Escherichia coli NA01 and application thereof

Abstract

The invention discloses Escherichia coli (Escherichia coli) NA01 and application thereof, the Escherichia coli NA01 is preserved in the China Center for Type Culture Collection (CCTCC) on September 24, 2024, and the preservation number is CCTCC NO: M20242061. The invention further discloses an application of the Escherichia coli NA01. According to the invention, Escherichia coli W3110 is used as an original strain, nitrous acid mutagenesis is adopted, and the structure of a microorganism is changed, so that gene mutation is generated, and a mutant strain Escherichia coli NA01 with high gallic acid tolerance is screened out. The Escherichia coli NA01 has high tolerance to gallic acid, and can be used as a chassis microorganism to construct a gallic acid high-yield strain through genetic engineering modification, so that the yield of gallic acid is increased.

Description

Technical Field

[0001] The invention relates to an Escherichia coli NA01 strain and application thereof, belonging to the technical field of microbial breeding. Background Art

[0002] Gallic acid, as a type of phenolic compound, also has a stress-inhibiting effect on E. coli. It increases membrane fluidity and permeability, induces cell membrane leakage, and destroys its integrity. In addition, after entering the cell, it will also destroy the intracellular hydrophobic structure and affect the physiological metabolism of the cell. The existence of the above problems seriously limits the ability and efficiency of E. coli to synthesize gallic acid. To achieve efficient synthesis of gallic acid by E. coli, the key core issue is to reduce or eliminate the stress inhibition of gallic acid on E. coli, in order to enhance E. coli's tolerance to gallic acid.

[0003] Mutation breeding is a breeding method that uses physical, chemical and biological means to artificially induce mutations in the genetic material of organisms, and then selects and cultivates new varieties or germplasms of animals, plants and microorganisms from the resulting mutations. Nitrite can directly react chemically with bacterial DNA, causing problems such as base pair mismatch or deletion during DNA replication, thereby causing changes in bacterial genetic information and causing microorganisms to mutate. Summary of the invention

[0004] Purpose of the invention: The first purpose of the present invention is to provide a strain of Escherichia coli NA01; the second purpose of the present invention is to provide a strain fermentation broth containing the Escherichia coli NA01; the third purpose of the present invention is to provide a microbial preparation containing the Escherichia coli NA01 or its strain fermentation broth; the fourth purpose of the present invention is to provide the use of the Escherichia coli NA01 or its fermentation broth or microbial preparation in the fermentation production of gallic acid.

[0005] Technical solution: The Escherichia coli NA01 described in the present invention is characterized in that the Escherichia coli NA01 was deposited in the China Center for Type Culture Collection (CCTCC) on September 24, 2024, with a collection number of CCTCC NO: M20242061, and the collection address is Wuhan University, Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and is classified and named: Escherichia coli NA01.

[0006] Furthermore, the Escherichia coli is obtained by nitrite mutagenesis screening.

[0007] The method for cultivating Escherichia coli of the present invention comprises the following steps:

[0008] (1) preparing activated seed solution;

[0009] (2) Determination of the screening threshold for gallic acid;

[0010] (3) Using nitrite to induce mutagenesis and screen for gallic acid-tolerant Escherichia coli;

[0011] (4) Subculture the mutagenic strain to determine its genetic stability;

[0012] (5) Preserving the strain seed liquid after subculture to obtain gallic acid-tolerant Escherichia coli; the strain fermentation liquid of the present invention comprises the Escherichia coli NA01 of the present invention.

[0013] The microbial preparation of the present invention comprises the Escherichia coli NA01 of the present invention or the fermentation liquid of the strain of the present invention.

[0014] The invention discloses an application of Escherichia coli NA01 in synthesizing gallic acid.

[0015] The invention discloses an application of the bacterial strain fermentation liquid in synthesizing gallic acid.

[0016] Application of the microbial preparation of the present invention in synthesizing gallic acid.

[0017] The present invention also includes a method for synthesizing gallic acid, which is synthesized by using the Escherichia coli NA01 of the present invention, the fermentation liquid of the strain of the present invention, or the microorganism of the present invention.

[0018] Furthermore, the Escherichia coli NA01 of the present invention, the fermentation liquid of the strain of the present invention or the microorganism of the present invention is used as a chassis microorganism and is modified by genetic engineering to synthesize gallic acid.

[0019] Furthermore, the Escherichia coli NA01 of the present invention, the fermentation broth of the strain of the present invention, or the microbial preparation of the present invention is cultured in a liquid culture medium.

[0020] Furthermore, the liquid culture medium is a synthetic culture medium, and each liter of liquid culture medium contains: 24 g of dipotassium hydrogen phosphate, 9.6 g of potassium dihydrogen phosphate, 1 g of magnesium sulfate heptahydrate, 5 g of ammonium sulfate, 30 g of glucose, 15 g of yeast powder, 2 g of citric acid monohydrate and 3 mL of trace element solution, wherein each liter of trace element solution contains: 2 g of Al2(SO4)3·18H2O, 0.75 g of CoSO4·7H2O, 5 g of CuS04·5H2O2, 0.5 g of H3BO3, 4 g of MnSO4·H2O2, 3 g of Na2MOO4·2H2O, 2.5 g of NiSO4·6H2O, 15 g of ZnSO4·7H2O and 5 g of FeSO4·7H2O2, and the pH of the liquid culture medium is maintained at 6.5-7.2.

[0021] The invention uses Escherichia coli W3110 as a starting strain, performs sodium nitrite mutagenesis and finally obtains an Escherichia coli NA01 with high tolerance to gallic acid. The invention has guiding significance for the construction of Escherichia coli as a gallic acid chassis microorganism and has potential research value for improving gallic acid yield.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0023] (1) The Escherichia coli NA01 screened by the present invention has a high tolerance to gallic acid.

[0024] (2) The Escherichia coli NA01 screened by the present invention can be used as a chassis microorganism and applied to the synthesis of gallic acid through genetic engineering modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a flow chart of the cultivation of Escherichia coli NA01 in Example 1;

[0026] Figure 2 This is a graph showing the determination result of the gallic acid stress threshold in Example 1;

[0027] Figure 3 The nitrous acid-induced lethality curve in Example 1 is shown;

[0028] Figure 4 This is a comparison of the colonies on the plate of wild E. coli W3110 and Escherichia coli NA01 under 3.0 g / L gallic acid stress in Example 2;

[0029] Figure 5This is a diagram showing the liquid culture of wild E. coli W3110 and Escherichia coli NA01 under 3.0 g / L gallic acid stress in Example 3;

[0030] Figure 6 The plasmid map of the expression vector pACYC177-aroF-pobA in Example 4;

[0031] Figure 7 This is a diagram showing the application results of Escherichia coli NA01 in gallic acid production in Example 5. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0033] Example 1

[0034] 1. Cultivation of Escherichia coli NA01

[0035] like Figure 1 As shown, the cultivation process of Escherichia coli NA01 is as follows:

[0036] (1) Prepare LB solid medium: Tryptone 10 g / L, Yeast 5 g / L, NaCl 5 g / L, Agar Powder 15 g / L;

[0037] Prepare LB liquid medium: Tryptone 10g / L, Yeast 5g / L, NaCl 5g / L;

[0038] Prepare mother solution: 2g sodium selenite in 100mL deionized water;

[0039] (2) Activation of the strain: Take out the E. coli W3110 (purchased from China Center for Type Culture Collection, item number: S376352) from -80°C, inoculate it into the LB solid medium prepared in step (1), streak it on a plate, and then place it in a 37°C constant temperature incubator for 10 hours. Pick a single colony with good growth in 10 / 50mL LB liquid medium, and culture it at 37°C, 250rpm for 12 hours to prepare the activated E. coli (E. coli) W3110 seed solution for use.

[0040] (3) The E. coli W3110 seed solution activated in step (2) was cultured at 37°C, 250 rpm for 10 h and then coated on a screening plate. Different gallic acid concentrations were set on the screening plate, namely 1.0 g / L, 1.1 g / L, 1.2 g / L, 1.3 g / L, 1.4 g / L, 1.5 g / L, and 1.6 g / L. After culturing E. coli W3110 for 10 h, the bacterial solution was diluted 10 -4 times, spread on the screening plate, culture in a constant temperature incubator at 37°C for 12 hours, and observe the growth. As the stress concentration increases, the degree of growth inhibition increases until no bacteria grow on the plate surface. The gallic acid concentration at this time is defined as the screening threshold (1.6 g / L). Figure 2 As shown in the figure, the number of E. coli colonies gradually decreased with the increase of gallic acid concentration. When the concentration of gallic acid was 1.5 g / L, there were still very few single colonies on the plate. When the concentration of gallic acid was increased to 1.6 g / L, no single colonies appeared on the plate. Therefore, 1.6 g / L of gallic acid was used as the screening threshold of the strain. If E. coli W3110 showed colonies on the surface of LB solid medium containing 1.6 g / L gallic acid after being treated with chemical mutagens, it was preliminarily inferred that the strain had a certain tolerance to gallic acid compared with the control strain (original E. coli W3110).

[0041] (4) The E. coli W3110 seed liquid activated in step (2) was cultured to the logarithmic growth phase, 1 mL of the bacterial liquid was centrifuged (10000 r / min, 4 min) to remove the supernatant, and washed with physiological saline. After washing, centrifuge again under the same conditions to remove the supernatant, add 1 mL of acetic acid-sodium acetate buffer with a pH value of 4.5 and 0.1 mol / L sodium nitrite solution to the precipitated bacteria, and gently shake to suspend them. The bacteria were induced by water bathing at 36°C for about 120, 150, 180, 210, 240, 270, 300, 330, and 360 s, and after the mutagenesis was completed, the bacterial liquid was diluted to 10 -5 times, take 0.15mL of the diluted bacterial solution and spread it on the screening plate, and design three parallel samples for each mutagenesis time. After 16 hours of culture, observe the growth and calculate the lethality. Figure 3 As shown. Figure 3It can be seen that under the action of sodium nitrite concentration of 0.1mol / L, the lethality is proportional to the growth of time. The longer the mutagenesis time, the higher the lethality of the strain. After 360s, the lethality of the bacteria reaches 100%. Usually, when the lethality of the bacteria is between 80% and 90%, the probability of obtaining a positive mutant strain is greater. When the sodium nitrite is treated for 210s, the lethality of the bacteria is 83.71%. Therefore, in order to obtain better mutagenesis results, this experiment uses 0.1mol / L sodium nitrite treatment for 210s as the optimal mutagenesis condition for the screening of highly tolerant Escherichia coli strains.

[0042] (5) The target strain NA01 was selected from the mutagenic strains treated with 0.1 mol / L sodium nitrite for 210 s in step (4) and cultured for 12 h as the activated seed liquid. The strain was inoculated into the LB liquid medium prepared in step (1) at a volume ratio of 10% and cultured at 37°C and 250 rpm for 10 h. The above steps were followed for 6 generations to determine its genetic stability.

[0043] (6) The activated seed solution prepared from the subcultured strain NA01 in step (5) was stored in a glycerol tube with a final concentration of 15%, stored in a -80°C refrigerator for a long term, and sent to the China Center for Type Culture Collection for preservation, with the preservation number of CCTCC M 20242061.

[0044] Example 2 Growth of Escherichia coli NA01 under high gallic acid solid conditions

[0045] 30uL of wild E. coli W3110 and screened Escherichia coli NA01 were taken in LB liquid medium at 37℃ for 10h, and then diluted 10 -6 times, spread on LB solid medium containing 3g / L gallic acid, and culture at 37℃ for 12h. Figure 4 As shown in the figure, on the LB solid medium containing 3g / L gallic acid, wild E. coli W3110 had no colonies, while Escherichia coli NA01 grew well and a single colony appeared. The results showed that compared with wild E. coli W3110, Escherichia coli NA01 had a higher tolerance to gallic acid.

[0046] Example 3 Growth of Escherichia coli NA01 in high gallic acid liquid conditions

[0047] 30uL of wild E. coli W3110 and screened Escherichia coli NA01 were taken in LB liquid medium containing 3g / L for 16h at 37℃. Samples were taken every 4h to measure the OD value at a wavelength of 600nm to determine the biomass. Figure 5 As shown in the figure, in LB liquid medium containing 3g / L gallic acid, the growth of wild E. coli W3110 was significantly inhibited, while Escherichia coli NA01 grew well. With the extension of culture time, the biomass of Escherichia coli NA01 gradually increased. The results showed that compared with wild E. coli W3110, Escherichia coli NA01 had a higher tolerance to gallic acid.

[0048] Example 4 Construction of pACYC177-aroF-pobA for Gallic Acid Synthesis Expression Vector The pACYC177 plasmid (purchased from China Center for Type Culture Collection, catalog number: TS153556) gene sequence (SEQ ID NO.1) was used as a template to design amplification primers P1 and P2, and PCR amplification was performed to obtain the pACYC177 plasmid backbone fragment pACYC. PCR reaction system: 1 μL pACYC177 plasmid DNA, 1 μL P1, 1 μL P2, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNAPolymerase. PCR reaction conditions: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 4 min, 35 cycles; 72°C extension for 10 min; 12°C insulation.

[0049] Using the gene sequence (SEQID NO.2) of pBV220 plasmid (purchased from China Center for Type Culture Collection, catalog number: TSPLA16466) as a template, primers P3 and P4 were designed, and PCR amplification was performed to obtain the PL promoter fragment; PCR reaction system: 1 μL pBV220 plasmid DNA, 1 μL P3, 1 μL P4, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNA Polymerase. Primers P5 and P6 were designed, and PCR amplification was performed to obtain the PR promoter fragment. PCR reaction system: 1 μL pBV220 plasmid DNA, 1 μL P5, 1 μL P6, 9.5 μL ddH2O, 12.5 μL prime STAR HSDNA Polymerase. The above PCR reaction conditions are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 0.5 min, 35 cycles; 72°C extension for 10 min; 12°C insulation.

[0050] Using the wild Escherichia coli (E.coli) W31103-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthase (AroF) encoding gene aroF encoding gene sequence (NCBI ID: 947084) as a template, amplification primers P7 and P8 were designed, and the gene aroF was amplified by PCR. PCR reaction system: 1μL E.coli W3110 genomic DNA, 1μL P7, 1μL P8, 9.5μL ddH2O, 12.5μL prime STAR HSDNA Polymerase. PCR reaction conditions: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 1.5min, 35cycles; 72℃ extension for 10min; 12℃ insulation.

[0051] Using the gene sequence (NCBI ID: 882128) of p-hydroxybenzoate hydroxylase (PobA) encoding gene pobA of Pseudomonas aeruginosa PAO1 (purchased from American Type Culture Collection, catalog number: KCSP.ATCC.47085D-5) as a template, primers P9 (nucleotide sequence as shown in SEQ ID NO.3) and P10 (nucleotide sequence as shown in SEQ ID NO.4) were designed to amplify gene pobA by PCR. PCR reaction system: 1 μL P. aeruginosa PAO1W3110 genomic DNA, 1 μL primer P9, 1 μL primer P10, 9.5 μL ddH2O, 12.5 μL prime STARHSDNAPolymerase. PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1.5 min, 35 cycles; extension at 72°C for 10 min; insulation at 12°C.

[0052] The above five PCR amplification products (pACYC, PL, PR, aroF, pobA) were tested for yield and specificity by 1% agarose gel electrophoresis, and purified by PCR product recovery kit (BIOMIGA, Shanghai Jinpan Biotechnology Co., Ltd.). After purification, the connection was carried out according to the operating steps of the one-step rapid cloning kit (Yisheng Biological Commercial Tool Vector, Catalog No. 10923ES20). The ligation product was transformed into Escherichia coli DH5α (purchased from China Center for Type Culture Collection, Catalog No.: TS277737) competent cells, cultured at 37°C for 8h, and the transformants were selected for shaking culture in LB containing 30mg / L kanamycin. The plasmid was extracted and verified by enzyme digestion to obtain the expression plasmid pACYC177-aroF-pobA (such as Figure 6 shown).

[0053] Prepare wild E.coli W3110 and Escherichia coli NA01 as electroporation competent cells, and place them in a -80℃ refrigerator for standby use. Thaw the E.coli W3110 competent cells and plasmid pACYC177-aroF-pobA on ice for 5-10 minutes; gently add 2.5μL of plasmid to the thawed E.coli W3110 competent cells and mix gently; add the competent cells containing the plasmid to an electroporation cup with a pore size of 1mm and place it on ice for 10 minutes; perform electroporation at a voltage of 1.8kV, and the pulse time is more than 5ms for the effective electroporation time. Then use a pipette to quickly transfer the mixed solution in the electroporation cup to 900 μL of LB medium, culture at a speed of 200 rpm and a temperature of 37°C for 2 hours, take an appropriate amount of bacterial solution and apply it on an LB plate containing kanamycin (30 mg / L), and culture it at 37°C for 8 hours to obtain the original strain, named SDL-1. Pick a single colony to liquid LB, culture it at 37°C overnight, and save it in a glycerol tube. Using the same transformation method, transform the plasmid pACYC177-aroF-pobA into Escherichia coli NA01 competent cells, apply it on an LB plate containing kanamycin (30 mg / L), and culture it at 37°C for 8 hours to obtain a gallic acid production strain named SDL-2. Pick a single colony to liquid LB, culture it at 37°C overnight, and save it in a glycerol tube.

[0054] SEQ ID NO.1 (>pACYC177 plasmid gene sequence (3941 bp)):

[0055] GTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATG

[0056] ACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTA

[0057] AGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACT

[0058] TCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGG

[0059] GATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAA

[0060] CGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTA

[0061] TTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0062] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTA

[0063] TTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTG

[0064] GGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGC

[0065] AACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGC

[0066] ATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCA

[0067] TTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAAT

[0068] CCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCTTAATAAGATGATCTTC

[0069] TTGAGATCGTTTTGGTCTGCGCGTAATCTCTTGCTCTGAAAACGAAAAAACCGCCT

[0070] TGCAGGGCGGTTTTTCGAAGGTTCTCTGAGCTACCAACTCTTTGAACCGAGGTAAC

[0071] TGGCTTGGAGGAGCGCAGTCACCAAAACTTGTCCTTTCAGTTTAGCCTTAACCGGC

[0072] GCATGACTTCAAGACTAACTCCTCTAAATCAATTACCAGTGGCTGCTGCCAGTGGT

[0073] GCTTTTGCATGTCTTTCCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCA

[0074] GCGGTCGGACTGAACGGGGGGTTCGTGCATACAGTCCAGCTTGGAGCGAACTGCC

[0075] TACCCGGAACTGAGTGTCAGGCGTGGAATGAGACAAACGCGGCCATAACAGCGG

[0076] AATGACACCGGTAAACCGAAAGGCAGGAACAGGAGAGCGCACGAGGGAGCCGC

[0077] CAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCACTGATTT

[0078] GAGCGTCAGATTTCGTGATGCTTGTCAGGGGGGCGGAGCCTATGGAAAAACGGCT

[0079] TTGCCGCGGCCCTCTCACTTCCCTGTTAAGTATCTTCCTGGCATCTTCCAGGAAATC

[0080] TCCGCCCCGTTCGTAAGCCATTTCCGCTCGCCGCAGTCGAACGACCGAGCGTAGC

[0081] GAGTCAGTGAGCGAGGAAGCGGAATATATCCTGTATCACATATTCTGCTGACGCAC

[0082] CGGTGCAGCCTTTTTTCTCCTGCCACATGAAGCACTTCACTGACACCCTCATCAGT

[0083] GCCAACATAGTAAGCCAGTATACACTCCGCTAGCGCTGAGGTCTGCCTCGTGAAGA

[0084] AGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGA

[0085] GGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAA

[0086] CTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCT

[0087] TCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCACGTTGTGTCTCAAAATCTC

[0088] TGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCT

[0089] TACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTG

[0090] CTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGC

[0091] TCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCG

[0092] ATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACA

[0093] GATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAA

[0094] GCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAA

[0095] AACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGC

[0096] GCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAA

[0097] CAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGG

[0098] TTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGG

[0099] AAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGA

[0100] TTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTT

[0101] GGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCT

[0102] CGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAA

[0103] TCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAA

[0104] TTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGG

[0105] CTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCC

[0106] GACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCC

[0107] ACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGG

[0108] GGCGATTCAGGCCTGGTATGAGTCAGCAACACCTTCTTCACGAGGCAGACCTCAG

[0109] CGCTCAAAGATGCAGGGGTAAAAGCTAACCGCATCTTTACCGACAAGGCATCCGG

[0110] CAGTTCAACAGATCGGGAAGGGCTGGATTTGCTGAGGATGAAGGTGGAGGAAGG

[0111] TGATGTCATTCTGGTGAAGAAGCTCGACCGTCTTGGCCGCGACACCGCCGACATGA

[0112] TCCAACTGATAAAAGAGTTTGATGCTCAGGGTGTAGCGGTTCGGTTTATTGACGAC

[0113] GGGATCAGTACCGACGGTGATATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGT

[0114] GGCACAGGCTGAACGCCGGAGGATCCTAGAGCGCACGAATGAGGGCCGACAGGA

[0115] AGCAAAGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGT

[0116] CGTGCTGACGCTTCATCAGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTC

[0117] AGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATA

[0118] CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCA

[0119] CTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAA

[0120] ATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAA

[0121] GGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCAT

[0122] TTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAA

[0123] GATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGA

[0124] TCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTT

[0125] CTGCTATGTGGCGCGGTATTATCCCGT;

[0126] SEQ ID NO.2 (>pBV220 plasmid gene sequence (3666bp)):

[0127] GAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTCTGTTTTGGCTTATGAG

[0128] AGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAA

[0129] ACAGAATTTGCCTCCCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC

[0130] TCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAG

[0131] TAGCCAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCT

[0132] TTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCG

[0133] GGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGC

[0134] CCGCCATAAACTGCCAGGCATCAAAGGAATCAGAAGGCCATCCTGACGGATGGCC

[0135] TTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCG

[0136] CTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTAT

[0137] GAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT

[0138] GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGG

[0139] GTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAG

[0140] TTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGG

[0141] CGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACT

[0142] ATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGAT

[0143] GGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGC

[0144] GGCCAACTTACTTCTGACAACGATCGGGAGGACCGAAGGAGCTAACCGCTTTTTT

[0145] GCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGATCTGAATG

[0146] AAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAAC

[0147] GTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAAT

[0148] AGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCG

[0149] GCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTAT

[0150] CATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGA

[0151] CGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGC

[0152] CTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATT

[0153] GATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATC

[0154] TCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTA

[0155] GAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTG

[0156] CAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTAC

[0157] CAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTC

[0158] CTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTAC

[0159] ATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGT

[0160] GTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGG

[0161] CTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGA

[0162] ACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGA

[0163] AAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGG

[0164] GAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCAACC

[0165] TCTGACTTGAGCGTCGATTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA

[0166] AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCA

[0167] CATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAG

[0168] TGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC

[0169] GAGGAAGCGGAAGAGCGCCCTTATCTTTCCCTTTATTTTTGCTGCGGTAAGTCGCAT

[0170] AAAAACCATTCTTCATAATTCAATCCATTTACTATGTTATGTTCTGAGGGGAGTGAA

[0171] AATTCCCCTAATTCGATGAAGATTCTTGCTCAATTGTTATCAGCTATGCGCCGACCA

[0172] GAACACCTTGCCGATCAGCCAAACGTCTCTTCAGGCCACTGACTAGCGATAACTTT

[0173] CCCCACAACGGAACAACTCTCATTGCATGGGATCATTGGGTACTGTGGGTTTAGTG

[0174] GTTGTAAAAACACCTGACCGCTATCCCTGATCAGTTTCTTGAAGGTAAACTCATCA

[0175] CCCCCAAGTCTGGCTATGCAGAAATCACCTGGCTCAACAGCCTGCTCAGGGTCAA

[0176] CGAGAATTAACATTCCGTCAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGGTCATG

[0177] GAATTACCTTCAACCTCAAGCCAGAATGCAGAATCACTGGCTTTTTTGGTTGTGCT

[0178] TACCCATCTCTCCGCATCACCTTTGGTAAAGGTTCTAAGCTTAGGTGAGAACATCCC

[0179] TGCCTGAACATGAGAAAAAACAGGGTACTCATACTCACTTCTAAGTGACGGCTGC

[0180] ATACTAACCGCTTCATACATCTCGTAGATTTCTCTGGCGATTGAAGGGCTAAATTCT

[0181] TCAACGCTAACTTTGAGAATTTTTGCAAGCAATGCGGCGTTATAAGCATTTAATGCA

[0182] TTGATGCCATTAAATAAAGCACCAACGCCTGACTGCCCCATCCCCATCTTGTCTGCG

[0183] ACAGATTCCTGGGATAAGCCAAGTTCATTTTTCTTTTTTTCATAAATTGCTTTAAGG

[0184] CGACGTGCGTCCTCAAGCTGCTCTTGTGTTAATGGTTTCTTTTTTGTGCTCATACGT

[0185] TAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACC

[0186] TCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATGGAACAACGCATAAC

[0187] CCTGAAAGATTATGCAATGCGCTTTGGGCAAACCAAGACAGCTAAAAGATCTCTCA

[0188] CCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAACATACAGATA

[0189] ACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTG

[0190] ATACTGAGCACATCAGCAGGACGCACTGACCACCATGAAGGTGACGCTCTTAAAA

[0191] ATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGTGATACGAAACGAAGCATTGGTTAAAAATTAAGGAG;

[0192] The sequences of the primers for amplifying the pACYC177 plasmid backbone fragment pACYC are as follows:

[0193] Forward primer P1: 5′-CCTGCAGCAATGGCAACAAC-3′;

[0194] Reverse primer P2: 5′-GATCCTCCGGCGTTCAGCCT-3′;

[0195] PL promoter amplification primers:

[0196] Forward primer P3: 5′-GAACGCCGGAGGATCCCAATGCTTCGTTTCGTATC-3′;

[0197] Reverse primer P4: 5′-GATCTCTCACCTACCAAACAATGC-3′;

[0198] PR promoter amplification primers:

[0199] Forward primer P5: 5′-TAGTTGATCCTCAGATCTTTAGCTGTCTTG GTTTGCCCAA-3′;

[0200] Reverse primer P6: 5′-ATTTAATGCATTGATGCC-3′;

[0201] AroF encoding gene aroF amplification primers:

[0202] Forward primer P7: 5′-GCATTGTTTGGTAGGTGAGAGATCGCCTCGCGCT CCGGAACATA-3′;

[0203] Reverse primer P8: 5′-CTGAGGATCAACTATCGCAAACGA-3′;

[0204] Primers for amplification of the PobA coding gene:

[0205] Forward primer P9 (SEQ ID NO.3):

[0206] 5'-GGCATCAATGCATTAAATATGAAGACTCAAGTCGCCAT-3';

[0207] Reverse primer P10 (SEQ ID NO.4):

[0208] 5'-TTGCCATTGCTGCAGGGTTCTGGGCGAGATCGGACA-3'.

[0209] Example 5 Application of Escherichia coli NA01 in the production of gallic acid The strains SDL-1 and SDL-2 obtained in Example 4 were fermented in shake flasks at 37° C. for 24 h. During the fermentation process, 20% ammonia water was used to adjust the culture medium (the culture medium is a synthetic culture medium, and each liter of the culture medium contains: 24 g of dipotassium hydrogen phosphate, 9.6 g of potassium dihydrogen phosphate, 1 g of magnesium sulfate heptahydrate, 5 g of ammonium sulfate, 30 g of glucose, 15 g of yeast powder, 2 g of citric acid monohydrate and 3 ml of trace element solution, wherein each liter of the trace element solution contains: 2 g of Al2(SO4)3·18H2O, 0.75 g of CoSO4·7H2O, 5 g of CuS04·5H2O2, 0.5 g of H3BO3, 4 g of MnSO4·H2O2, 3 g of Na2MOO4·2H2O, 2.5 g of NiSO4·6H2O, and 3 ml of trace element solution. 15g and FeSO4·7H2O25g) pH was maintained at 6.5-7.2. The results of the shake flask experiment are as follows Figure 7 As shown, compared with strain SDL-1, it can be found that the final gallic acid content of strain SDL-2 is 1.8 g / L, and the gallic acid yield is 2.25 times that of SDL-1. Therefore, the Escherichia coli NA01 provided by the present invention can be used as an excellent chassis microorganism for the production of gallic acid.

Claims

1. A strain of Escherichia coli NA01, characterized in that: The Escherichia coli (Escherichiacoli) NA01 was deposited in the China Center for Type Culture Collection (CCTCC) on September 24, 2024, with the deposit number being CCTCCNO: M20242061.

2. A strain fermentation broth, characterized in that: The invention comprises the Escherichia coli NA01 as claimed in claim 1.

3. A microbial preparation, characterized in that: It comprises the Escherichia coli NA01 described in claim 1 or the fermentation broth of the strain described in claim 2.

4. Use of the Escherichia coli NA01 described in claim 1 in synthesizing gallic acid.

5. Use of the fermentation broth of the strain according to claim 2 in synthesizing gallic acid.

6. Use of the microbial preparation according to claim 3 in synthesizing gallic acid.

7. A method for synthesizing gallic acid, characterized in that: The method is prepared by using the Escherichia coli NA01 described in claim 1, the fermentation liquid of the strain described in claim 2, or the microorganism described in claim 3.

8. The synthesis method according to claim 7, characterized in that The Escherichia coli NA01 described in claim 1, the fermentation liquid of the strain described in claim 2, or the microorganism described in claim 3 are made into chassis microorganisms and modified by genetic engineering for the synthesis of gallic acid.

9. The synthesis method according to claim 7, characterized in that: The Escherichia coli NA01 according to claim 1, the fermentation liquid of the strain according to claim 2, or the microbial preparation according to claim 3 is cultured in a liquid culture medium.

10. The synthesis method according to claim 9, characterized in that The liquid culture medium is a synthetic culture medium, and each liter of the liquid culture medium contains: 24g of dipotassium hydrogen phosphate, 9.6g of potassium dihydrogen phosphate, 1g of magnesium sulfate heptahydrate, 5g of ammonium sulfate, 30g of glucose, 15g of yeast powder, 2g of citric acid monohydrate and 3ml of trace element solution, wherein each liter of the trace element solution contains: Al2(SO4)3·18H2O2g, CoSO4·7H2O 0.75g, CuS04·5H2O2 5g, H3BO3 0.5g, MnSO4·H2O2 4g, Na2MOO4·2H2O 3g, NiSO4·6H2O 2.5g, ZnSO4·7H2O 15g and FeSO4·7H2O2 5g, and the pH of the liquid culture medium is maintained at 6.5-7.2.

Images