification. The reaction system is shown in Table 1, and the amplification primer sequence is shown in Table 2. The PCR reaction program is: 94°C pre-denaturation for 2 minutes; 94°C denaturation for 30 seconds, 50°C annealing for 30 seconds, 72°C extension for 30 seconds, 30 cycles; 72°C final extension for 2 minutes.

[0040] Table 1 Sequence amplification system

[0041]

[0042] Table 2 PCR amplification universal primer gene sequence

[0043]

[0044] The amplified product was detected by 1% agarose gel electrophoresis and purified and sent to a sequencing company for DNA sequence determination. The fungal splicing sequence was submitted to NCBI for BLAST comparison; after comparison, the target gene sequence was submitted to GenBank, and the TEF gene sequence of strain HNU01 was submitted to GeneBank for homology comparison. It was found that the TEF sequence of strain HNU01 had a homology similarity of 99% to 100% with Clonostachys spseudochroleuca culture CBS:191.94 (OQ944678.1). The phylogenetic tree was constructed using MEGA 11.0 software ( Figure 1), it was determined that HNU01 was a Clonostachys fungus, but the specific taxonomic species could not be determined. The whole genome sequencing was then performed, and the ANI value of the HNU01 strain based on the fungal Scaffold sequence alignment and other similar species identified by KmerFinder was calculated (using the ANI tool OAT software to perform the OrthoANI algorithm and BLAST calculation), and the classification threshold (ANI < 95%) identified HNU01 as a new species of the fungal genus Clonostachys ( Figure 2 ) and named it Clonostachys Hainanensis HNU01.

[0045] The TEF sequence of Clonostachys Hainanensis HNU01 is as follows (SEQ ID NO.3):CACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTTAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAACTGGTCTGAGGCCCGTTTCCAGGAAATCATCAAGGAGACCTCCTCTTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGTTTCCACGGTGACAACATGCTGTCCCCCTCCACCAACGCCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCTGGCAAGTCCTCCGGCAAGACCCTCCTCGAGGCCATTGACTCCATTGAGCCCCCCAAGCGTCCTCTTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGCACAGTACCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTCGCTTCCGACTCCAAGAACGACCCTGCTTCAGGTGCCGCTTCTTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGACAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGATCGCCGAACTGGTAAGGCTACTGAGGCCAACCCCAAGTTCATCAAGTCTGGTGACTCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTCACCGACTACCCTCCTCTGGGCC。.

[0046] The deposit information of Clonostachys Hainanensis HNU01 is as follows:

[0047] ClonostachysHainanensis HNU01 was sent to the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) for preservation in July 2024. The address of the preservation unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; the preservation date is July 8, 2024, the preservation number is CGMCCNO.41461, and the classification name is ClonostachysHainanensis.

[0048] 3. Antagonistic activity of Clonostachys Hainanensis HNU01 strain against avocado root rot:

[0049] The harmful red dermatophyte A20 (abbreviated as A20) and cinnamon phytophthora YLPC0321 (abbreviated as PC, provided by the team of Associate Professor Xie Changping of the College of Plant Protection, Hainan University) isolated and identified by the Key Laboratory of Quality Control of Tropical Horticultural Crops of Hainan University were used as target pathogens for antagonistic screening of the isolated strain HNU01. A 5mm diameter target bacterial cake was inoculated in the center of the corresponding culture medium (A20 was inoculated in potato culture medium, PC was inoculated in rye culture medium), and the antagonistic bacteria HNU01 was inoculated at a distance of 2.5cm from the pathogen using the four-point method, with the blank culture medium as the control. Each endophyte was repeated three times, and the culture medium inoculated with A20 was placed in the dark at 25℃ for 20 days, and the culture medium inoculated with PC was placed in the dark at 20℃ for 15 days. The growth of the confrontation culture colonies was observed every day, and the diameter of the target colonies was measured using the cross method.

[0050]

[0051] The growth of HNU01 and root rot pathogens (A20 and PC) was observed daily when they were co-cultured and not co-cultured. The mycelial growth of the co-cultured pathogens in the treatment group was inhibited. Compared with the control group, A20 began to be inhibited on the seventh day. On the tenth day, it was clearly observed that the mycelial growth of A20 was inhibited, and the colonies began to wilt and shrivel from the surrounding fluffy state. On the fifteenth day, most of the fluffy colonies of A20 were inhibited and wilted. On the 20th day, the A20 colonies were completely inhibited, and the mycelial was wilted or shriveled. The diameter of the colonies cultured with A20 was reduced by 86.92mm compared with the A20 colonies cultured alone, and the inhibition rate was 96.58% ( Figure 3); The colonies of PC confrontation were inhibited, and antagonism began to occur on the seventh day. On the tenth day, it was clearly observed that the PC hyphae were attached to HNU01 and inhibited their growth. On the fifteenth day, the surrounding of the fluffy PC colonies was completely inhibited, and the hyphae could not grow around. The diameter of the colonies cultured in confrontation with PC was reduced by 81.20mm compared with the PC colonies cultured alone, and the inhibition rate was 89.10% ( Figure 3 ). The results showed that the mycelia of the pathogen in the control group were thick, full, straight, uniform and regular; the mycelia of the pathogen in the treatment group were shriveled, broken, bent and short, parasitized or wrapped by the antagonistic mycelia to inhibit their growth, and the mycelial structure was severely damaged, showing abnormal growth or stopped growing. After the test, the plates were placed at room temperature for several months. When observed again, it was found that the root rot bacteria were still in a state of inhibited growth. It can be seen that HNU01 has a significant antibacterial effect on the root rot bacteria A20 and PC ( Figure 3 ).

[0052] 4. SEM observation of Clonostachys Hainanensis HNU01 strain against avocado root rot pathogen:

[0053] After 20 days of confrontation culture, use a scalpel to take a soybean-sized piece of the junction between the antagonistic bacteria and the pathogenic bacteria on the plate, transfer it to a 2 ml centrifuge tube containing electron microscopy fixative, fix it at 4°C for 10 hours, and then send the sample to Zhongke Baice for scanning electron microscopy observation.

[0054] Observation results( Figure 4 ) showed that the above results were consistent with the naked eye observation. The A20 colony was dense and regular at 1000 times, and the hyphae were densely overlapped and stacked at 200 times. The observations at 100 times and 50 times were consistent. When cultured against HNU01, the colony was disordered at 1000 times. At 200 times, the hyphae of A20 were attached by broom-like hyphae and inhibited from growing. The originally thick hyphae wall was destroyed. At 100 times and 50 times, it was clearly observed that unlike the single culture of A20, only the HNU01 hyphae in good condition were seen, while the hyphae of A20 were broken and damaged. The PC was observed to have regular colony distribution at 1000, 200, 100 and 50 times magnification, and the hyphae grew healthily and had a tendency to sprout. Under the confrontation culture with HNU01, the colony was obviously disordered at 1000 times magnification, and the PC hyphae were attached by broom-like hyphae and inhibited growth at 200 times magnification. The originally thick hyphae wall was destroyed and could not grow normally. Under the microscope of 100 times and 50 times magnification, it was obviously observed that, unlike the single culture of PC, only the HNU01 hyphae in good condition was seen, while the PC hyphae was shrunken and twisted and entangled by HNU01 and could not grow and reproduce normally. In summary, the pathogenic bacteria were attached and wrapped by the broom-like hyphae of the antagonistic bacteria and inhibited their growth. The hyphae of the pathogenic bacteria were broken or wrinkled, while the colony of the control group grew well, fluffy and regular, and the hyphae were dense.

[0055] Example 2: Clonostachys Hainanensis HNU01 strain morphology and growth test experiment

[0056] 1. Morphological identification of Clonostachys Hainanensis HNU01

[0057] The isolated and purified Clonostachys Hainanensis HNU01 was inoculated into potato culture medium and cultured for 20 days. The growth state was observed and the growth and development of spores and hyphae were observed under a microscope.

[0058] Take photos and record the period when the colony growth shows obvious changes at 3 days, 7 days, and 20 days. Figure 5 ). HNU01 mycelium grew slowly and densely in the early stage. After 20 days of dark culture at 26℃, the mycelium diameter could reach about 6cm. In the early stage of growth, the center of the colony was light yellow and gradually turned to white towards the edge. The mycelium grew radially outward. In the later stage of culture, the colony collapsed and thickened, with yellow powder attached. The mycelium was short and slightly irregular flower-shaped. Under microscopic observation, the spores of HNU01 were small and dense in the early stage, and were oval in shape. In the later stage of growth, the mycelium was broom-shaped, with a large number of zoospores densely distributed around the mycelium.

[0059] 2. Temperature resistance test of Clonostachys Hainanensis HNU01

[0060] Take HNU01 with good growth, punch a hole at the edge of the colony to get a mycelium block (5mm in diameter), and inoculate it on the center of a PDA plate (90mm in diameter). Inoculate 3 plates for each treatment as 3 replicates. Invert the plates and culture them at 4℃, 20℃, 26℃, 34℃, and 38℃, and measure the colony diameter of each plate every 24h until the tenth day ( Figure 6 ). The most suitable growth temperature for fungi is 20-30℃. After 36 hours of culture, it was found that HNU01 placed at 4℃ and 38℃ had no obvious growth phenomenon, and there was still no obvious growth trend after the tenth day; the growth ability of plates placed at 20℃ and 26℃ was stronger. After ten days of culture, 26℃>20℃>34℃. After the plates cultured at 4℃ and 38℃ were transferred to 26℃ where the growth was the best, it was found that HNU01 could still resume normal growth after 10 days of culture, and the growth condition was consistent with that of HNU01 cultured at 26℃, indicating that Clonostachys Hainanensis HNU01 has extremely strong growth ability, heat and cold resistance, and the best growth condition is at 26℃.

[0061] 3. Acid-base tolerance test of Clonostachys Hainanensis HNU01

[0062] The pH values ​​of potato solid culture medium were adjusted to 3, 4, 5, 6, 7, 8, 9, and 10 respectively with 0.1 mol / L HCl and NaOH solutions, and 5 mm bacterial cakes were transferred to 60 mm potato culture medium with different pH values ​​in sequence, and inverted in a 26 ° C incubator for 7 days. By preparing potato solid culture medium with different pH values, several gradient solid culture media with different pH values ​​were formed to explore the effect of different pH values ​​on the growth of HNU01 ( Figure 7 ). Since agar does not solidify under pH values ​​of 3 and 4, the final experimental pH was set to 5, 6, 7, 8, 9, and 10 for five gradient experiments. The experiment found that the growth of HNU01 under different pH conditions was not much different. It can grow normally under pH = 5-10, with lush colony growth and dense mycelium growth.

[0063] Example 3: Experiment on the carbon and nitrogen source utilization ability and siderophore production ability of Clonostachys Hainanensis HNU01 strain 1. Experiment on the carbon and nitrogen source utilization of Clonostachys Hainanensis HNU01

[0064] Solid culture medium was prepared by replacing the carbon source and nitrogen source components in Czapek medium with different carbon sources (D-galactose, sucrose, D-fructose, glucose, D-mannitol, soluble starch) and nitrogen sources (ammonium sulfate, urea, peptone, ammonium nitrate, sodium nitrate, yeast extract), the culture medium was divided and sterilized, and HNU01 with good growth was taken. Mycelium blocks (5 mm in diameter) were punched at the edge of the colony and inoculated in the center of a 90 mm culture dish. Three plates were inoculated for each treatment, as three replicates. The plates were inverted and cultured in the dark at 26°C for 7 days, and the colony diameters were measured.

[0065] result( Figure 8 ) showed that HNU01 could grow on different carbon sources (D-galactose, sucrose, D-fructose, glucose, D-mannitol, soluble starch) and nitrogen sources (ammonium sulfate, urea, peptone, ammonium nitrate, sodium nitrate, yeast extract), and grew best under the conditions of yeast extract as the carbon source and glucose as the nitrogen source. It has a strong ability to utilize carbon and nitrogen sources, and during the growth of the plant, it converts and decomposes a variety of carbon and nitrogen sources that cannot be absorbed in its growth environment, thereby promoting plant growth or inhibiting the reproduction of pathogenic bacteria.

[0066] 2. Experiment on the ability of Clonostachys Hainanensis HNU01 to produce siderophore

[0067] The fungus HNU01 was inoculated into CAS detection medium (siderophore detection medium, prepared according to the instructions of the drug), pH 7.4, sterilized at 121°C for 20 minutes, and cultured at 26°C, with 3 replicates for each treatment group. During the culture process, the colonies were continuously observed for the presence of yellow transparent circles around them. If there were any, it proved that the antagonistic bacteria had the ability to produce siderophores.

[0068] Siderophores are microorganisms that can chelate Fe in the rhizosphere soil by producing siderophores in an iron-deficient environment. 3+ , reducing it to Fe 2+ For plants to absorb nutrients. Test results ( Fig. 9 ) showed that HNU01 formed an orange-yellow transparent circle on the CAS medium. It can be seen that HNU01 has a strong ability to secrete siderophores and can inhibit the growth of root rot bacteria by producing siderophores to chelate iron in the soil.

[0069] Example 4: Inhibitory effect of Clonostachys Hainanensis HNU01 strain on common plant pathogenic fungi

[0070] Potato infestation Phytophthora, pepper infestation Phytophthora, litchi infestation Phytophthora, tomato infestation Phytophthora, mango anthracnose pathogen, pepper anthracnose pathogen, strawberry anthracnose pathogen, banana wilt pathogen, cucumber wilt pathogen, banana long spot pathogen were used as the test pathogens. Among them, Phytophthora infestation was provided by Professor Li Zhengguo's team from the School of Life Sciences of Chongqing University; the other strains were provided by the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences (Table 3). A 5mm bacterial cake was punched out with a cork puncher and inoculated in the center of the corresponding culture medium. Antagonistic bacteria were inoculated at a distance of 2.5 cm from the pathogen using the two-point method, and the blank culture medium was used as the control. Each antagonistic bacteria was repeated 3 times, and the culture medium inoculated with pathogenic fungi was placed in the dark at 26℃ for 5-7 days, and the culture medium inoculated with pathogens was placed in the dark at 20℃ for 7-10 days. The colony diameter of the test pathogen was measured by the cross method.

[0071] Antagonistic screening was performed on pathogens from different plant species, and the results were as follows Fig.10 As shown in the figure, strain HNU01 has antagonistic effects on 11 tested pathogenic fungi. This shows that HNU01 is a good broad-spectrum antagonist against microbial fungi and can effectively inhibit the growth of multiple pathogens.

[0072] Table 3 Pathogens of different plant species

[0073]

[0074]

Claims

1. A new strain of Clonostachys Hainanensis HNU01 was deposited in the General Microbiological Center of China Microbiological Culture Collection with the registration number of CGMCC No.41461.

2. Use of Clonostachys Hainanensis HNU01 or its fermentation liquid according to claim 1 in any of the following: (1) Application in inhibiting root rot pathogens or preventing and controlling plant root rot; (2) Application in the preparation of products for inhibiting root rot pathogens or preventing and treating plant root rot.

3. The use according to claim 2, characterized in that: The plants include avocado, loquat, longan, lychee, wax apple and camphor tree.

4. The use according to claim 2, characterized in that: The root rot pathogens include harmful red dermatophyte Pyrrhoderma noxium and Phytophthora cinnamomi.

5. Use of Clonostachys Hainanensis HNU01 or its fermentation liquid according to claim 1 in inhibiting plant pathogenic fungi or in preventing and controlling plant diseases caused by the plant pathogenic fungi, wherein the plant pathogenic fungi include Phytophthora infestans, Phytophthora capsici, Peronophthoralitchii, Colletotrichum acutatum, Colletotrichum fragariae, Fusarium oxysporum f.sp, Fusarium oxysporum (Schl.) F.sp cucumerinum Owen.anamorph, and Curvularia fallax.

6. A product for inhibiting plant pathogens or preventing and controlling plant diseases, characterized in that: Its active ingredients include any of the following: (1) Clonostachys Hainanensis HNU01 according to claim 1; (2) Fermentation broth of Clonostachys Hainanensis HNU01.

7. The product according to claim 6, characterized in that: The plant pathogens include Pyrrhoderma noxium, Phytophthora cinnamomi, Phytophthora infestans, Phytophthora capsici, Peronophthora litchii, Colletotrichum acutatum, Colletotrichum fragariae, Fusarium oxysporum oxysporum f.sp、Fusarium oxysporum(Schl.)F.spcucumerinum Owen.anamorph, Curvulariafallax, the pathogen of banana long spot disease.

8. The product according to claim 6, characterized in that: The plants include avocado, loquat, longan, lychee, wax apple, camphor tree, potato, tomato, pepper, mango, strawberry, banana and cucumber.

Images