TaC3H72-6B gene and CAPS marker and application thereof

Abstract

The invention relates to a TaC3H72-6B gene as well as a CAPS marker and application thereof, and relates to the technical field of plant genetic engineering, the TaC3H72-6B gene has a nucleotide sequence as shown in SEQ ID NO.1, and the TaC3H72-6B gene is capable of regulating and controlling the pre-harvest germination resistance of plant seeds. A pre-harvest sprouting resistant gene TaC3H72-6B is identified according to a transcriptome result of infiltration treatment of pre-harvest sprouting resistant wheat Jing 411 and pre-harvest sprouting resistant wheat Red Miangchun 21, a CAPS marker, namely TaC3H72-6B-C450, is developed according to the sequence difference of the gene in a pre-harvest sprouting resistant / pre-harvest sprouting resistant wheat material, and 431 wheat varieties are utilized to verify that the CAPS marker is extremely remarkably related to a seed sprouting index GI. The CAPS marker is clear and distinguishable in band after electrophoresis detection, the band pattern difference between different pre-harvest-resistant / pre-harvest-sensitive sprouting wheat varieties is obvious, detection is easy, the CAPS marker can effectively distinguish the pre-harvest-resistant / pre-harvest-sensitive sprouting wheat varieties, and the efficiency of wheat pre-harvest sprouting resistance genetic improvement can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to a TaC3H72-6B gene and a CAPS marker and application thereof. Background Art

[0002] Wheat is my country's second largest staple food crop, and its safe production is particularly important for ensuring my country's food security. However, with global warming, rainy weather occurs frequently during the wheat harvest period, and the phenomenon of grains sprouting directly on the wheat ears (i.e., germination before harvest) frequently occurs, resulting in a decrease in wheat yield and deterioration in quality, which seriously threatens my country's food security.

[0003] Although chemical agents can improve the ear sprout resistance of wheat varieties to a certain extent, the potential risks they pose to ecological environmental safety and human health are difficult to estimate. Therefore, breeding and planting wheat varieties resistant to ear sprout is the most fundamental way to solve the ear sprout problem. Cloning key genes for ear sprout resistance and developing molecular markers are particularly critical for improving the ear sprout resistance of modern wheat varieties through molecular design breeding. However, few wheat ear sprout resistance genes and functional markers have been cloned, which seriously hinders the breeding process of new wheat varieties resistant to ear sprout. Summary of the invention

[0004] The purpose of the present invention is to provide a TaC3H72-6B gene and its CAPS marker and application in order to solve the above problems.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] A TaC3H72-6B gene, wherein the TaC3H72-6B gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0007] The invention discloses an application of a TaC3H72-6B gene in regulating the resistance of plant seed ear germination, wherein the TaC3H72-6B gene positively regulates the resistance of plant seed ear germination.

[0008] As a further optimized solution of the present invention, the plant is wheat.

[0009] A CAPS marker for identifying wheat ear sprout resistance, the CAPS marker is TaC3H72-6B-C450, which comprises:

[0010] Primers for amplifying a nucleotide sequence containing the +450th base of the TaC3H72-6B gene coding region as shown in SEQ ID NO.1, wherein the +450th base type of the TaC3H72-6B gene coding region is C or A;

[0011] Restriction endonuclease used to verify the base type of TaC3H72-6B-C450.

[0012] As a further optimization scheme of the present invention, the restriction endonuclease used to verify the base type of TaC3H72-6B-C450 is Msl I.

[0013] A CAPS marker is used in identifying wheat seed ear sprout resistance. When the CAPS marker of the wheat seed is of the TaC3H72-6B-C450-C type, it is an ear sprout-resistant wheat variety. When the CAPS marker of the wheat seed is of the TaC3H72-6B-C450-A type, it is a ear sprout-susceptible wheat variety.

[0014] A method for identifying wheat seed spike germination resistance using CAPS markers comprises the following steps:

[0015] S1, extract total RNA from wheat seeds and reverse transcribe it into cDNA;

[0016] S2. Using the nucleotide sequence consisting of the TaC3H72-6B-C450 polymorphic site and its upstream and downstream nucleotides as an amplification template, designing CAPS primers, and performing PCR amplification to obtain an amplification product containing the TaC3H72-6B-C450 polymorphic site;

[0017] S3. Use restriction endonuclease Msl I to verify the base type of TaC3H72-6B-C450, determine the gene type of the amplified product based on the base type of TaC3H72-6B-C450, and determine the ear germination resistance of wheat seeds based on the gene type.

[0018] As a further optimization scheme of the present invention, the CAPS primers are specifically as follows:

[0019] SEQ ID NO.12: TaC3H72-6B-C450-F: CAGGCACAATGATGGG;

[0020] SEQ ID NO. 13: TaC3H72-6B-C450-R: AAGGAAGGCAGCAAAA.

[0021] The beneficial effects of the present invention are:

[0022] The present invention identified an anti-ear sprout gene TraesCS6B02G386600 encoding a CCCH type zinc finger transcription factor through the transcriptome results of infiltration treatment of susceptible ear sprout wheat Jing 411 and resistant ear sprout wheat Hongmangchun 21, named TaC3H72-6B, which has the function of positively regulating wheat ear sprout resistance, and based on the sequence difference of the gene in resistant / susceptible ear sprout wheat materials (in the resistant / susceptible ear sprout wheat materials, the coding region of the TaC3H72-6B gene at the +450bp position) Mutations lead to changes in encoded amino acids) and developed a gene function marker CAPS marker, namely TaC3H72-6B-C450, which is easy to detect on a large scale. 431 wheat varieties were used to verify that the CAPS marker was significantly correlated with the seed germination index GI. The CAPS marker had clear bands after electrophoresis detection, and the band types were significantly different between different resistant / susceptible ear sprouting wheat varieties. The detection method is simple, which helps to improve the targeting and specificity of molecular marker selection, thereby improving the efficiency of genetic improvement of wheat ear sprout resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the expression analysis of TaC3H72-6B gene in wheat seeds of Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) at different infiltration times, **P<0.01( Figure 1 A is based on the analysis of transcriptome sequencing data; Figure 1 B is based on qRT-PCR analysis);

[0024] Figure 2 The nucleotide sequence difference map of TaMADS-3B gene in Jing 411 (J411, susceptible to ear sprouting) and Hongmangchun 21 (HMC21, resistant to ear sprouting) wheat;

[0025] Figure 3 Agarose gel electrophoresis phenotyping diagram;

[0026] Figure 4 Figure 1 shows TaC3H72-6B gene overexpression and RNA interference test ( Figure 4 A is a graph showing the relative expression of TaC3H72-6B gene in overexpression strains, wild-type wheat Fielder and silencing interference strains; Figure 4 B, C, and D are the seed germination and whole ear germination test phenotypes of the TaC3H72-6B gene overexpression strain, wild-type wheat Fielder, and TaC3H72-6B gene RNA silencing interference strain, respectively. The recipients of the overexpression and RNA silencing interference strains are all Fielder wheat. DETAILED DESCRIPTION

[0027] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0028] 1. Materials

[0029] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0030] 2. Methods

[0031] 2.1 Identification and analysis of wheat gene TaC3H72-6B

[0032] 2.1.1. Transcriptome analysis of wheat gene TaC3H72-6B

[0033] Seeds of wheat varieties Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) were soaked in water, and seed samples were collected at different soaking periods (immersion for 1h, 6h, 9h, 12h, and 36h). The transcriptome data of Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) were analyzed by transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA895954). An anti-ear germination gene TaC3H72-6B (TraesCS6B02G386600 gene, named TaC3H72-6B) encoding a CCCH-type zinc finger transcription factor associated with seed ear germination resistance was identified. The expression pattern of TaC3H72-6B gene at different soaking periods of seeds of the two wheat varieties (Jing 411 and Hongmangchun 21) was studied.

[0034] The transcriptome sequencing (RNA-seq) data of wheat varieties Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) seeds were analyzed. Figure 1 As shown, Figure 1 A is the statistical chart of the expression level (Fragments Per Kilobase Milli on) of TaC3H72-6B gene in wheat varieties Jing 411 and Hongmangchun 21 seeds at 1h, 6h, 9h, 12h, and 36h of infiltration (**P<0.01), based on Figure 1 From the data of A, it can be seen that at 1h, 6h, 9h, 12h and 36h of infiltration, the gene expression level of TaC3H72-6B gene in Hongmangchun 21 seeds was significantly higher than that in Jing 411.

[0035] 2.1.2. qRT-PCR analysis of wheat gene TaC3H72-6B.

[0036] Quantitative Real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of products after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add fluorescent groups to the PCR reaction system, use the accumulation of fluorescent signals to monitor the entire PCR process in real time, and finally use a standard curve to quantitatively analyze unknown templates. The fluorescent substances used in real-time fluorescent quantitative PCR include fluorescent probes and fluorescent dyes. This experiment uses SYBR fluorescent dye, and its principle is to add excess SYBR fluorescent dye to the PCR reaction system. After the SYBR fluorescent dye is non-specifically incorporated into the DNA double strand, it emits a fluorescent signal, while the SYBR dye molecules that are not incorporated into the strand will not emit any fluorescent signals, thereby ensuring that the increase in the fluorescent signal is completely synchronized with the increase in the PCR product. SYBR only binds to double-stranded DNA, so the specificity of the PCR reaction can be determined through the melting curve.

[0037] Wheat seeds at different infiltration periods (1 h, 9 h, and 36 h) were taken, and wheat seed RNA was extracted and reverse transcribed into cDNA. Reverse transcription was performed using the cDNA first-strand synthesis kit Prime Script RT reagent kit (Takara Biotechnology, Dalian, China). Fluorescence quantitative PCR was performed according to the instructions of the SYBR Premix Ex Taq GC kit (Takara Biotechnology, Dalian, China). The PCR amplification primer sequences, PCR reaction system, and PCR reaction procedures were as follows:

[0038] The PCR amplification primer sequences are as follows:

[0039] SEQ ID NO.2: TaC3H72-6B-qRT-PCR-F: CAAGCAATCACTCGACCATGCG;

[0040] SEQ ID NO.3: TaC3H72-6B-qRT-PCR-R: TTTCTCGCGGTGTATGCTTCGG;

[0041] PCR reaction system: The total qPCR reaction system is 20 μL, including 10 μL SYBR Advantage Premix (2×), 2.0 μL cDNA after reverse transcription and 7.2 μL ddH2O, and 0.4 μL of each 10 μM upstream and downstream primers for mRNA quantification;

[0042] PCR reaction program: When quantification was performed, the mRNA quantification program was 95°C for 2 min, 95°C for 10 sec, 60°C for 30 sec, and 40 cycles were set. The fluorescence quantitative PCR process was run on a 7500 Real-Time PCR System (Bio-Rad Laboratories, Shanghai, China). Actin was selected as the internal reference gene for mRNA. Each sample was repeated 4 times, and the Ct value corresponding to each group of samples was calculated using 2 -△△Ct The algorithm calculates changes in relative gene expression.

[0043] Analyze the qRT-PCR test data of wheat varieties Jing 411 and Hongmangchun 21 seeds. Figure 1 B is the statistical chart of the gene expression level (Fragments PerKilobase Million) of TaC3H72-6B gene in wheat varieties Jing 411 and Hongmangchun 21 seeds at 1h, 9h, and 36h of infiltration (**P<0.01);

[0044] From the data in the figure, it can be seen that, consistent with the results of transcriptome analysis, at 1h, 9h, and 36h of infiltration, the gene expression levels of TaC3H72-6B gene in Hongmangchun 21 were significantly higher than those in Jing 411, which shows that the TaC3H72-6B gene is related to seed spike germination resistance and that the TaC3H72-6B gene has the function of positively regulating wheat spike germination resistance.

[0045] 2.2 Development of CAPS markers for TaC3H72-6B gene

[0046] Cleaved Amplified Polymorphism Sequences (CAPS) is also known as RFLP-PCR. The basic principle is to screen out DNA sequences containing known restriction sites and design corresponding specific PCR primers, then amplify the DNA fragments at the site through these specific PCR primers, and then use a restriction endonuclease with specificity that can recognize the site to cut the resulting amplified product, separate the restriction fragments by gel electrophoresis, stain and analyze the changes in the site. CAPS markers are co-dominant markers, which are relatively simple to operate and can be directly detected by agarose gel electrophoresis. However, CAPS markers must have suitable restriction endonucleases, so the workload during the development process is relatively large.

[0047] 2.2.1. Cloning of candidate genes

[0048] Gene cloning refers to the process of using enzymatic methods to reassemble DNA molecules from different sources into hybrid molecules in vitro through enzyme cutting, ligation and other operations, and amplify them in appropriate host cells to form a large number of progeny DNA molecules; by comparing the obtained first-generation sequencing sequence with the reference genome, the sequence inconsistency caused by carrying different bases in different wheat varieties is analyzed.

[0049] The TaC3H72-6B gene was cloned by referring to the genome sequence of wheat Chinese Spring (CS) to obtain the full-length gene. Using this as a template, specific primers (as shown in SEQ ID NO. 4-11) were designed using Primer Premier 5.0 (https: / / www.PremierBiosoft.com) software for fragment amplification. The full-length gene was cloned in the susceptible ear sprouting variety Jing 411 and the resistant ear sprouting variety Hongmangchun 21 according to the following operation;

[0050] Since the full-length sequence of TaC3H72-6B gene is long, four pairs of specific primers were used to clone it. The sequences of the specific primers are as follows:

[0051] SEQ ID NO.4: TaC3H72-6B.1-F: TAGCGATGCTGACTCCT;

[0052] SEQ ID NO.5: TaC3H72-6B.1-R: GTTCGGGTCCAATACG;

[0053] SEQ ID NO.6: TaC3H72-6B.2-F: ATGGCTGAAGGAAAGGTA;

[0054] SEQ ID NO.7: TaC3H72-6B.2-R: CGAGGCAGGTAGTAGGG;

[0055] SEQ ID NO.8: TaC3H72-6B.3-F: CGCTTCTTATCTTTCTCG;

[0056] SEQ ID NO.9: TaC3H72-6B.3-R: GGATGTCCCACCTTTTAT;

[0057] SEQ ID NO.10: TaC3H72-6B.4-F: GCCGAAGCATACACCG;

[0058] SEQ ID NO.11: TaC3H72-6B.4-R: AGACCAGACCTGACCAAA;

[0059] PCR amplification was performed using the high-fidelity enzyme 2×Phanta Max Master Mix with high amplification efficiency and high speed according to the following reaction system: 12.5μL Phanta Max Master Mix, 1μL upstream primer (10μM), 1μL downstream primer (10μM), 2μL template DNA (50-100ng / uL), and distilled water was added to 25μL. Reaction procedure: 95℃ pre-denaturation for 3min, 95℃ denaturation for 15s, annealing at the required annealing temperature for each pair of primers for 15s, 72℃ extension (extension time is calculated according to the fragment length and the amplification efficiency of 2×Phanta MaxMaster Mix of 1kb / min), denaturation-annealing-extension 3 steps for 38 cycles, 72℃ additional extension for 5min, and the product was stored at 4℃.

[0060] Aspirate 4 μL of the PCR product and add 2 μL of 6× DNA loading buffer, then detect by 1.5% agarose gel electrophoresis. If the detection result is a single band at the target position, the remaining PCR product can be sent to a biological company for sequencing.

[0061] 2.2.2 Sequence analysis of candidate genes

[0062] The splicing, alignment and structural analysis of gene sequencing results were completed by DNAMAN software (https: / / www.lynnon.com / dnaman.html). The sequences of Hongmangchun 21 (HMC21, resistant to ear germination) and Jing 411 (J411, susceptible to ear germination) were aligned and it was found that there were sequence differences in the coding region (such as Figure 2 As shown in the figure, the mutation at the +450bp position of the coding region of the TaC3H72-6B gene (from base C (HMC21) to base A (J411)) resulted in a change in the encoded amino acid; and specific primers were designed for this mutation using PrimerPremier5.0 (http: / / www.premierbiosoft.com) software and developed into a CAPS marker, namely TaC3H72-6B-C450;

[0063] The nucleotide sequences of the specific primers are as follows:

[0064] SEQ ID NO.12: TaC3H72-6B-C450-F: CAGGCACAATGATGGG;

[0065] SEQ ID NO. 13: TaC3H72-6B-C450-R: AAGGAAGGCAGCAAAA.

[0066] 2.2.3. CAPS marker amplification, restriction digestion and electrophoresis

[0067] 2×Rapid Taq Master Mix was used for PCR amplification. The PCR reaction program was as follows: 95℃, 5min; 95℃, 15s; annealing temperature, 15s; 72℃, 15s / kb, 38×; 72℃, 8min. After amplification, the PCR product was detected and digested with enzymes. 5μL of PCR product, 3.9μL of sterile water, 1μL of CutSmart buffer and 0.1μL of specific restriction endonuclease (Msl I) were taken for digestion. The digestion temperature was 37℃ and the digestion time was 8-10h. The digested products were detected by gel electrophoresis on 2.0% agarose, and the genotypes of different wheat varieties were recorded using a gel imager. The association analysis between different allele types and ear germination traits was completed by IBM SPSS Statistics 26 (http: / / www.spss.com) software.

[0068] The results are as follows Figure 3 As shown, when the specific restriction endonuclease (Msl I) was used for enzyme digestion, the band of Jing 411 (susceptible to ear sprouting, TaC3H72-6B-C450-A allele variation) could not be digested by enzyme, while the band of Hongmangchun 21 (resistant to ear sprouting, TaC3H72-6B-C450-C allele variation) could be digested by enzyme. Figure 3 It can be seen that the PCR product of Hongmangchun 21 was cut into two bands, indicating that it was of TaC3H72-6B-C450-C type, and Jing 411 was one band, indicating that it was of TaC3H72-6B-C450-A type. The bands were clearly visible and easy to judge.

[0069] 2.2.4 Validation of CAPS markers in natural populations

[0070] The germination index (GI) is used to evaluate the ear germination resistance level of wheat varieties. Germination index (GI) determination:

[0071] Wheat test materials (431 wheat varieties) were harvested at the end of May in 2021 and 2022. 50 seeds with intact embryos were selected for each material, rinsed with 0.1% sodium hypochlorite solution for 5 minutes, and then rinsed with distilled water 3 times to rinse off the sodium hypochlorite residues on the surface of the seeds. Place the treated seeds in a 90mm round glass culture dish (with two layers of sterile filter paper) with the abdomen facing down, and add 10mL of distilled water to moisten the germination paper. Culture in an incubator for 3 days (20°C, 80% humidity, 16h day / 8h night), and record the germination of the seeds every day. After 3 days, calculate the seed germination index (GI) value, and the calculation formula is:

[0072] GI=[(3×n1+2×n2+1×n3) / (3×N)]×100%;

[0073] N represents the total number of seeds, n1, n2, and n3 represent the number of germinated seeds on the 1st, 2nd, and 3rd day, respectively; the seed germination standard is the rupture of the seed coat in the embryo.

[0074] In a natural population consisting of 431 wheat varieties (Table 1), the Manny-Whitney test (U-test) analysis between different allele types (resistance to ear sprouting TaC3H72-6B-C450-C and susceptible to ear sprouting TaC3H72-6B-C450-A) and ear sprout resistance traits was completed by IBM SPSS Statistics20 (www.spss.com) software.

[0075] Table 1 Correlation between two alleles (TaC3H72-6B-C450-C and TaC3H72-6B-C450-A) of CAPS marker and ear sprouting phenotype verified using 431 wheat varieties

[0076]

[0077] Note: 2022GI-HF, 2022GI5-LK, 2021GI-HF, and 2021GI-HB represent the ear germination phenotypes of 431 wheat varieties measured in Hefei, Anhui (HF) and Longkang Town, Anhui (LK) in 2022 and in Hefei, Anhui (HF) and Huaibei, Anhui (HB) in 2021, respectively.

[0078] *Indicates that there is a very significant correlation between the two different allele variation types of the marker and the seed dormancy phenotype at the 0.05 level;

[0079] **Indicates that there is a significant correlation between the two different allelic variation types of the marker and the seed dormancy phenotype at the 0.01 level.

[0080] It can be seen from Table 1 that the differences in seed dormancy phenotype values ​​(GI) between wheat varieties carrying the two allelic variations of TaC3H72-6B-C450-C and TaC3H72-6B-C450-A reached extremely significant levels (P < 0.05 or 0.01).

[0081] 2.3TaC3H72-6B gene overexpression and RNA interference assay

[0082] Genetic modification refers to the addition of regulatory elements upstream of the target gene through artificially constructed vectors, which enables the gene to be overexpressed under artificially controlled conditions, thereby achieving massive transcription and translation of the gene product; RNA interference (RNAi) refers to the introduction of double-stranded RNA (dsRNA) consisting of sense RNA and antisense RNA corresponding to mRNA into cells, which can cause specific degradation of mRNA and lead to silencing of its corresponding gene.

[0083] 2.3.1 Vector construction

[0084] The full-length CDS sequence of the TaC3H72-6B anti-ear sprouting allele (i.e., the full-length CDS sequence of the TaC3H72-6B anti-ear sprouting allele of Hongmangchun 21, as shown in SEQ ID NO.1) was constructed into the BamH I and Spe I restriction sites of the pWMB006 vector driven by the maize Ubi promoter (Ubiquitinpromoter), and then the constructed vector was double-digested with HindIII and EcoR I, and constructed into the corresponding restriction sites of pCAMBIA3301 by a one-step cloning method, and the one with correct sequencing was the TaC3H72-6B overexpression vector;

[0085] Partial gene fragments (200-500bp) of the full-length sequence of the CDS of the TaC3H72-6B anti-ear sprouting allele were connected in the forward and reverse directions at the upper and lower multiple cloning sites of the pWMB006 vector. After successful connection and sequencing, the large fragment was recovered by double cutting with Hind III and EcoR I enzymes, and then connected to the pCAMBIA3301 vector that was also cut with Hind III and EcoR I; sequencing verified the correctness of the TaC3H72-6B-RNAi vector.

[0086] 2.3.2 Agrobacterium transfection and positive strain detection

[0087] All correctly sequenced vector plasmids (TaC3H72-6B overexpression vector and TaC3H72-6B-RNAi vector) were transformed into Agrobacterium EHA105 competent cells by Agrobacterium heat shock transformation method, and then transformed into immature embryos of wheat variety Fielder by Agrobacterium-mediated transformation method; T0 generation wheat seedlings were transplanted into flower matrix and placed in an incubator for two weeks to slow down the seedlings, leaves were collected and genomic DNA was extracted by CTAB method; primers were designed according to the sequence information of the vector and the inserted fragment (primer sequences are shown in SEQ ID NO.14-15) to detect the OE strain (overexpression strain) and RNA silencing strain of TaC3H72-6B;

[0088] Upstream primer: SEQ ID NO.14: Pubi-F: 5'-TCGATGCTCACCCTGTTGTTTG-3';

[0089] Downstream primer: SEQ ID NO.15: Nos-R: 5'-TGTATAATTGCGGGACTCTAATC-3';

[0090] Total RNA was extracted from transgenic wheat leaves and reverse transcribed to obtain cDNA. The expression levels of TaC3H72-6B in each transgenic line (OE line) and RNA silenced line (such as Figure 4 As shown in A, the wild-type strain wheat variety Fielder, OE strains OE#51, 52, 53 and RNA silenced strains RNAi#7, 11, 12 (the receptors of OE strains and RNA silenced strains are both wheat variety Fielder) were analyzed.

[0091] 2.3.3 Evaluation of ear germination phenotype

[0092] The seed germination index GI (Germination index) and spike germination rate SGR (Spike germination rate) were used to evaluate the spike germination resistance of wheat varieties.

[0093] Seed germination index GI phenotype determination: 50 seeds with intact embryos were selected for each material, rinsed with 0.1% sodium hypochlorite solution for 5 minutes, and then rinsed with distilled water for 3 times to rinse the sodium hypochlorite residue on the surface of the seeds. The treated seeds were placed in a 90mm round glass culture dish (with two layers of sterile filter paper), with the abdomen facing down, and 10mL of distilled water was added to moisten the germination paper. After culturing in an incubator for 4 days (20°C, 80% humidity, 16h day / 8h night), the phenotype was observed. The seed germination standard was the rupture of the embryo seed coat.

[0094] Determination of SGR phenotype of whole ear germination: 35 days after wheat flowering (physiological maturity is completed, ears, stems, leaves completely lose green and turn yellow), 15 whole ears were cut and randomly divided into 3 groups, 5 ears in each group, and soaked in tap water for 6 hours (to allow ears and seeds to fully absorb water), then disinfected with 0.5% sodium hypochlorite solution for 15 minutes, rinsed 3 times, and cultured in an artificial climate chamber (22°C, 100% relative humidity), simulating field rainfall for 30 minutes every 8 hours. The phenotype was observed after 4 days of culture.

[0095] The results are as follows Figure 4 As shown in BD, it can be seen in the figure that the TaC3H72-6B gene positively regulates wheat ear germination resistance.

[0096] 3 Conclusion

[0097] The present application used transcriptome sequencing and real-time fluorescence quantitative PCR (qRT-PCR) technology to identify a spike sprout resistance gene TraesCS6B02G386600 encoding a CCC H-type zinc finger transcription factor, named TaC3H72-6B. The relative expression level of this gene in the spike sprout resistance wheat variety Hongmangchun 21 at different infiltration periods was significantly higher than that in the spike sprout susceptible variety Jing 411 (P<0.01)( Figure 1 );

[0098] Through cloning and sequencing, it was found that between the resistant spike sprouting variety Hongmangchun 21 and the susceptible spike sprouting variety Jing411, the coding region of the TaC3H72-6B gene at the +450bp position (such as Figure 2As shown in the figure, the mutation of base C (HMC21) to base A (J411) leads to the change of the encoded amino acid. A CAPS (Cleaved Amplified Polymorphic Sequences) marker was developed for the SNP variation (C / A) at the +450bp position in the coding region of the TaC3H72-6B gene, namely TaC3H72-6B-C450 (including two allele variation types, TaC3H72-6B-C450-C for resistance to ear sprouting and TaC3H72-6B-C450-A for sensitivity to ear sprouting). A natural population consisting of 431 wheat varieties was used to verify the correlation between the above CAPS markers TaC3H72-6B-C450 (TaC3H72-6B-C450-C, TaC3H72-6B-C450-A) and the seed germination index (germination index). dex,GI) and found that the ear sprout resistance of wheat varieties carrying the TaC3H72-6B-C450-C genotype was significantly higher than that of wheat varieties carrying the TaC3H72-6B-C450-A genotype (P<0.01), which verified that the sequence variation (C / A) at the +450bp position in the coding region of the TaC3H72-6B gene was significantly correlated with the ear sprout phenotype ( Figure 3 , Table 1);

[0099] The TaC3H72-6B gene was further overexpressed in the wheat variety Fielder, and it was found that the overexpression of the TaC3H72-6B gene significantly improved the ear sprouting resistance of the transgenic strains; at the same time, the expression of the TaC3H72-6B gene was silenced using RNA interference technology, and it was found that the downregulation of the expression of the TaC3H72-6B gene significantly reduced the ear sprouting resistance of wheat; the above results confirmed that the TaC3H72-6B gene has the function of positively regulating the wheat ear sprouting resistance ( Figure 4 ).

[0100] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A TaC3H72-6B gene, characterized in that: The TaC3H72-6B gene has a nucleotide sequence as shown in SEQ ID NO.

1.

2. A use of the TaC3H72-6B gene as claimed in claim 1 in regulating plant seed spike germination resistance, characterized in that: The TaC3H72-6B gene positively regulates plant seed ear germination resistance.

3. The use according to claim 2, characterized in that: The plant is wheat.

4. A CAPS marker for identifying wheat ear sprout resistance, characterized in that: The CAPS is labeled TaC3H72-6B-C450, which includes: Primers for amplifying a nucleotide sequence containing the +450th base of the TaC3H72-6B gene coding region as shown in SEQ ID NO.1, wherein the +450th base type of the TaC3H72-6B gene coding region is C or A; Restriction endonuclease used to verify the base type of TaC3H72-6B-C450.

5. The CAPS label according to claim 4, characterized in that: The restriction endonuclease used to verify the base type of TaC3H72-6B-C450 was Msl I.

6. Use of the CAPS marker according to any one of claims 4 to 5 in identifying wheat seed spike germination resistance, characterized in that: When the CAPS mark of the wheat seeds is TaC3H72-6B-C450-C type, it is a wheat variety resistant to ear sprouting. When the CAPS mark of the wheat seeds is TaC3H72-6B-C450-A type, it is a wheat variety susceptible to ear sprouting.

7. A method for identifying wheat seed spike germination resistance using the CAPS marker as described in any one of claims 4-5, characterized in that: The following steps are involved: S1, extract total RNA from wheat seeds and reverse transcribe it into cDNA; S2. Using the nucleotide sequence consisting of the TaC3H72-6B-C450 polymorphic site and its upstream and downstream nucleotides as an amplification template, designing CAPS primers, and performing PCR amplification to obtain an amplification product containing the TaC3H72-6B-C450 polymorphic site; S3. Use restriction endonuclease Msl I to verify the base type of TaC3H72-6B-C450, determine the gene type of the amplified product based on the base type of TaC3H72-6B-C450, and determine the ear germination resistance of wheat seeds based on the gene type.

8. The method according to claim 7, characterized in that The CAPS primers are as follows: SEQ ID NO.12: TaC3H72-6B-C450-F: CAGGCACAATGATGGG; SEQ ID NO. 13: TaC3H72-6B-C450-R: AAGGAAGGCAGCAAAA.

Images