Engineering escherichia coli for producing O-succinyl-L-homoserine as well as construction method and application of engineering escherichia coli

Abstract

The invention discloses engineering escherichia coli for producing O-succinyl-L-homoserine as well as a construction method and application of the engineering escherichia coli, and the engineering escherichia coli for producing the O-succinyl-L-homoserine with high yield is constructed by enhancing the synthetic route of a precursor aspartic acid and homoserine and enhancing the supply of a coenzyme NADPH (Nicotinamide Adenine Dinucleotide Phosphate). A process of controlling dissolved oxygen by stages is adopted, a fed-batch culture medium is fed, the fermentation yield of the O-succinyl-L-homoserine is 125g / L, and the sugar-acid conversion rate is 63%. The method disclosed by the invention is simple, short in time consumption and low in cost, and has a relatively good large-scale application prospect.

Description

(I) Technical field

[0001] The invention belongs to the technical fields of biotechnology and biochemical engineering, and relates to an engineering Escherichia coli for producing O-succinyl-L-homoserine, a construction method and application thereof. (II) Background technology

[0002] O-Succinyl-L-homoserine (OSH) is an important C4 platform compound that can be used to synthesize L-methionine, L-phosphinothricin, isobutanol, γ-butyrolactone, 1,4-butanediol, etc. It has broad application prospects in many fields such as food, medicine, and agriculture. At present, chemical synthesis is difficult to achieve large-scale production due to harsh reaction conditions, high operating risks, and high emissions of three wastes. With the rapid development of synthetic biology, the construction of microbial cell factories has become an important means of green and efficient production of OSH.

[0003] According to reports, OSH has been mainly synthesized by chemical methods since then. L-homoserine is used as a precursor to react with benzyloxycarbonyl chloride in an aqueous solution at 0°C, and then HCl is added to the aqueous solution to acidify the reaction system to obtain the product N-benzyloxycarbonyl-L-homoserine. Anhydrous pyridine is heated, and the obtained N-benzyloxycarbonyl-L-homoserine is added as a precursor to react with succinic anhydride to succinate it to obtain O-succinyl-N-benzyloxycarbonyl-L-homoserine, which is further hydrogenolyzed to synthesize OSH. However, due to the long steps, harsh reaction conditions and low synthesis efficiency, this method can only synthesize OSH on a laboratory scale. In recent years, with the development of synthetic biology and metabolic engineering technology, the construction of efficient microbial cell factories has become an important strategy for the biosynthesis of OSH. In Escherichia coli, a molecule of glucose is converted into acetyl CoA through the glycolysis pathway, and then acetyl CoA enters the citric acid cycle. Oxaloacetate in the citric acid cycle accepts the amino group transferred from glutamate to become L-aspartate, which is converted into asparagine-4-phosphate under the action of aspartate aminotransferase and aspartate kinase. Then, aspartate is generated under the action of aspartate semialdehyde dehydrogenase and homoserine dehydrogenase, and finally converted into OSH under the catalysis of homoserine O-succinyltransferase.

[0004] In previous studies, an engineered Escherichia coli production bacterium was constructed by knocking out negative transcriptional regulators and downstream product transporters, inactivating cysteine ​​γ-synthetase, replacing the original promoter of the bifunctional aspartate kinase / homoserine dehydrogenase II with a strong promoter, overexpressing feedback inhibition-desensitized homoserine succinyltransferase and aspartate kinase / homoserine dehydrogenase I, and overexpressing the L-methionine transport system, and the OSH production reached 9.31 g / L (3Biotech, 2018, 8:310).

[0005] In order to further improve the production efficiency of OSH, after carefully analyzing the key factors that limit further improving the OSH productivity, we propose that the supply balance between precursors and reducing power is an urgent issue that needs to be addressed.

[0006] In summary, the engineered Escherichia coli capable of efficiently producing L-methionine precursor O-succinyl-L-homoserine was constructed, which is of great significance in the field of L-methionine production. (III) Summary of the invention

[0007] The present invention aims to provide an engineered Escherichia coli for producing O-succinyl-L-homoserine (OSH), a construction method and an application thereof, and achieves a supply balance between precursors and reducing capacity by strengthening an upstream precursor biosynthetic pathway and the flux of NAD(P)H used to synthesize OSH. On this basis, the production efficiency of OSH is further improved through systematic regulation of the fermentation process, thereby achieving efficient synthesis of the target product.

[0008] The technical solution adopted by the present invention is:

[0009] The invention provides an engineered Escherichia coli for producing O-succinyl-L-homoserine. The engineered Escherichia coli is constructed by using Escherichia coli as a starting strain, knocking out the metB (cystathionine-γ-synthase) gene, the metJ gene, the metI gene encoding the MetD protein of the L-methionine transport system, and the thrB gene encoding the homoserine kinase to construct a chassis bacterium; the chassis bacterium is subjected to one or more of the following gene editing to obtain the engineered Escherichia coli for producing O-succinyl-L-homoserine: (1) a cystathionine-γ-synthase gene derived from Pseudomonas aeruginosa; and (2) a cystathionine-γ-synthase gene derived from Pseudomonas aeruginosa. aeruginosa) after codon optimization, the aspDH gene of the chassis bacteria was replaced in situ with the aspC gene; (2) the original promoter of the thrA gene of the strain in step (1) was replaced with the Trc promoter, the original promoter of the metL gene was replaced with the Trc promoter, and the original metA gene was replaced with the gene encoding the metA mutant; the metA mutant was a protein encoded by the metA gene (homoserine succinyltransferase) with the 63rd amino acid mutated from leucine to phenylalanine, and the 28th alanine mutated to valine (L63F / A28V); (3) the zwf and gnd genes from Corynebacterium glutamicum were introduced into the strain in step (2) respectively; (4) the strain in step (3) overexpressed the gene gapC encoding NAD(P)H-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Clostridium acetobutylicum and the gene encoding the metA mutant in step (2).

[0010] Furthermore, the nucleotide sequence of the metB gene is shown in SEQ ID NO.1; the nucleotide sequence of the metJ gene is shown in SEQ ID NO.2, the nucleotide sequence of the metI gene is shown in SEQ ID NO.3, and the nucleotide sequence of the thrB gene is shown in SEQ ID NO.4.

[0011] Furthermore, the nucleotide sequence of the aspDH gene after codon optimization is shown in SEQ ID NO.5.

[0012] Furthermore, the nucleotide sequence of Trc promoter is shown in SEQ ID NO.6.

[0013] Furthermore, the nucleotide sequence of the gene encoding the metA mutant L63F / A28V is shown in SEQ ID NO.7.

[0014] Furthermore, the nucleotide sequence of the zwf gene is shown in SEQ ID NO.8, and the nucleotide sequence of the gnd gene is shown in SEQ ID NO.9.

[0015] Furthermore, the nucleotide sequence of the gapC gene is shown in SEQ ID NO.10.

[0016] The starting strain of the present invention can be Escherichia coli commonly used in the art, and can be selected according to needs without special limitation. For example, the starting strain includes E. coli W3110.

[0017] The present invention knocks out the negative transcriptional regulatory factor metJ of Escherichia coli to relieve the negative feedback inhibition of the key enzyme of OSH synthesis pathway, knocks out cystathionine-γ-synthase (metB gene encoding) to block the consumption pathway of OSH, and knocks out the homoserine kinase encoded by thrB gene to block the competitive bypass of L-threonine. In order to reduce the inhibition of oxaloacetate on the aspC gene encoding aspartate aminotransferase, the aspDH gene derived from Pseudomonas aeruginosa is introduced to replace the aspC gene on the chassis strain OSHUP3 in situ. Compared with the aspDH gene from other sources, the gene has stronger mesophilicity, alleviates the inhibition of oxaloacetate on it, and strengthens the aspartate pathway. In order to improve the expression efficiency of foreign genes on the E. coli genome, the codons of the aspDH gene are optimized so that it has higher efficiency in expression in E. coli, which can further improve the yield of O-succinyl-L-homoserine. The Trc promoter was used to replace the promoters of thrA and metL on the OSHUP4 genome in situ, and the amino acid at position 63 of the homoserine succinyltransferase gene metA was mutated from leucine to phenylalanine and the amino acid at position 28 was mutated to valine (L63F / A28V), then the original metA was replaced to release its feedback inhibition.

[0018] The invention enhances the synthesis of NAD(P)H by modifying the pentose phosphate pathway (PPP), and comprises the following genes: (1) glucose-6-phosphate dehydrogenase (G6PDH) encoded by the zwf gene from Corynebacterium glutamicum; (2) glucose-6-phosphate dehydrogenase (6PDGH) encoded by the gnd gene from Corynebacterium glutamicum; and (3) glyceraldehyde 3-phosphate dehydrogenase gene (GAPDH) encoded by gapC.

[0019] E. coli's own G6PDH and 6PDGH will undergo allosteric inhibition under the action of ATP, phosphoenolpyruvate and fructose-1,6-bisphosphate, thus affecting its catalytic efficiency. Therefore, the two genes zwf and gnd from Corynebacterium glutamicum were introduced. When glucose is used as a carbon source, the glycolysis pathway produces excessive NADH, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) encoded by gapC is responsible for generating NADH. Another GAPDH (NAD(P)H-dependent) encoding gene gapC from Clostridium acetobutylicum was overexpressed with the gene encoding the metA mutant, thereby increasing the production of NADPH in the glycolysis pathway, and constructing strain OSHUP7.

[0020] It can be understood that the corresponding variants of the glucose-6-phosphate dehydrogenase gene, 6-phosphate glucose dehydrogenase gene and glyceraldehyde-3-phosphate dehydrogenase gene disclosed in the art are all suitable for the present invention. For example, the relevant sequences of genes related to the synthesis of L-methionine precursor O-succinyl-L-homoserine can be queried through the NCBI database. The specific nucleic acid sequence can be selected from the following sequences or sequences with more than 90% homology thereto.

[0021] The present invention also provides a method for constructing the engineered Escherichia coli, which adopts the CRISPR / Cas9 dual-plasmid system for genome modification. The system has two plasmids, a pCas plasmid and a pTarget plasmid, and the pTarget plasmid carries both gRNA and donor DNA.

[0022] The present invention also provides an application of the engineered Escherichia coli in producing O-succinyl-L-homoserine, wherein the application method is as follows: the engineered Escherichia coli is inoculated into a fermentation tank added with MS culture medium, the pressure of the fermentation tank is 0.05-0.06Mpa, the air volume is 1.2m 3 / h, initial speed 100-600rpm, temperature 37℃; in the early stage of fermentation, DO was maintained at 50-60%, and after 36h, DO was maintained at 10-30%; fermentation liquid OD 600 When the pH value reaches 8, 0.5 mmol / L IPTG is added; after the initial glucose is consumed, the feed medium is fed at a constant rate to control the glucose concentration between 0-5 g / L.

[0023] The composition of MS medium is: glucose 30g / L, (NH4)2SO4 16g / L, yeast extract 5g / L, KH2PO4 1g / L, betaine 2g / L, MgSO4 0.5g / L, FeSO4·4H2O 0.01g / L, MnSO4 0.005g / L, ZnSO40.0025g / L, L-threonine 0.2g / L, L-isoleucine 0.2g / L, CaCO3 20g / L, the solvent is water, when the cultured strain carries the gapC gene and metA mutant encoding gene overexpression plasmid, 50μg / mL kanamycin is added.

[0024] Feed medium composition: glucose 500 g / L, yeast extract 10 g / L, L-isoleucine 0.2 g / L, L-threonine 0.2 g / L, (NH4)2SO4 8 g / L, KH2PO4 12 g / L, MgSO4 0.5 g / L, betaine 2 g / L, solvent is water, pH is natural.

[0025] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0026] (1) The present invention constructs an engineered Escherichia coli that produces high levels of O-succinyl-L-homoserine by strengthening the synthesis pathway of precursors aspartic acid and homoserine and strengthening the supply of coenzyme NADPH. The OSH yield is increased by more than 75%, and the biomass (OD600) is increased to 9.95.

[0027] (2) Based on the above-mentioned engineered E. coli, the fermentation process was optimized. The tank pressure of the fermentation tank was 0.05-0.06Mpa, and the air volume was 1.2m 3 / h, the inoculation amount was 10%, the initial rotation speed was 400rpm, and a staged dissolved oxygen control process was adopted. The dissolved oxygen was controlled at 30%-50% 36h before fermentation, and then maintained at 20%. After the initial glucose was consumed, the culture medium was fed at a constant rate to control the glucose concentration between 0-5g / L. The feeding was continued until the end of the fermentation. The output of O-succinyl-L-homoserine was 125g / L, and the sugar-acid conversion rate was 63%.

[0028] (3) The method of the present invention is simple, time-saving, low-cost, and has good prospects for large-scale application. (IV) Description of the drawings

[0029] Figure 1 Schematic diagram of donor DNA construction; A represents the target fragment to be knocked out, and B represents the target fragment to be replaced.

[0030] Figure 2 Comparison of biomass and OSH production among OSHUP1, OSHUP2, OSHUP3 and the starting strain.

[0031] Figure 3 Comparison of biomass and yield among OSHUP5, OSHUP4 and OSHUP3 strains.

[0032] Figure 4 Comparison of biomass and yield among OSHUP7, OSHUP6 and OSHUP5 strains.

[0033] Figure 5 Biomass and yield of OSH high-producing bacteria in a 50L fermenter. (V) Specific implementation methods

[0034] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0035] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product instructions shall be followed.

[0036] The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased through regular channels.

[0037] Escherichia coli W3110 was purchased from Shanghai Yuchun Biotechnology Co., Ltd., and plasmid pCas was purchased from Yunzhou Biotechnology.

[0038] LB medium composition: yeast extract 5g / L, peptone 10g / L, sodium chloride 10g / L, the solvent is water.

[0039] MS culture medium composition: glucose 30g / L, (NH4)2SO4 16g / L, yeast extract 5g / L, KH2PO4 1g / L, betaine 2g / L, MgSO4 0.5g / L, FeSO4·4H2O 0.01g / L, MnSO4 0.005g / L, ZnSO4 0.0025g / L, L-threonine 0.2g / L, L-isoleucine 0.2g / L, CaCO3 20g / L, and the solvent is water.

[0040] Example 1: Construction of the bottom plate bacteria OSHUP3

[0041] The CRISPR / Cas9 dual plasmid system is used for genome modification. There are two plasmids in the system, pCas plasmid and pTarget plasmid. The pCas plasmid is responsible for expressing the Cas9 protein. Cas9 is a multifunctional protein. While participating in the crRNA maturation process, it can also be guided by the tracrRNA:crRNA complex to cut the target sequence DNA. The recognition site is in front of the PAM site (usually 5′-NGG-3′) downstream of the protospacer region. After cutting, a double-strand break (DSBs) is formed; the pTarget plasmid carries both gRNA and donor DNA.

[0042] Using Escherichia coli W3110 as the starting strain, Figure 1 In middle A, metB, the gene encoding cystathionine-γ-synthase, metJ gene encoding the transcriptional negative regulatory protein MetJ, metI gene encoding the L-methionine transport system MetD protein, and thrB gene encoding homoserine kinase were knocked out respectively to construct the chassis bacteria OSHUP3 for producing the L-methionine precursor O-succinyl-L-homoserine and test the OSH production performance.

[0043] 1. Use the above-mentioned CRISPR / Cas technology to knock out the cystathionine-γ-synthase encoding gene metB and construct the OSHUP1 strain.

[0044] (1) Primer design

[0045] E. coli W3110 genomic DNA was extracted as a template, and primers for knocking out the target gene were designed according to the metB target gene to be knocked out (nucleotide sequence as shown in SEQ ID NO.1), including upstream homologous arm primers P1 and P2 for amplifying the target gene to be knocked out, and downstream homologous arm primers P2 and P4 for amplifying the target gene to be knocked out.

[0046] P1: 5'CGGTGCTTTTTTGAATTCTCTAGAATGCAGAAACGCTT CGCACA3',

[0047] P2: 5'GCCTGCGCAATCACACTCATGGGCTTTGTCGGTGAAATGT3',

[0048] P3: 5'AAAGCCCAGGGAACTTCATCGAAAGGTCGTCAGCTGCATA3',

[0049] P4: 5'GGGTAATAGATCTAAGCTTCTGCAGCGTTCAGCGCGTAAAAACTC3'.

[0050] (2) Doner fragment

[0051] The PCR amplification reaction system used to amplify the upstream homology arm of the knockout target gene: 2×Phanta MaxBuffer 25μL, dNTP Mix 1μL, template 0.5μL, primer P1 and primer P2 0.5μL each, high-fidelity DNA polymerase 1μL, ddH2O is added to 50μL.

[0052] The PCR amplification reaction system used to amplify the downstream homology arm of the knockout target gene: 2×Phanta MaxBuffer 25μL, dNTP Mix 1μL, template 0.5μL, primer P2 and primer P4 0.5μL each, high-fidelity DNA polymerase 1μL, ddH2O is added to 50μL.

[0053] Amplification conditions were as follows: (1) 95°C for 10 min; (2) 95°C for 30 s, 55°C for 30 min, and 72°C for 30 s, for a total of 25 cycles; (3) 72°C for 10 min.

[0054] After the upstream and downstream homology arm fragments are obtained, they are recovered by gel recovery, and then the gel-recovered products are used as templates to perform fusion PCR using primers P1 and P4 to obtain the Doner fragment.

[0055] (3) pTarget knockout plasmid vector

[0056] Using the pTarget plasmid as a template, primers P5 and P6 were used to perform PCR amplification in the same amplification system and conditions as in step (2). The original 20 bp sequence on the pTarget plasmid was mutated to the sequence before the PAM site of the target gene. The mutated product was digested with DpnⅠ digestion enzyme to degrade the template, and then the product was amplified with the Doner fragment in step (2) using Clon Express TM Ultra One Step Cloning Kit.

[0057] P5:

[0058] 5'TAATACTAGTTCCAGCACCTATAACTTTACGTTTTAGAGCTAGAAATAGC3',

[0059] P6:

[0060] 5'GCTCTAAAACGTAAAGTTATAGGTGCTGGAACTAGTATTATACCTAGGAC3'.

[0061] (4)OSHUP1 strain

[0062] First, the pCas plasmid was transferred into the competent cells of Escherichia coli W3110, spread on an LB plate containing 50 μg / mL kanamycin sulfate (Kan) resistance, and inverted at 30°C overnight. A single colony was picked to prepare an electroporation competent cell (0.01 mol / L L-arabinose was added to the culture medium to induce the expression of the pCas protein). The pTarget plasmid constructed in step (3) was transferred into the competent cells and spread on an LB plate containing both 50 μg / mL Kan resistance and 50 μg / mL spectinomycin hydrochloride (SD) resistance. After inverted culture at 30°C, a single colony was picked and verified by colony PCR and sequencing. A single colony with a correct sequencing result indicated that the corresponding gene was successfully knocked out, thereby obtaining the OSHUP1 strain.

[0063] 2. OSHUP2 strain

[0064] The method of step 1 was used to knock out the metJ gene (nucleotide sequence as shown in SEQ ID NO.2) encoding the transcriptional negative regulatory protein MetJ and the metI gene (nucleotide sequence as shown in SEQ ID NO.3) encoding the L-methionine transport system MetD protein in the OSHUP1 strain to construct the OSHUP2 strain.

[0065] The primers used to knock out the metJ target gene are:

[0066] P1: 5’CGGTGCTTTTTTTGAATTCTCTAGAGATCGGTCTGGCTTAGTTTC3’

[0067] P2: 5’CTGATAAGCGTAGCGCATCAGAGACCAGACCACACAGTTG3’

[0068] P3: 5’TCAGTACCCACATCAACTGTTGGAATCGCCTGATGCGCTA3’

[0069] P4: 5’GGGTAATAGATCTAAGCTTCTGCAGTCAACGCGGCGAACAACGTA3’; P5: 5’TAATACTAGTATCAGCCCATACGCTGAGCAGTTTTAGAGCTAGAAATAGC3’, P6: 5’GCTCTAAAACTGCTCAGCGTATGGGCTGATACTAGTATTATACCTAGGAC3’

[0070] The primers for knocking out the metI target gene are:

[0071] P1: 5’CGGTGCTTTTTTTGAATTCTCTAGATGCTGAAAGACATCAACCGC3’

[0072] P2: 5’CACTGCCGCAAAGGTTTTGAAATGGCGGCTTGCGTATCTT3’

[0073] P3: 5’GCTGCAGGAACACCATGTAAAGAAGGAATAAGGTATGGCG3’

[0074] P4: 5’GGGTAATAGATCTAAGCTTCTGCAGTTTGCAGCAGCAGCAGTGAA3’; P5: 5’TAATACTAGTCTGGCAATGACCTTCGTATCGTTTTAGAGCTAGAAATAGC3’

[0075] P6: 5’GCTCTAAAACGATACGAAGGTCATTGCCAGACTAGTATTATACCTAGGAC3’

[0076] 3. OSHUP3 strain

[0077] The method of step 1 was used to knock out the thrB gene encoding homoserine kinase of the OSHUP2 strain (the nucleotide sequence is shown in SEQ ID NO.4) to construct the OSHUP3 strain.

[0078] The primers used to knock out the thrB target gene are:

[0079] P1: 5'CGGTGCTTTTTTGAATTCTCTAGACGGGAAATGGGTTATACCGA3',

[0080] P2: 5'AGCCCCTGATTTTTGCCCAAATGAGAGGGTACGTAGCAGA3',

[0081] P3: 5'TCAACAACCTCGGACCGCTTTGGTTGGGTAAGAACTACCTG3',

[0082] P4: 5'GGGTAATAGATCTAAGCTTCTGCAGTGCAGTGGACTGATTTTGCC3'; P5: 5'TAATACTAGTTCCCAGTGCCAATATGAGCGTGTTTTAGAGCTAGAAATAGC3', P6: 5'GCTCTAAAACACGCTCATATTGGCACTGGAACTAGTATTATACCTAGGAC3'.

[0083] 4. OSH production performance of strains

[0084] Pick a single colony of OSHUP1, OSHUP2, and OSHUP3 strains and inoculate it into a test tube containing 10 mL of LB medium. Culture it overnight at 37°C and 180 rpm as seed liquid. Pipette 1 mL of seed liquid and add it to 10 mL of MS medium. At the same time, add 0.3 g of sterilized CaCO3 to maintain the pH of the fermentation liquid. Set up 3 parallels for each group and culture it at 30°C and 180 rpm for 48 hours. Culture the starting strain in the same way as a control, and test the OSH production and OD600. The results are shown in Figure 2 , OSH production reached 3.55 g / L, an increase of 22.8% compared with the starting strain.

[0085] OSH production was detected by an amino acid analyzer (Hitachi-LA8080). After preparing a 5g / L OSH standard solution and diluting it 100 times, it was filtered into a liquid injection bottle with a filter membrane (0.22μm) and stored for inspection to obtain the peak time and peak area of ​​the standard. The fermentation broth sample was processed by centrifuging the fermentation broth to obtain the supernatant, diluting the supernatant 100-500 times according to the concentration, and the pre-treatment method was referenced to the standard. Chromatographic conditions: The chromatographic column was a Hitachi special cation exchange resin column (4.6mm ID×60mm, 3μm); the injection volume was 20μL; the infusion pump pressure was 34MPa; the separation column temperature was 57℃; the reaction column temperature was 135℃; the pump 1 flow rate was 0.4mL / min; the pump 2 flow rate was 0.35mL / min; the detector wavelengths were 570nm and 440nm.

[0086] Example 2, OSHUP4 strain

[0087] 1. Based on OSHUP3, strengthen the aspartate synthesis pathway and use CRISPR-Cas technology ( Figure 1 In B), the codon of the aspDH gene from Pseudomonas aeruginosa was optimized (the nucleotide sequence of the aspDH gene after codon optimization is shown in SEQ ID NO.5) and then replaced in situ with the aspC gene on the strain OSHUP3 to construct the strain OSHUP4 with improved production intensity of the L-methionine precursor O-succinyl-L-homoserine.

[0088] (1) Primer design

[0089] Six primers, P1, P2, P3, P4, P5 and P6, were designed. The target strain was used as a template to amplify the upstream and downstream fragments and the replaced genes. The three fragments were fused to the vector using a recombination cloning kit. The primers for the aspDH replacement gene were designed as follows:

[0090] P1:5'CGGTGCTTTTTTGAATTCTCTAGACGCTAC GCCGATCACTAATA3',

[0091] P2:5'CATAACAATGTTCAGTGCCATTGGTTACAGAAGGGAAGTCC3',

[0092] P3:5'GGACTTCCCTTTCTGTAACCAATGGCACTGAACATTGTTAT3',

[0093] P4:5'GCGGGCTTCATTGTTTTTAATTAAATACTAATTGCATGTG3',

[0094] P5:5'CACATGCAATTAGTATTTAATTAAAAACAATGAAGCCCGC3',

[0095] P6:5'GGGTAATAGATCTAAGCTTCTGCAGTTACAGGTGTTACATTGCCC3',

[0096] (2) Doner DNA

[0097] PCR amplification of upstream homology arm fragments: Using E. coli W3110 genomic DNA as a template, using primers P1 and P2, and using the PCR reaction system and conditions in Example 1, amplify the upstream homology arm fragments.

[0098] PCR amplification of downstream homology arm fragments: Using E. coli W3110 genomic DNA as a template, using primers P5 and P6, and using the PCR reaction system and conditions in Example 1, amplify the downstream homology arm fragments.

[0099] PCR amplification of the replacement fragment: Using the recombinant plasmid carrying the aspDH gene sequence as a template, using primers P3 and P4, and using the PCR reaction system and conditions in Example 1, amplify the replacement fragment.

[0100] After obtaining the upstream and downstream homologous arms and the fragments of the replaced gene, they are gel-recovered and purified.

[0101] The purified upstream and downstream homology arms and the replacement gene fragments can be used as templates for fusion PCR to obtain the final donor DNA.

[0102] (3)OSHUP4 strain

[0103] Using Clon Express TM Ultra One Step Cloning Kit was used to connect the linearized pTarget plasmid and the donor (Doner) DNA fragment.

[0104] As in step (4) of Example 1, the Doner DNA fragment was used to replace the original genomic fragment. After verifying that the replacement was successful, the OSHUP4 strain was constructed.

[0105] 2. OSH production performance of OSHUP4 strain

[0106] A single colony of the OSHUP4 strain was picked and inoculated into a test tube containing 10 mL of LB medium, and cultured overnight at 37°C and 180 rpm as a seed solution. 1 mL of seed solution was added to 10 mL of MS medium, and 0.3 g of sterilized CaCO3 was added to maintain the pH of the fermentation broth. Three parallels were set up in each group and cultured at 30°C and 180 rpm for 48 hours. OSHUP3 was cultured in the same way as a control, and the OSH yield reached 6.31 g / L, an increase of 81.8% compared to OSHUP3. In addition, it was found that the biomass was also improved, from 5.72 to 7.65 relative to the OSHUP3 biomass (OD600). This shows that an engineered Escherichia coli for producing O-succinyl-L-homoserine was successfully constructed.

[0107] Example 3, OSHUP5 strain

[0108] 1. Based on the OSHUP4 strain, the homoserine synthesis pathway was strengthened. The Trc promoter (nucleotide sequence as shown in SEQ ID NO.6) was used to in situ replace the promoters of thrA and metL on the OSHUP4 strain genome. At the same time, the metA gene was replaced with a metA mutant encoding gene to construct the strain OSHUP5 with further improved production intensity of the L-methionine precursor O-succinyl-L-homoserine.

[0109] (1) According to the Doner DNA structure, promoter replacement only requires four primers, P1, P2, P3 and P4, and the replaced promoter sequence is carried on the two primers P2 and P3.

[0110] The primers used for thrA promoter replacement are as follows:

[0111] P1:5'CGGTGCTTTTTTGAATTCTCTAGATTCATTCTGACTGCAACGGG3'

[0112] P2:5'GTGACCACACATTATACGAGCCCGGATGATTAATTGTCAATAAAATTTTA ATTTACTCAC3'

[0113] P3:5'ATCCGGCTCGTATAATGTGTGGTCACAAAGGAGATATACATGAAACGCA TTAGCACCAC3'

[0114] P4:5'GGGTAATAGATCTAAGCTTCTGCAGTTGATGCTATCCGGGCACTG3'

[0115] The primers used for metL promoter replacement are as follows:

[0116] P1:5'CGGTGCTTTTTTGAATTCTCTAGAGATACTTAATCCTCTTCG3'

[0117] P2:5'GTGACCACACATTATACGAGCCCGGATGATTAATTGTCAATACATCTGGA CATCTAAACT3'

[0118] P3:5'ATCCGGCTCGTATAATGTGTGGTCACAAAGGAGATATACATGAGTGTGA TTGCGCAGGCAG3'

[0119] P4:5'GGGTAATAGATCTAAGCTTCTGCAGATAAAATCCGGTCACCACCAG3'

[0120] Other operation steps are the same as in Example 2.

[0121] (2) Using the above method, the amino acid at position 63 of homoserine succinyltransferase metA was mutated from leucine to phenylalanine, and the amino acid at position 28 was mutated to valine to obtain the mutant metA-L63F / A28V (nucleotide sequence as shown in SEQ ID NO.7), which replaced the original metA gene to construct the OSHUP5 strain.

[0122] 2. OSH production performance of OSHUP5 strain

[0123] A single colony of OSHUP5 strain was picked and inoculated into a test tube containing 10 mL of LB medium, and cultured overnight at 37°C and 180 rpm as seed liquid. 1 mL of seed liquid was taken and added to 10 mL of MS medium, and 0.3 g of sterilized CaCO3 was added to maintain the pH of the fermentation liquid. Three parallels were set up in each group and cultured at 30°C and 180 rpm for 48 hours. OSHUP4 was cultured in the same way as a control, and the yield of OSH reached 8.04 g / L, which was 75.1% higher than that of OSHUP4, and the biomass (OD 600 ) from 7.65 to 7.98.

[0124] Example 4, OSHUP6 strain

[0125] 1. Based on OSHUP5, two genes, zwf and gnd, from Corynebacterium glutamicum were introduced (the nucleotide sequence of zwf is shown in SEQ ID NO.8, and the nucleotide sequence of gnd is shown in SEQ ID NO.9), and the pentose phosphate pathway (PPP) was modified to enhance the supply of NADPH, relieve allosteric inhibition, increase the activity of enzymes in the metabolic process, and further enhance the synthesis of OSH, thereby constructing the OSHUP6 strain.

[0126] Primers for the zwf replacement gene were designed as follows:

[0127] P1:5'CGGTGCTTTTTTGAATTCTCTAGAAGAAA CGATTCACCGTCGGT3',

[0128] P2:5'TCGTGTTTGTGCTCACGTTAACTAACCCGGTAC3',

[0129] P3:5'ACCGGGTTAGTTAACTTAAGTGAGCACAAACACGACCCCC3',

[0130] P4:5'ATAAAGGATAAGCGCAGATATTATGGCCTGCGCCAGGT3',

[0131] P5:5'CACACCTGGCCGCAGGCCATAATATCTGCGCTTATCCTTTATG3',

[0132] P6: 5'GGGTAATAGATCTAAGCTTCTGCAGGGATAGTGTTCATAAGGCTGG3', the primers for gnd replacement gene were designed as follows:

[0133] P1:5'CGGTGCTTTTTTGAATTCTCTAGAATTTCC CCGCTTATTCGCAC3',

[0134] P2:5'TGATCGTACTTGACGGCATGTCAGGTGTG ATCACCGCGCT3',

[0135] P3:5'ATGGCAGTGATGGGACGCATGCCGTCAAGTACGATCA3',

[0136] P4:5'TTGTTGGTTAAATCAGATTAAGCTTCAACCTCGGAGCGGTCGCCGG3',

[0137] P5: 5'GACCGCTCCGAGGTTGAAGCTTAATCTGATTTAACCAACAATAAAA3', P6: 5'GGGTAATAGATCTAAGCTTCTGCAGATCATAGTCGGTTGGAGTGG3', and other operation steps are the same as Example 2.

[0138] 2. OSH production performance of OSHUP6 strain

[0139] A single colony of the engineered E. coli OSHUP6 strain was selected and inoculated into a test tube containing 10 mL of LB medium, and cultured overnight at 37°C and 180 rpm as a seed solution. 1 mL of seed solution was added to 10 mL of MS medium, and 0.3 g of sterilized CaCO3 was added to maintain the pH of the fermentation broth. Three parallels were set up in each group and cultured at 30°C and 180 rpm for 72 hours. OSHUP5 was cultured in the same way as a control. After 48 hours and 72 hours of fermentation, the accumulation of intracellular NADPH increased by 67.0% and 55.1% respectively compared with the OSHUP5 strain. After 72 hours of fermentation, the OSH production reached 8.87 g / L.

[0140] Example 5, OSHUP7 strain

[0141] 1. Based on OSHUP6, the glycolysis pathway was modified to increase the supply of NADPH. GAPDH was modified to produce NADPH instead of NADH during glycolysis. The gapC gene encoding NAD(P)H-dependent GAPDH from Clostridium acetobutylicum (nucleotide sequence as shown in SEQ ID NO.10) was introduced, and metA-L63F / A28V (nucleotide sequence as shown in SEQ ID NO.7) was overexpressed with pRSFDuet-1 to further increase the supply of NAD(P)+ / NAD(P)H and strengthen the synthesis of OSH, thus constructing the OSHUP7 strain.

[0142] The target gene fragments were cloned using gapC (nucleotide sequence as shown in SEQ ID NO.10) and metA-L63F / A28V (nucleotide sequence as shown in SEQ ID NO.7) recombinant plasmids as templates, and the obtained PCR products were purified, and the concentrations were measured using NanoDrop TM one and stored for future use. pRSFDuet-1 was used as a template and linearized, and the target genes gapC and metA-L63F / A28V were connected at two MCS sites, respectively, and the obtained PCR products were purified and the concentrations were measured, and stored for future use.

[0143] The primers required in the construction of gapC gene recombinant plasmid are as follows:

[0144] P1:5'ATCCGAATTCGAGCTCGGCGATGGCAAA AATCGCGATTAA3'

[0145] P2:5'CGCAAGCTTGTCGACCTGCATTATTTTGCAATTTTTGCAA3'

[0146] The primers required for the construction of metA-L63F / A28V gene recombination plasmid are as follows:

[0147] P1:5'ATCCGAATTCGAGCTCGGCGATGCCGATTCGTGTGCCGGA3'

[0148] P2:5'CAATTGGATATCGGCCGGCCATGCCGATTCGTGTGCCGGA3'

[0149] The obtained recombinant plasmid was transformed into OSHUP6 competent cells to construct OSHUP7 strain.

[0150] 2. OSH production performance of OSHUP7 strain

[0151] A single colony of the engineered Escherichia coli OSHUP7 strain was picked and inoculated into a test tube containing 10 mL of LB medium, and cultured overnight at 37°C and 180 rpm as a seed solution. 1 mL of seed solution was added to 10 mL of MS medium, and 0.3 g of sterilized CaCO3 was added to maintain the pH of the fermentation broth. Three parallels were set up in each group and cultured at 30°C and 180 rpm for 48 hours. OSHUP6 was cultured in the same way as a control, and the OSH yield reached 15.64 g / L, an increase of 76.3% compared to OSHUP6. In addition, it was found that the biomass was also improved to a certain extent. Compared with OSHUP6, the biomass (OD600) increased from 8.70 to 9.95. Thus, an engineered bacterium for efficient production of OSH was constructed.

[0152] Example 6: Production of O-succinyl-L-homoserine by fermentation of OSHUP7 strain

[0153] The OSHUP7 strain was inoculated into LB solid medium and cultured at 37°C for 12 hours. A single colony was picked and cultured in 10 mL of LB medium at 37°C for 12 hours to obtain a seed solution. The seed solution was inoculated into 100 mL of liquid LB medium at a volume concentration of 1%. After culturing at 37°C for 8 hours, a fermenter containing 50 L of initial fermentation medium was inoculated at a volume concentration of 10%.

[0154] The fermentation tank pressure is 0.05-0.06Mpa and the air volume is 1.2m 3 / h, initial speed of 400rpm, temperature of 37℃; in the early stage of fermentation, DO was maintained at 50-60%, and after 36h, DO was maintained at 20%; fermentation liquid OD 600 When the pH value reaches 8, 0.5 mmol / L IPTG is added; after the initial glucose is consumed, the feed medium is fed at a constant rate to control the glucose concentration between 0-5 g / L.

[0155] The initial fermentation medium composition was: glucose 30 g / L, (NH4)2SO4 16 g / L, yeast extract 5 g / L, KH2PO4 1 g / L, betaine 2 g / L, MgSO4 0.5 g / L, FeSO4·4H2O 0.01 g / L, MnSO4 0.005 g / L, ZnSO4 0.0025 g / L, L-threonine 0.2 g / L, L-isoleucine 0.2 g / L, CaCO3 20 g / L, the solvent was water, and 50 μg / mL kanamycin was added before fermentation.

[0156] Feed medium composition: glucose 500 g / L, yeast extract 10 g / L, L-isoleucine 0.2 g / L, L-threonine 0.2 g / L, (NH4)2SO4 8 g / L, KH2PO4 12 g / L, MgSO4 0.5 g / L, betaine 2 g / L, solvent is water, pH is natural.

[0157] After 80h of fermentation, OD 600 was 34, OSH production reached 125 g / L, and the sugar-acid conversion rate was 63%.

[0158] In summary, the present invention constructs an OSH-producing Escherichia coli chassis strain, introduces the aspDH gene from Pseudomonas aeruginosa to replace the aspC gene on the chassis strain in situ, introduces the zwf and gnd genes from Corynebacterium glutamicum, introduces the gapC gene encoding NAD(P)-dependent GAPDH from Clostridium acetobutylicum to increase the regeneration of NAD(P)H, and further improves the supply of NAD(P)+ / NAD(P)H. In addition, the homoserine O-succinyltransferase encoded by metA is responsible for transferring a succinyl group from succinyl-CoA to homoserine, and plays an important role in the biosynthesis of homoserine-derived products, but is sensitive to various stress factors and is severely inhibited by downstream products. We have previously modified this enzyme and generated a positive mutant metA-L63F / A28V that is sensitive to environmental release. The constructed engineered Escherichia coli has the ability to efficiently prepare the L-methionine precursor O-succinyl-L-homoserine, the strain has excellent performance, and the preparation method of O-succinyl-L-homoserine is simple, time-saving and low-cost, and has good prospects for large-scale application.

[0159] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. An engineered Escherichia coli for producing O-succinyl-L-homoserine, characterized in that: The engineered Escherichia coli is constructed by knocking out metB gene, metJ gene, metI gene and thrB gene from Escherichia coli as the starting strain; the base strain is subjected to one or more of the following gene editing to obtain the engineered Escherichia coli producing O-succinyl-L-homoserine: (1) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced in situ with the aspC gene of the base strain; (2) the original promoter of the thrA gene of the strain in step (1) is replaced with the Trc promoter, the original promoter of the metL gene is replaced with the Trc promoter, and the metA gene is replaced with the gene encoding the metA mutant; the metA mutant is a gene in which the amino acid at position 63 of the protein encoded by the metA gene is mutated from leucine to phenylalanine, and the amino acid at position 28 of the alanine is mutated to valine; (3) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced in situ with the aspC gene of the base strain; (4) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced in situ with the aspC gene of the base strain; (5) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced in situ with the aspC gene of the base strain; (6) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced with the aspC gene of the base strain; (7) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced with the aspC gene of the base strain; (8) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced with the aspC gene of the base strain; (9) the aspDH gene codon from Pseudomonas aeruginosa is optimized and replaced with glutamicum) are introduced into the strain of step (2) respectively; (4) the strain of step (3) overexpresses the gene gapC encoding NAD(P)H-dependent GAPDH from Clostridium acetobutylicum and the metA mutant of step (2).

2. The engineered Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the metB gene is shown in SEQ ID NO.1; the nucleotide sequence of the metJ gene is shown in SEQ ID NO.2, the nucleotide sequence of the metI gene is shown in SEQ ID NO.3, and the nucleotide sequence of the thrB gene is shown in SEQ ID NO.

4.

3. The engineered Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the aspDH gene after codon optimization is shown in SEQ ID NO.

5.

4. The engineered Escherichia coli according to claim 1, characterized in that The nucleotide sequence of Trc promoter is shown in SEQ ID NO.

6.

5. The engineered Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the gene encoding the metA mutant is shown in SEQ ID NO.

7.

6. The engineered Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the zwf gene is shown in SEQ ID NO.8; the nucleotide sequence of the gnd gene is shown in SEQ ID NO.

9.

7. The engineered Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the gapC gene is shown in SEQ ID NO.

10.

8. Use of the engineered Escherichia coli according to claim 1 in producing O-succinyl-L-homoserine.

9. The use according to claim 8, characterized in that The application method is: inoculating the engineered Escherichia coli into a fermentation tank added with an initial fermentation medium, the fermentation tank pressure is 0.05-0.06Mpa, the air volume is 1.2m 3 / h, initial speed 100-600rpm, temperature 37℃; in the early stage of fermentation, DO was maintained at 50-60%, and after 36h, DO was maintained at 10-30%; fermentation liquid OD 600 When the pH value reaches 8, 0.5 mmol / L IPTG is added; after the initial glucose is consumed, the feed medium is fed at a constant rate to control the glucose concentration between 0-5 g / L.

10. The use according to claim 9, characterized in that The initial fermentation medium composition was: glucose 30 g / L, (NH4)2SO4 16 g / L, yeast extract 5 g / L, KH2PO4 1 g / L, betaine 2 g / L, MgSO4 0.5 g / L, FeSO4·4H2O0.01 g / L, MnSO4 0.005 g / L, ZnSO4 0.0025 g / L, L-threonine 0.2 g / L, L-isoleucine 0.2 g / L, CaCO3 20 g / L, the solvent was water, when the cultured strain carried gapC and metA mutant overexpression plasmids, 50 μg / mL kanamycin was added; Feed medium composition: glucose 500 g / L, yeast extract 10 g / L, L-isoleucine 0.2 g / L, L-threonine 0.2 g / L, (NH4)2SO4 8 g / L, KH2PO4 12 g / L, MgSO4 0.5 g / L, betaine 2 g / L, solvent is water, pH is natural.

Images