Lactobacillus casei engineering strain for treating inflammatory bowel disease and application thereof

Abstract

In order to solve the technical problems that in the prior art, the survival rate of lactobacillus casei reaching the intestinal tract is too low, and the lactobacillus casei is difficult to colonize in the intestinal tract, the invention provides a lactobacillus casei lyT-7 engineering strain with high gastrointestinal fluid tolerance, and the engineering strain takes lactobacillus casei lyT-7 as a chassis strain and comprises a recombinant expression vector for expressing Amuc1100 protein. A nucleotide sequence for coding the Amuc1100 protein is as shown in SEQ ID NO: 1. The expression of the Amuc1100 protein is intracellular expression or secretory expression. Compared with a natural strain, the engineering strain disclosed by the invention has the advantages that the tolerance of the engineering strain to the gastrointestinal tract environment is remarkably improved, the engineering strain has excellent intestinal survival rate and intestinal colonization capability, and the treatment effect on the inflammatory bowel disease is effectively improved. Meanwhile, the engineering strain disclosed by the invention also has excellent antibacterial ability and good biological safety; by combining the excellent intestinal survival rate, intestinal colonization capacity and intracellular high expression or secretory high expression of Amuc1100 protein, the polypeptide has a good application prospect and social significance in treatment of inflammatory bowel diseases by oral administration.

Description

Technical Field

[0001] The invention belongs to the field of microbial technology, relates to the fields of genetic engineering and biomedicine, and specifically relates to an engineered strain of lactic acid bacteria of casei for treating colitis, and a construction method and application thereof. Background Art

[0002] Inflammatory Bowel Disease (IBD) is a general term for a series of intestinal diseases, mainly including Crohn's Disease (CD) and ulcerative colitis (UC); the two have different pathogenesis but similar clinical manifestations. The etiology of IBD may involve genetics, immune system, environmental factors and intestinal microorganisms; clinical manifestations mainly include abdominal pain, diarrhea and weight loss. At present, the treatment of IBD is mainly through drug control of inflammation; currently, 5-aminosalicylic acid, corticosteroids, immunomodulators and biological agents are mainly used in clinical treatment of IBD. These drugs have problems such as drug resistance, drug off-target, side effects and high treatment costs during use. Therefore, the treatment of IBD still needs further research.

[0003] Probiotics refer to active microorganisms that can improve the intestinal microbial balance of the host and promote health. Among them, Lactobacillus casei is a probiotic isolated from yak milk on the Qinghai-Tibet Plateau, which has excellent acid resistance and high gastric survival rate. According to literature reports, natural Lactobacillus casei has the following advantages: (1) Strong acid production ability, which can reduce the pH of the fermentation liquid to below 4.0 after 48 hours of culture. (2) It can produce extracellular bacteriocins, which have good thermal stability, pH stability and good anti-resistant bacteria activity. (3) Oral Lactobacillus casei has a good preventive and therapeutic effect on gastric inflammation caused by Helicobacter pylori infection, and it also helps to alleviate intestinal flora disorders. However, oral Lactobacillus casei can only play the role of live bacteria if it survives and remains active after passing through the acidic environment and digestion of the gastrointestinal tract. But in fact, after passing through gastric acid and gastrointestinal digestive juice, the survival rate of natural Lactobacillus casei is usually very low, and it is difficult to reach and colonize in the intestine. Therefore, how to improve the acid and bile resistance of Lactobacillus casei, increase its survival rate when reaching the intestine and its ability to colonize in the intestine, is a technical problem that needs to be solved urgently.

[0004] The membrane protein Amuc_1100 of Akkermansia muciniphila (AKK) is one of the most abundant proteins on the outer membrane of the bacterium. It is a natural postbiotic compound that can maintain biological activity and exert beneficial effects at pasteurization temperatures. Amuc_1100 can replicate almost all the effects of AKK bacteria in mice fed a high-fat diet. It is reported that Amuc_1100 can also regulate CD8 + T cells to alleviate colitis and colitis-related colorectal cancer (CAC). Amuc_1100 can improve liver fat deposition and intestinal health in zebrafish fed a high-fat diet. At the same time, Amuc_1100 also has a good antidepressant effect, and its mechanism may be related to improving intestinal microbiota, upregulating BDNF levels and inhibiting neuroinflammatory responses.

[0005] Invention patent ZL201010277557 discloses "a Lactobacillus casei bacteriocin and its application in feed", and the Lactobacillus casei lyT-7 is preserved in the China Center for Type Culture Collection, with the preservation number: CCTCC M2010197; the patent also discloses that the bacteriocin produced by the Lactobacillus casei can inhibit the growth of bacteria and can be used as a feed additive. At present, there is no relevant report on the expression of Amuc_1100 protein by Lactobacillus casei. Summary of the invention

[0006] In view of the technical problems in the prior art that the survival rate of Lactobacillus casei in the intestine is too low and it is difficult to colonize in the intestine, the present application provides an engineered strain of Lactobacillus casei. Compared with the natural strain, the engineered strain not only significantly improves its tolerance to the gastrointestinal environment, but also effectively improves the therapeutic effect on inflammatory bowel disease.

[0007] The technical solution of the present invention:

[0008] The invention discloses an engineered strain of Lactobacillus casei lyT-7 with high gastrointestinal fluid tolerance. The engineered strain uses Lactobacillus casei lyT-7 as a chassis strain and comprises a recombinant expression vector for expressing Amuc_1100 protein.

[0009] The Lactobacillus casei lyT-7 is deposited in the China Center for Type Culture Collection with the deposit number CCTCCM2010197, which has been disclosed in the invention patent ZL201010277557. The Amuc_1100 protein is derived from AKK, and the nucleotide sequence encoding the Amuc_1100 protein is shown in SEQ ID NO: 1. The expressed Amuc_1100 protein is intracellularly expressed or secreted.

[0010] When the engineered strain expresses Amuc_1100 protein intracellularly, the recombinant expression vector is selected from a lactic acid bacteria expression vector containing a nucleotide sequence, a promoter and a terminator encoding the Amuc_1100 protein. When the engineered strain expresses the Amuc_1100 protein in a secretory manner, the recombinant expression vector is selected from a lactic acid bacteria expression vector containing a nucleotide sequence, a promoter, a terminator encoding the Amuc_1100 protein and a nucleotide sequence encoding a signal peptide. Wherein, the nucleotide sequence encoding the signal peptide is shown in SEQ ID NO: 2. The lactobacillus expression vector is selected from plasmid pMG36e.

[0011] Since Amuc_1100 protein has a certain tolerance to the gastrointestinal environment, and can regulate intestinal metabolism and restore microbiota after oral administration, improve intestinal inflammation, and thus effectively improve the therapeutic effect of inflammatory bowel disease. The engineered strain described in this application can continuously highly express Amuc_1100 protein intracellularly or secrete highly expressed, and therefore also has the application prospect of treating inflammatory bowel disease.

[0012] Moreover, the inventor unexpectedly discovered that compared with the original strain, the engineered strain has significantly improved tolerance to the gastrointestinal environment and resistance to bile salts, resulting in unexpected technical effects. As a result, after oral administration, the survival rate of the engineered strain in the intestine and its ability to colonize in the intestine are also significantly improved, thereby not only enhancing their ability to regulate intestinal metabolism and restore microbiota, but also effectively improving intestinal inflammation, thereby significantly improving the therapeutic effect of inflammatory bowel disease. At the same time, due to the increase in the number of colonization of the engineered strain in the intestine, the technical effect also indirectly increases the expression of the Amuc_1100 protein in the intestine, which produces a synergistic effect with bacteria, further improving the therapeutic effect of inflammatory bowel disease.

[0013] The application of the aforementioned Lactobacillus casei lyT-7 engineered strain in the preparation of medicines is used for treating inflammatory bowel disease. The medicine is administered orally.

[0014] Preferably, the medicine is a pharmaceutical composition comprising the engineered strain as described above and a pharmaceutically acceptable adjuvant, carrier, excipient, solvent or a combination thereof.

[0015] Beneficial effects of the present invention:

[0016] (1) The present application provides an engineered strain of Lactobacillus casei lyT-7 with high gastrointestinal fluid tolerance. Compared with the natural strain, the engineered strain significantly improves its tolerance to the gastrointestinal environment and effectively improves the therapeutic effect on inflammatory bowel disease.

[0017] (2) The Lactobacillus casei lyT-7 engineered strain described in the present application can achieve intracellular high expression or secretory high expression of Amuc_1100 protein, depending on whether the recombinant expression vector contains a nucleotide sequence encoding a signal peptide, and has the flexibility to meet different application requirements.

[0018] (3) The engineered strain of Lactobacillus casei lyT-7 described in the present application also has excellent antibacterial ability and good biosafety; combined with its excellent intestinal survival rate, intestinal colonization ability and its intracellular high expression or secretory high expression of Amuc_1100 protein, it has good application prospects and social significance in the oral administration treatment of inflammatory bowel disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Attached Figure 1 This is a schematic diagram of the structure of the plasmid cPCBT7 constructed in Example 1 of the present invention;

[0020] Attached Figure 2 This is a schematic diagram of the structure of the plasmid sPCBT7 constructed in Example 1 of the present invention;

[0021] Attached Figure 3 This is a verification diagram of the expression of Amuc_1100 protein in the engineered strains T7-cAmuc1100 and T7-sAmuc1100 constructed in Example 2 of the present invention;

[0022] Attached Figure 4 The dynamic synthesis of Amuc_1100 protein in wild-type Lactobacillus casei lyT-7, the engineered strains T7-cAmuc1100 and T7-sAmuc1100 constructed in Example 2;

[0023] Attached Figure 5 The growth curves of wild-type Lactobacillus casei lyT-7, the engineered strains T7-cAmuc1100 and T7-sAmuc1100 constructed in Example 2;

[0024] Attached Figure 6 This is an analysis diagram of the antibacterial effect of the engineered strains T7-cAmuc1100 and T7-sAmuc1100 on three strains of intestinal pathogens evaluated in Example 6;

[0025] Attached Figure 7 This is a schematic diagram of membrane formation-intervention in Example 7 for evaluating the ability of engineered strains to adhere to and colonize the intestines of normal mice and colitis mice;

[0026] Attached Figure 8 This is an analysis diagram of Example 7 evaluating the ability of the engineered strain to adhere to and colonize the intestines of normal mice and DSS-induced colitis mice;

[0027] Attached Fig. 9This is an analysis chart of the toxic and side effects of the engineered strain on mice after oral administration in Example 8. DETAILED DESCRIPTION

[0028] The present invention is further described below in conjunction with the examples. The following examples are only used to illustrate the present invention, but not to limit the present invention. The raw materials used in the present invention are all purchased from commercial channels.

[0029] Example 1: Construction of recombinant expression vector

[0030] 1. Codon optimization of the amino acid sequence of Amuc_1100 protein and artificial synthesis of its nucleotide sequence

[0031] The Amuc_1100 amino acid sequence (GenBank: ACD04926.1) on the genome of Akkermansia muciniphila ATCC BAA-835 was codon optimized, and the 6xHis affinity tag nucleotide sequence was added to the 3′ end of the nucleotide sequence obtained after optimization to obtain the optimized nucleotide sequence encoding the Amuc_1100 protein, which was submitted to Shanghai Sangon Biotech Co., Ltd. for synthesis. The nucleotide sequence is shown in SEQ ID NO: 1 (the thick solid line represents the 6xHis affinity tag).

[0032] SEQ ID NO: 1:

[0033]

[0034] 2. Codon optimization of USP45 signal peptide nucleotide sequence and artificial synthesis of its nucleotide sequence

[0035] The amino acid sequence of USP45 signal peptide that promotes secretory expression of protein in lactic acid bacteria was obtained from the NCBI database (GenBank: ADJ57691.1), and codon optimization was performed to obtain the optimized nucleotide sequence encoding USP45 signal peptide, which was submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The signal peptide can promote the extracellular secretion of Amuc_1100 protein. The nucleotide sequence is shown in SEQ ID NO: 2.

[0036] SEQ ID NO: 2:

[0037] ATGAAAAAAAAGATTATCTCAGCTATTTTAATGTCTACAGTGATACTTTCTGCTGCAGCCC

[0038] CGTTGTCAGGTGTTTACGCTGACACAAACTCAGATATTGCTAAACAAGATGCGACAATT 3: Design the vector construction primers for cPCBT7 plasmid and sPCBT7 plasmid, see Table 1 for details.

[0039] Table 1. Primers for constructing cPCBT7 plasmid and sPCBT7 plasmid

[0040]

[0041] 4: Construction of cPCBT7 plasmid and sPCBT7 plasmid:

[0042] (1) Construction of cPCBT7 plasmid:

[0043] Using pMG36e-F / pMG36e-R as primers and pMG36e plasmid as template, the pMG36e plasmid was linearized by PCR, and then Amuc1100-F / Amuc1100-R as primers and the artificially synthesized Amuc_1100 gene fragment as template, the Amuc_1100 fragment used to construct the cPCBT7 plasmid was obtained by PCR amplification. Finally, after the linearization product of the pMG36e plasmid was digested with DpnI enzyme, the enzyme-digested pMG36e linearization fragment and the Amuc_1100 fragment were ligated by homologous recombination, and the ligation product was transformed into Escherichia coli DH5α, and the positive transformants were selected and sequenced to obtain the successfully constructed cPCBT7 plasmid.

[0044] (2) Construction of sPCBT7 plasmid:

[0045] Using pMG36e-F1 / pMG36e-R1 as primers and pMG36e plasmid as template, pMG36e linearized fragment was obtained by PCR. Then, using artificially synthesized USP45 signal peptide fragment and Amuc_1100 gene fragment as templates, using USP45-F, USP45-R, Amuc1100-F1 and Amuc1100-R1 as primers, the USP45-Amuc_1100 fusion fragment was obtained by overlap extension PCR amplification, and its sequence is shown in SEQ ID NO: 3 (capital letters represent the nucleotide sequence of USP45 signal peptide, lowercase letters represent the nucleotide sequence of Amuc_1100 gene, double solid lines represent the nucleotide sequence of 6xHis affinity tag, and single solid lines represent the stop codon). Finally, the linearized product of pMG36e plasmid was digested with DpnI enzyme, and the linearized fragment of pMG36e digested with enzyme and the fusion fragment of USP45-Amuc_1100 were ligated by homologous recombination method. The ligated product was transformed into Escherichia coli DH5α, and the positive transformants were selected and sequenced to obtain the successfully constructed sPCBT7 plasmid. SEQ ID NO: 3:

[0046]

[0047] Example 2: Construction of engineered strains and verification of Amuc_1100 protein expression and expression location

[0048] 1. The pMG36e plasmid, cPCBT7 plasmid and sPCBT7 plasmid were electro-transformed into Lactobacillus casei lyT-7 to obtain the engineered strain.

[0049] The specific steps are as follows: (1) Pick a single colony of wild-type Lactobacillus casei lyT-7 and culture it in 5 mL of MRS containing 5% glucose at 37°C overnight. (2) Add 1 mL of overnight culture solution to 100 mL of MRS liquid medium containing 2% glycine and culture Lactobacillus casei lyT-7 at 30°C until OD 600After the pH value is 0.5-0.6, precool on ice for 30 min. (3) Subsequently, collect the bacterial precipitate by centrifugation (4°C, 1600 g, 3 min), wash the bacterial precipitate three times with 25 mL precooled sterile washing solution containing 10% glucose and 10% glycine, resuspend the bacteria in 1 mL precooled washing solution, and dispense 400 μL per tube into 1.5 mL EP tubes for later use. (4) Add 0.5 μg of plasmid to 400 μL of Lactobacillus casei lyT-7 competent cells, transfer the mixture to a sterile electroporation cuvette with a gap of 0.2 cm, and perform electroporation in a gene pulse electroporation device; the electroporation conditions are: pulse voltage of 1.2 kV, pulse resistance of 400 Ω, pulse capacitance of 25 μF, and pulse duration of 3 s. (5) After electroporation, the competent cells of Lactobacillus casei lyT-7 were suspended in 1 mL of MRS broth, incubated at 30°C for 3 h, and then centrifuged to spread the bacterial precipitate on an MRS agar plate containing 5 μg / mL erythromycin. Finally, the transformants were detected by PCR to obtain the engineered strains T7-pMG36e (engineered strain negative control), T7-cAmuc1100, and T7-sAmuc1100 containing pMG36e (empty control), cPCBT7 plasmid, and sPCBT7 plasmid, respectively.

[0050] Among them, the MRS culture medium used in the above-mentioned culture has the following composition: peptone: 10.0g; beef extract powder: 8.0g; yeast extract powder: 4.0g; glucose: 20.0g; dipotassium hydrogen phosphate: 2.0g; diammonium hydrogen citrate: 2.0g; sodium acetate: 5.0g; magnesium sulfate: 0.2g; manganese sulfate: 0.04g; agar: 14.0g; Tween 80: 1.0g; distilled water: 1000mL; the pH value of the culture medium is 6.5±0.2.

[0051] 2. Expression status and expression location verification of Amuc_1100 protein in T7-cAmuc1100 and T7-sAmuc1100 engineering strains.

[0052] In order to verify the expression of Amuc_1100 protein in T7-cAmuc1100 engineering strain and T7-sAmuc1100 engineering strain, the inventors used protein immunoblot (western bolt, WB) and enzyme-linked immunosorbent assay (enzymelinked immunosorbent assay, ELISA) to detect the expression level of 6xHis affinity tag in the broken contents and fermentation supernatant of T7-cAmuc1100 engineering strain and T7-sAmuc1100 engineering strain respectively; the results are detailed in the attached Figure 3 .

[0053] Depend on Figure 3It can be seen that: (1) Amuc_1100 protein was not detected in the crushed contents and fermentation supernatant of wild-type Lactobacillus casei lyT-7. (2) Amuc_1100 protein was detected in the crushed contents of T7-cAmuc1100 engineered strain, but not in the fermentation supernatant. (3) Amuc_1100 protein was detected in both the crushed contents and fermentation supernatant of T7-sAmuc1100 engineered strain. This fully demonstrates that the T7-cAmuc1100 engineered strain can only express Amuc_1100 protein intracellularly; while the T7-sAmuc1100 engineered strain can not only express Amuc_1100 protein intracellularly, but also express it in a secretory manner.

[0054] Example 3: Growth curve of engineered strain and dynamic synthesis analysis of Amuc_1100 protein

[0055] The inventors further studied the effect of expressing Amuc_1100 protein in T7-cAmuc1100 engineered strain and T7-sAmuc1100 engineered strain on strain growth and the dynamic synthesis of Amuc_1100 protein during bacterial growth. Figure 4 .

[0056] Depend on Figure 4 It can be seen that: (1) the broken contents and fermentation supernatant of wild-type Lactobacillus casei lyT-7, and the fermentation supernatant of T7-cAmuc1100 engineering strain, all can not detect Amuc_1100 protein, which is consistent with the result of Example 2. (2) In the broken contents of T7-cAmuc1100 engineering strain, the broken contents and fermentation supernatant of T7-sAmuc1100 engineering strain, Amuc_1100 protein can be detected. And when the incubation time is 60h, the synthesis amount of Amuc_1100 protein in the two engineering strains reaches the maximum value. Wherein, the synthesis amount of Amuc_1100 protein in T7-cAmuc1100 (broken contents), T7-sAmuc1100 (broken contents) and T7-sAmuc1100 (fermentation supernatant) is 58.88pg / mL, 50.02pg / mL and 52.34pg / mL respectively. This shows that both engineered strains achieved high expression of Amuc_1100 protein and have broad application prospects.

[0057] Depend on Figure 5 It can be seen that the growth curves of wild-type Lactobacillus casei lyT-7, T7-cAmuc1100 engineered strain and T7-sAmuc1100 engineered strain are basically the same. This shows that the expression of Amuc_1100 protein does not significantly affect the growth of Lactobacillus casei lyT-7.

[0058] Example 4: Tolerance of engineered strains T7-cAmuc1100 and T7-sAmuc1100 to simulated artificial gastrointestinal fluid

[0059] The inventors then studied the tolerance of the engineered strains T7-cAmuc1100 and T7-sAmuc1100 to simulated artificial gastric juice (pH=2.5, pH=3.5, pH=4.5) and intestinal juice (pH=6.8). The results are shown in Table 2 for details.

[0060] Table 2. Survival rates of wild strains and engineered strains T7-cAmuc1100 and T7-sAmuc1100 in simulated artificial gastrointestinal fluid

[0061]

[0062] As shown in Table 2: (1) After incubation for 2 hours in artificial gastric juice at pH = 2.5, the wild-type Lactobacillus casei T7 and the two engineered strains can maintain a survival rate of more than 80%, and there is no significant difference among the three. After incubation for 4 hours, the survival rate of the two engineered strains is about 50%. After incubation for 6 hours, the survival rate of the two engineered strains is significantly lower than that of the wild-type Lactobacillus casei lyT-7. (2) After incubation for 8 hours in artificial gastric juice at pH = 3.5, the survival rate of the wild-type Lactobacillus casei lyT-7 is 100.53%, while the survival rates of T7-cAmuc1100 and T7-sAmuc1100 are 112.99% and 253.10%, which are 1.12 times and 2.52 times of the wild-type Lactobacillus casei lyT-7, respectively. (3) After incubation in artificial gastric juice at pH = 4.5 for 8 hours, the survival rate of wild-type Lactobacillus casei lyT-7 was about 97.92%, while the survival rates of T7-cAmuc1100 and T7-sAmuc1100 were 183.19% and 219.40%, respectively, which were 1.87 times and 2.24 times that of wild-type Lactobacillus casei lyT-7. (4) During the incubation period of 0.5 to 4.0 hours in artificial intestinal juice at pH = 6.8, the survival rates of wild-type Lactobacillus casei lyT-7 and the two engineered strains were greater than 100%; and the survival rates of the two engineered strains were significantly higher than that of wild-type Lactobacillus casei lyT-7. After incubation in simulated artificial intestinal fluid for 4 hours, the survival rates of T7-cAmuc1100 and T7-sAmuc1100 were 929.65% and 1008.93%, which were 2.72 times and 2.96 times that of wild-type Lactobacillus casei lyT-7 (340.71%), respectively.

[0063] The above results fully demonstrate that compared with the wild-type Lactobacillus casei lyT-7, the T7-cAmuc1100 and T7-sAmuc1100 engineered strains have better tolerance to simulated gastrointestinal fluid and produce unexpected technical effects.

[0064] Example 5: Tolerance of engineered strains T7-cAmuc1100 and T7-sAmuc1100 to NaCl and bile salts

[0065] The inventors then studied the tolerance of wild-type Lactobacillus casei lyT-7 and two engineered strains to different NaCl concentrations and different bile salt concentrations. The results are shown in Tables 3 and 4 for details.

[0066] Table 3. Survival rates of wild strains and engineered strains T7-cAmuc1100 and T7-sAmuc1100 in different NaCl environments

[0067]

[0068] Table 4. Survival rates of wild strains and engineered strains T7-cAmuc1100 and T7-sAmuc1100 in different bile salt environments

[0069]

[0070] It can be seen from Table 3 that: (1) After tolerating the high-salt environment of 70 mg / mL for 12 hours, the survival rate of wild-type Lactobacillus casei lyT-7 was 10.79%, while the survival rates of T7-cAmuc1100 and T7-sAmuc1100 were 11.33% and 11.11%, respectively, which were 1.05 times and 1.03 times that of wild-type Lactobacillus casei lyT-7. (2) After incubation under the high-salt condition of 70 mg / mL for 24 hours, wild-type Lactobacillus casei lyT-7 and the two engineered bacteria were still able to survive. It can be seen from Table 4 that: (1) After incubation for 8 hours in an environment with a bile salt concentration of 1.0 mg / mL, the survival rate of wild-type Lactobacillus casei lyT-7 was 286.05%, while the survival rates of T7-cAmuc1100 and T7-sAmuc1100 were 957.47% and 788.75%, respectively, which were 3.35 times and 2.76 times that of wild-type Lactobacillus casei lyT-7; (2) After incubation for 8 hours in an environment with a bile salt concentration of 2.0 mg / mL, the survival rate of wild-type Lactobacillus casei lyT-7 was 20.72%, while the survival rate of T7-sAmuc1100 was as high as 98.59%, which was 4.76 times that of wild-type Lactobacillus casei lyT-7.

[0071] The above results fully demonstrate that the engineered strain not only does not affect the excellent tolerance of Lactobacillus casei lyT-7 to NaCl and bile salts, but on the contrary effectively improves its tolerance to NaCl and bile salts.

[0072] Example 6: Analysis of the antibacterial effects of engineered strains T7-cAmuc1100 and T7-sAmuc1100 on three intestinal pathogenic bacteria

[0073] In order to study the antibacterial effect of the engineered strains T7-cAmuc1100 and T7-sAmuc1100 on intestinal pathogens, the inventors selected three representative intestinal pathogens [Escherichia coli (Migula) Castellani and Chalmers, Salmonella typhimurium and Aeromonas hydrophila] and observed the antibacterial effect of the aseptic fermentation supernatant of the two engineered strains on the above three intestinal pathogens. The results are detailed in Figure 6 .

[0074] Depend on Figure 6 It can be seen that: (1) Whether it is wild-type Lactobacillus casei lyT-7 or the two engineered strains, only 25% of the aseptic fermentation supernatant can achieve an antibacterial effect of more than 80% on three intestinal pathogens; this confirms that the engineering modification has not affected the excellent antibacterial ability of Lactobacillus casei lyT-7. (2) The antibacterial effect does not increase with the increase in the concentration of the aseptic fermentation supernatant; this shows that the aseptic fermentation supernatant of wild-type Lactobacillus casei lyT-7 and the engineered strains has a highly efficient and stable antibacterial effect.

[0075] Example 7: Analysis of the ability of engineered strains to adhere to and colonize the intestines of healthy mice or mice with DSS-induced colitis 1. Construction of a DSS-induced colitis mouse model: 18 6-8 week old female C57BL / 6 mice with a body weight of (18±2) g / mouse were used for membrane formation. The mice were purchased from Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. The mice were raised in a standard environment (humidity: 51±13%, temperature: 23±3°C). After one week of adaptive feeding, the colitis mice were given free drinking water containing 2.5% DSS (MW: 36-50kDa) for one week. After the end, the water was replaced with normal drinking water to complete the membrane formation of DSS-induced colitis mice. Please refer to the attached for the membrane formation process. Figure 7 Dextran sulfate sodium salt (DSS) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0076] 2. 1×10 8CFU / mL of Lactobacillus casei lyT-7 (containing the pMG36e empty vector), T7-cAmuc1100 and T7-sAmuc1100 were labeled with indocyanine green (ICG). The three labeled strains were gavaged into normal mice and DSS-induced colitis mice, and the fluorescence intensity in each group of mice was observed using an animal living imager at 0h, 4h, 8h and 12h after gavage. After completing the fluorescence intensity detection in each group of mice at 12h, each group of mice was euthanized, and the mouse colon tissue was obtained by aseptic operation, and the fluorescence intensity of the colon tissue was detected. After recording the fluorescence data, the same part and the same mass of colon tissue of each group of mice were selected for grinding and homogenization for bacterial isolation and culture, and the adhesion and colonization of Lactobacillus casei lyT-7, T7-cAmuc1100 and T7-sAmuc1100 in the colon of each group of mice were observed by plate counting. For details of the results, see Figure 8 .

[0077] Depend on Figure 8 It can be seen that: (1) 12 hours after gavage, strong fluorescence signals of the three strains of bacteria could still be detected in the two different model mice; and the results of quantitative analysis of fluorescence intensity showed that there was no significant difference in the fluorescence signals of Lactobacillus casei lyT-7 and the two engineered strains in normal mice and colitis mice models within the range of 4 to 12 hours. (2) The fluorescence intensity of T7-sAmuc1100 in the colon of DSS-induced colitis mice was 69.83×10 9 ph.s -1 .cm -2 .sr -1 , which was 1.60 times that in the colon of normal mice (P<0.05). In the DSS-induced colitis mouse model, the fluorescence of T7-sAmuc1100 was the strongest (69.83×10 9 ph.s -1 .cm -2 .sr -1 ), which were 1.16 times and 1.89 times of those of Lactobacillus casei lyT-7 and T7-cAmuc1100, respectively (P<0.05). (3) The results of colon tissue bacterial counts showed that the number of Lactobacillus casei lyT-7, T7-cAmuc1100 and T7-sAmuc1100 colonizing in the colons of DSS-induced colitis mice was significantly higher than that of the corresponding normal mice (P<0.01, P<0.05 and P<0.0001). Among them, the number of T7-sAmuc1100 colonizing in the colons of normal mice was 0.57×10 2CFU, which were 2.09 times (P<0.05) and 1.90 times (P<0.05) of those of Lactobacillus casei lyT-7 and T7-cAmuc1100, respectively. In the colon of mice with DSS-induced colitis, the number of T7-sAmuc1100 colonization was 1.26×10 2 The CFU were 1.33 and 1.83 times that of Lactobacillus casei lyT-7 and T7-cAmuc1100, respectively (P<0.01).

[0078] The above results fully demonstrate that Lactobacillus casei lyT-7 and the engineered strains are more inclined to colonize in the inflammatory intestine. However, compared with Lactobacillus casei lyT-7, the engineered T7-sAmuc1100 has stronger adhesion and colonization ability to the normal mouse intestine or inflammatory intestine. This shows that the engineered T7-sAmuc1100 has better oral bioavailability, which will be more conducive to the treatment of inflammatory bowel disease.

[0079] Example 8: Oral toxicology test to detect the toxic and side effects of engineered strains

[0080] The inventors conducted oral toxicity tests (SYXK (Guizhou) 2018-000) on wild-type Lactobacillus casei lyT-7, T7-cAmuc1100 and T7-sAmuc1100 to detect toxic side effects. The mice used were 24 clean-grade C57BL / 6 mice (experimental animal license number: SCXK (Zhejiang) 2019-0004) provided by Hangzhou Ziyuan Experimental Animal Technology Co., Ltd., with 3 biological replicates in each group, and the body weight was (18±2) g / mouse, female. The experiment was given 200 μL of PBS, wild-type Lactobacillus casei lyT-7, T7-cAmuc1100 and T7-sAmuc1100 by gavage at a frequency of 2 days / time, and the gavage was continuous for 14 days (8 times in total), and the bacterial concentration used was 1×10 8 CFU / mL. The general condition, poisoning and death of mice were observed daily. After euthanasia of mice in each group on the 15th day, blood samples were collected from mice in each group for hematological and blood biochemical analysis to evaluate the biosafety of the engineered bacteria. The results are shown in Table 5 and Fig. 9 .

[0081] As shown in Table 5, (1) after exposure, no adverse reactions, poisoning symptoms or deaths were found in mice. (2) On day 15, all mice were euthanized, and no abnormalities in tissues or organs were observed after dissection. Figure 8It can be seen that the results of hematological and biochemical tests also showed that there was no significant difference between the mice gavaged with wild-type Lactobacillus casei lyT-7, T7-cAmuc1100 and T7-sAmuc1100 and the mice gavaged with PBS. The above results fully demonstrate that the engineered strains have good biosafety after gavage in mice.

[0082] Table 5. Toxicity test doses and results of engineered strains after oral administration to mice

[0083] Group dose Number of animals Number of dead animals mortality rate(%) PBS control group Sterile PBS, 200 μL 3 0 0 Lactobacillus casei lyT-7 group <![CDATA[1×10 8 CFU / mL,200μL]]> 3 0 0 T7-cAmuc1100 Group <![CDATA[1×10 8 CFU / mL,200μL]]> 3 0 0 T7-sAmuc1100 Group <![CDATA[1×10 8 CFU / mL,200μL]]> 3 0 0

[0084] In summary, it can be seen that: (1) Compared with the wild-type Lactobacillus casei lyT-7, the engineered strains T7-cAmuc1100 and T7-sAmuc1100 provided by the present application have significantly improved tolerance to simulated gastrointestinal fluid, NaCl and bile salts, producing unexpected technical effects. (2) The engineering transformation did not affect the excellent antibacterial ability of Lactobacillus casei lyT-7. The sterile fermentation supernatant of the engineered strain and the wild-type Lactobacillus casei LyT-7 had efficient and stable antibacterial effects. (3) The engineered T7-sAmuc1100 has stronger adhesion and colonization ability to the normal mouse intestine or inflammatory intestine, and has better oral bioavailability. (4) The engineered strain has good biosafety after gavage in mice. Therefore, the engineered strains T7-cAmuc1100 and T7-sAmuc1100 provided by the present application have good application prospects and social significance in the oral administration treatment of inflammatory bowel disease.

Claims

1. An engineered strain of Lactobacillus casei lyT-7 with high gastrointestinal fluid tolerance, characterized in that: The engineering strain uses Lactobacillus casei lyT-7 as a chassis strain and contains a recombinant expression vector for expressing Amuc_1100 protein.

2. Lactobacillus casei lyT-7 engineered strain according to claim 1, is characterized in that: The Amuc_1100 protein is derived from Akkermansia muciniphila, and the nucleotide sequence encoding the Amuc_1100 protein is shown in SEQ ID NO:

1.

3. Lactobacillus casei lyT-7 engineered strain according to claim 2, is characterized in that: The expressed Amuc_1100 protein is intracellular expression or secretory expression.

4. Lactobacillus casei lyT-7 engineered strain according to claim 3, is characterized in that: When the engineered strain expresses Amuc_1100 protein intracellularly, the recombinant expression vector is selected from a lactic acid bacteria expression vector containing a nucleotide sequence encoding the Amuc_1100 protein, a promoter and a terminator.

5. Lactobacillus casei lyT-7 engineered strain according to claim 3, is characterized in that: When the engineered strain expresses Amuc_1100 protein in a secretory manner, the recombinant expression vector is selected from a lactic acid bacteria expression vector containing a nucleotide sequence encoding Amuc_1100 protein, a promoter, a terminator, and a nucleotide sequence encoding a signal peptide.

6. Lactobacillus casei lyT-7 engineered strain according to claim 5, is characterized in that: The nucleotide sequence encoding the signal peptide is shown in SEQ ID NO:

2.

7. according to any described Lactobacillus casei lyT-7 engineered strain among the claim 4-6, it is characterized in that: The lactobacillus expression vector is selected from plasmid pMG36e.

8. as the application of any described Lactobacillus casei lyT-7 engineering strain in the preparation of medicine among the claim 1-7, it is characterized in that: The drug is used to treat inflammatory bowel disease.

9. The use according to claim 8, characterized in that: The drug is administered orally.

10. The use according to claim 8 or 9, characterized in that: The medicine is a pharmaceutical composition, comprising the engineered strain according to any one of claims 1 to 7 and a pharmaceutically acceptable adjuvant, carrier, excipient, solvent or a combination thereof.

Images