Gene qGL4 capable of influencing grain length and yield of rice and application of gene qGL4
By detecting and positioning QGL4 sites in rice, and using CRISPR-CAS9 technology to change the expression of the OSKS2/OSKSL2 gene, solve the problem of insufficient understanding of rice granules in the existing technology, realize the increase Effect.
Patent Information
- Application Number
- CN202411678430.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-01-28
AI Technical Summary
The prior art has limited understanding of rice grain type regulation, and it is difficult to effectively increase rice yield.
By inspecting groups derived from 63-4S and DODDA hybridization, using genetic chain as a diagram to detect QGL4 sites, positioning the 2.359kb segment on the 4th chromosome. The CAS9 system edit the gene to change its expression to affect the length and output.
By changing the expression of the QGL4 gene, it can significantly increase the grain and grain width of rice, thereby increasing thousands of grain weight and single plant yield, providing a method to increase rice output.
Smart Images
Figure CN119372229A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of rice molecular breeding, and relates to a gene qGL4 capable of influencing rice grain length and yield and an application thereof. Background Art
[0002] Rice (Oryza sativa L.) is one of the most important staple crops in the world, feeding more than half of the world's population. Faced with a growing population and shrinking arable land, how to further increase rice yield is a major concern for scientists and breeders. Rice yield is largely determined by three main components: grain weight, number of grains per panicle, and number of effective tillers per plant. Among them, grain weight is largely determined by grain shape, including grain length, grain width, and grain thickness. Exploring the genetic basis of grain size and grain weight will play an important role in the breeding of high-yield rice varieties. Although many QTLs regulating grain shape have been discovered, the understanding of rice grain shape regulation is still limited. Therefore, exploring new grain shape QTLs is of great significance for better understanding the regulatory mechanism of rice grain shape and providing genetic resources for breeding applications. Summary of the invention
[0003] The inventors of the present invention investigated BC1F2 and BC1F2 derived from hybridization of Guangzhan 63-4S and Dodda. 2:3 The grain length, grain width and length-to-width ratio phenotypes of the population were combined with polymorphic markers covering the entire genome within the population, and 30 QTLs related to grain length, grain width and length-to-width ratio were detected using genetic linkage mapping. Among them, the qGL4 locus located on chromosome 4 had a higher LOD value. The results of the two-year QTL effect verification of the near-isogenic line population showed that the grain length of the homozygous Guangzhan 63-4S genotype material was longer than that of the homozygous Dodda genotype material, and the differences were significant.
[0004] We screened recombinant plants and examined the phenotypes of the current and subsequent generations of recombinant plants to finely locate the qGL4 locus that controls grain length to a 2.359 kb segment. According to the annotations of the Rich Annotation Project (http: / / rapdb.dna.afrc.go.jp / ), this region contains only one annotated gene, LOC_Os04g52240, which encodes an enantiomeric basidiene synthase, called OsKS2 / OsKSL2. Previous studies have reported that the OsKS2 / OsKSL2 gene may be involved in gibberellin biosynthesis or phytoalexin biosynthesis. However, the effect of this gene on grain shape and its regulatory mechanism are still unclear.
[0005] Comparison of parental sequencing showed that OsKS2 / OsKSL2 had two single nucleotide variations in the promoter region within the localization interval, one single nucleotide variation in the first exon, and nine variations in the first intron. However, the SNP in the first exon was a nonsense mutation and did not result in amino acid changes. Considering that promoter variation may lead to differences in relative expression levels among near-isogenic lines, we detected the relative expression levels of OsKS2 / OsKSL2 in near-isogenic lines of 8 cm, 12 cm, 14 cm, and 16 cm panicles. RT-qPCR results showed that there was a significant difference in the relative expression level of OsKS2 / OsKSL2 between 12 cm and 14 cm panicles, indicating that the difference in grain length caused by OsKS2 / OsKSL2 among near-isogenic lines may be due to differences in its relative expression levels.
[0006] In order to further clarify the effect of OsKS2 / OsKSL2 gene on grain size, we used CRISPR-Cas9 system to edit the gene in the genetic background of NIL-Guangzhan 63-4S and constructed OsKS2 / OsKSL2 knockout material. Consistent with the expected results, in the background of NIL-Guangzhan 63-4S, the grain length of the mutant phenotype was shorter than that of the wild type. In contrast, the grain width of the mutant allele was wider than that of the wild type. In addition, the results of the field yield-related traits of the near-isogenic lines showed that compared with NIL-Dodda, the panicle length, number of primary branches and number of grains per panicle of NIL-Guangzhan 63-4S were reduced, but the grain length and grain width were significantly increased, which directly increased the thousand-grain weight of grains and indirectly increased the yield per plant of rice. The above results indicate that the qGL4 allele of Guangzhan 63-4S has the effect of increasing rice yield.
[0007] Based on the above research, the present invention provides the use of the qGL4 gene in changing rice grain length or yield.
[0008] The present invention also provides a qGL4 gene allele capable of increasing rice grain length and yield, characterized in that the qGL4 gene allele is derived from the qGL4 gene of the rice line Guangzhan 63-4S.
[0009] In a specific embodiment, the nucleic acid sequence of the qGL4 gene allele is shown as SEQ ID NO.1.
[0010] The present invention also provides a rice breeding method for changing rice grain length and / or yield, comprising the step of changing the expression level of qGL4 gene.
[0011] In a specific embodiment, the expression level of the qGL4 gene is changed by introducing a qGL4 gene allele having a desired expression efficiency into a starting rice line through hybridization.
[0012] In a specific embodiment, the qGL4 gene derived from Guangzhan 63-4S and its equivalent gene are qGL4 gene alleles with high expression efficiency; the qGL4 gene derived from Dodda and its equivalent gene are qGL4 gene alleles with low expression efficiency.
[0013] In a specific embodiment, the nucleic acid sequence encoded by the qGL4 gene allele is shown in SEQ ID NO:1, or the CDS sequence encoded by the qGL4 gene allele is shown in SEQ ID NO:2, or the encoded protein sequence is shown in SEQ ID NO:3.
[0014] In a specific embodiment, the expression of qGL4 gene is increased by introducing a qGL4 gene expression cassette through genetic engineering methods, or the expression level of qGL4 gene is changed by knocking out or knocking down the qGL4 gene in the starting rice line.
[0015] In a specific embodiment, the expression level of the qGL4 gene is changed by physical mutagenesis or chemical mutagenesis.
[0016] The present invention is to cross BC1F2 and BC1F2 derived from Guangzhan 63-4S and Dodda 2:3 The researchers conducted a study on the correlation between grain length, grain width and length-to-width ratio in the rice population, discovered the correlation between the qGL4 gene and grain length, and located the gene. Further research found that the qGL4 gene derived from Guangzhan 63-4S can not only increase grain length, but also increase rice yield. Therefore, the present invention provides a new gene that can increase rice grain length and yield, and provides a new method and path for rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 For BC1F2 and BC1F in 2016 and 2018 2:3 Frequency distribution of grain length, grain width and length-to-width ratio of the population. Figure A shows the frequency distribution of BC1F2 and BC1F in 2016 and 2018. 2:3 Frequency distribution of population grain length; Figure B shows BC1F2 and BC1F in 2016 and 2018 2:3 Frequency distribution of population grain width; Figure C shows BC1F2 and BC1F in 2016 and 2018 2:3 Frequency distribution of the length-to-width ratio of the population. The vertical axis is BC1F2 and BC1F 2:3 The number of plants, grain length, grain width and length-to-width ratio in 2016 are represented by white bars, and the grain length, grain width and length-to-width ratio in 2018 are represented by black bars.
[0018] Figure 2 For BC1F2 and BC1F 2:3Genetic linkage map of QTLs related to grain shape in populations.
[0019] Figure 3 The results are for the effect verification and fine positioning of qGL4. Figure A shows the results of the comparative analysis of the grain length differences of the near-isogenic lines of the qGL4 gene in Wuhan in 2019 and 2020. The grain length of homozygous Dodda is represented by black columns, and the grain length of homozygous Guangzhan 63-4S is represented by white columns. The * and ** on the columns indicate significant differences and extremely significant differences, respectively; Figure B is a schematic diagram of the fine positioning process of qGL4. Through the recombinant single plant progeny test, qGL4 was located in the 2.359kb interval, in which there is only one gene LOC_Os04g52240.
[0020] Figure 4 This is a sequence comparison and genetic transformation analysis of qGL4 parents. Figure A shows the information of the parental mutation sites in the positioning interval. The red mark is the sgRNA target in the CRISPR-Cas9 system. Scale bar: 100bp; Figure B shows the relative expression of qGL4 between near-isogenic lines. The expression level of qGL4 in homozygous Dodda is represented by black columns, and the expression level of qGL4 in homozygous Guangzhan 63-4S is represented by white columns. The * and ** on the columns indicate significant differences and extremely significant differences, respectively; Figure C shows the sgRNA target sequence and allele mutation sequence in the CRISPR-Cas9 system. Bold letters indicate sgRNA targets, red letters indicate inserted bases, and "-" indicates missing bases; Figure D shows the grain morphology of near-isogenic lines and different knockout mutants. Scale bar: 1 cm: Figure E shows the comparison of grain length and grain width between different knockout mutants and wild type. Different lowercase letters on the columns indicate significant differences.
[0021] Figure 5 The yield-related traits among the qGL4 near-isogenic lines. Figures A and H show the comparison results of grain length (mm), grain width (mm), 1000-grain weight (g), number of tillers per plant, ear length (cm), number of primary branches, number of grains per ear, and grain yield per plant among the near-isogenic lines, respectively. The qGL4 expression level of homozygous Dodda is represented by black columns, and the qGL4 expression level of homozygous Guangzhan 63-4S is represented by white columns. * and ** on the columns indicate significant differences and extremely significant differences, respectively. DETAILED DESCRIPTION
[0022] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.
[0023] 1. Source of Materials
[0024] The genetic population used in the present invention is derived from two parental materials, Guangzhan 63-4S (GZ63-4S) and Dodda. Guangzhan 63-4S is an indica light-heat-sensitive gene male sterile line carrying the TMS5 sterile gene, bred by the China Northern Hybrid Rice Research Center and Hefei Fengle Seed Company on the basis of the indica light-heat-sensitive gene male sterile line Guangzhan 63S. Dodda is an indica rice variety (belonging to the core germplasm collected by our team).
[0025] The effect of qGL4 on grain length was verified in the BC1F4 and BC1F6 populations, and both showed significant differences. Recombinant strains were screened in the BC1F6 generation. Progeny tests were conducted in the BC1F7 generation. The near-isogenic line materials involved in most of the experiments in this experiment were isolated from the BC1F n (n≥7) generations of heterozygous genotype plants. The mutant family KO was obtained by gene editing of NIL-Guangzhan 63-4S material using the CRISPR-Cas9 system. Transgenic phenotypes were collected in the T2 generation. All materials were grown normally in the experimental field of Huazhong Agricultural University in Wuhan in summer and the South Breeding Base of Huazhong Agricultural University in Hainan in winter, with a planting density of 16.5cm x 26.4cm.
[0026] The mature harvested rice was dried and stored at room temperature for at least three months before being used in the experiments.
[0027] BC1F2 and BC1F 2:3 Seeds of the colony were imaged on a Canon LiDE110 office scanner and the images were saved at a resolution of 300 dpi. The image files were processed using SmartGraph analysis software to measure the width, length, area, circumference and roundness of the seeds ( Figure 1 ). BC1F 2:3 The phenotypic values of each line in the population were averaged over 12 plants. The grain length, grain width and length-to-width ratio of the BC1F4 population were measured using a Canon LiDE110 office scanner, and the grain length, grain width and length-to-width ratio of the BC1F6 and BC1F7 populations were measured using a yield trait scoring instrument with more than 200 grains per plant.
[0028] 2. Linkage analysis of grain shape-related traits and fine mapping of qGL4
[0029] The BC1F2 population was genotyped using 125 polymorphic markers covering the entire genome. 2:3 After the population's grain length, grain width, and length-to-width ratio phenotypes were determined, a genetic linkage map was constructed using the Kosambi function of MapMaker / Exp3.0, and linkage analysis was performed using the composite interval mapping method in WinQTLCart 2.5 ( Figure 2). A total of 30 quantitative genetic loci (QTLs) controlling grain shape were detected by genetic linkage mapping, among which the qGL4 locus located on chromosome 7 had a higher LOD value.
[0030] To verify the genetic effect of qGL4, we used the BC1F4 and BC1F6 generation near-isogenic line populations in Wuhan in 2019 and 2020, respectively, to investigate the phenotypes of grain length, grain width, and length-to-width ratio. The results of the two-year genetic effect investigation showed that compared with NIL-Dodda, NIL-Guangzhan 63-4S had longer grain length ( Figure 3 A).
[0031] During the fine mapping of qGL4, we used BC1F6 generation heterozygous materials to develop a random population of 1,200 plants for screening recombinant plants. Then, we selected the offspring of the recombinant plants and planted them in the fields of Wuhan (96 seedlings were planted in each family). The genotypes of the offspring of the families were identified, and the seeds of the homozygous offspring were harvested and the grain shape traits were examined for progeny testing (Progenytest). Through the progeny testing of 9 important recombinant plant families, we located the grain length candidate gene of qGL4 between markers CX4-31.033787 and cx4-31.036146 ( Figure 3 B). So far, we have precisely located qGL4, which controls grain length, in a region of approximately 2.359 kb between CX4-31.033787 and cx4-31.036146. According to the annotation of the Rice Annotation Project (http: / / rapdb.dna.afrc.go.jp / ), this region contains only one annotated gene, LOC_Os04g52240, which encodes an enantiomeric basidiene synthase, called OsKS2 / OsKSL2. Previous studies have reported that the OsKS2 / OsKSL2 gene may be involved in gibberellin biosynthesis or phytoalexin biosynthesis. However, the effect of this gene on grain shape and its regulatory mechanism are still unclear.
[0032] 3. Comparative sequencing analysis of candidate segments of qGL4
[0033] Comparative sequencing of the two parents showed that OsKS2 / OsKSL2 had two single nucleotide variants in the promoter region, one single nucleotide variant in the first exon, and nine variants in the first intron within the localization interval. Figure 4A). However, the SNP on the first exon is a nonsense mutation and does not result in amino acid changes. Considering that promoter variation may lead to differences in relative expression levels among near-isogenic lines, we detected the relative expression levels of OsKS2 / OsKSL2 in 8-cm, 12-cm, 14-cm, and 16-cm panicles of near-isogenic lines. RT-qPCR results showed that there was a significant difference in the relative expression levels of OsKS2 / OsKSL2 between 12-cm and 14-cm panicles, indicating that the difference in grain length caused by OsKS2 / OsKSL2 among near-isogenic lines may be due to differences in their relative expression levels.
[0034] 4. Genetic transformation and functional verification of qGL4
[0035] In order to further clarify the effect of OsKS2 / OsKSL2 gene on grain size, we used CRISPR-Cas9 system to edit the gene in the NIL-Guangzhan 63-4S genetic background and constructed OsKS2 / OsKSL2 knockout material ( Figure 4 C-4E). We designed the first exon sequence of the OsKS2 / OsKSL2 gene (GTGGATCCAGCGGAACCAGC) as the target site of sgRNA, aiming to obtain amino acid mutations near the GGG domain ( Figure 4 C). The gene editing experiment produced three allele homozygous mutant types, named KO-1, KO-2 and KO-3. All mutant T2 generation materials and wild-type materials were planted in the South China Breeding Base of Huazhong Agricultural University in Hainan in 2023. We tested the grain shape of the mutants. Consistent with the expected results, in the NIL-GZ63-4S background, the grain length of all three allele mutant types was shorter than that of the wild type. In contrast, the grain width of the KO-1 and KO-2 allele mutants was wider than that of the wild type.
[0036] 5. Phenotypic Investigation
[0037] The determination method is as follows:
[0038] 1) Determination of particle shape:
[0039] BC1F2 and BC1F 2:3 Seeds of the colony were imaged on a Canon LiDE110 office scanner and the images were saved at a resolution of 300 dpi. The image files were processed using SmartGraph analysis software to measure the width, length, area, circumference and roundness of the seeds ( Figure 1 ). The tested seeds in each seed are all random full grains, and the number of grains is greater than 150. BC1F 2:3The phenotypic values of each line in the population were averaged over 12 plants. The grain length, grain width and length-to-width ratio of the BC1F4 population were measured using a Canon LiDE110 office scanner, and the grain length, grain width and length-to-width ratio of the BC1F6 and BC1F7 populations were measured using a yield trait scorer with more than 200 grains per plant. The number of grains tested in each seed was greater than 200.
[0040] 2) Determination of yield-related traits:
[0041] Determination of the number of tillers per plant: After the seeds mature, the number of effective ears with more than 10 grains is recorded manually, which is the number of effective tillers per plant.
[0042] Determination of ear length: After the seeds matured, the ear lengths of 5 main ears per plant were measured and recorded manually, with 12 plants per family measured.
[0043] Number of primary branches: After the seeds matured, the number of primary branches of 5 main ears per plant was recorded manually, and 12 plants were measured for each family.
[0044] Determination of the number of filled grains per ear: After the seeds are mature, all effective ears are harvested. After threshing, the total number of grains per plant is obtained using a digital seed testing machine. The total number of grains per plant divided by the number of effective ears is the number of filled grains per ear.
[0045] Determination of single-plant yield: After the seeds mature, all effective ears are harvested. After the individual plants are threshed, the single-plant grain weight is obtained using a digital seed testing machine, which is the single-plant yield.
[0046] 6. qGL4 affects rice yield
[0047] We investigated the yield-related traits of near-isogenic lines in the field in Wuhan in 2023. The results of the yield trait investigation of near-isogenic lines showed that compared with NIL-Dodda, the panicle length, number of primary branches and number of grains per panicle of NIL-Guangzhan 63-4S were reduced, but the grain length and grain width were significantly increased, which directly increased the thousand-grain weight of grains and indirectly increased the yield per rice plant. The above results indicate that the qGL4 allele of Guangzhan 63-4S has the effect of increasing rice yield.
[0048] In the present invention, we isolated and identified a QTL qGL4 that regulates grain length and grain weight through map-based cloning, and gene editing experiments verified that qGL4 can indeed regulate rice grain length. The present invention found that qGL4 can not only increase grain length, but also increase thousand-grain weight, thereby increasing single-plant yield. Therefore, we believe that qGL4, which can increase grain length and yield, has great application value in the breeding and improvement of high-yield rice varieties.
[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. Application of qGL4 gene in changing rice grain length or yield.
2. A qGL4 gene allele capable of increasing rice grain length and yield, characterized in that: The qGL4 gene allele is derived from the qGL4 gene of the rice variety Guangzhan 63-4S.
3. The qGL4 gene allele according to claim 2, characterized in that The nucleic acid sequence of the qGL4 gene allele is shown in SEQ ID NO.
1.
4. A rice breeding method for changing rice grain length and / or yield, characterized in that: The method comprises the step of changing the expression level of the qGL4 gene.
5. The method according to claim 4, characterized in that By hybridization, the qGL4 gene allele with the target expression efficiency is introduced into the starting rice line to change the expression level of the qGL4 gene.
6. The method according to claim 5, characterized in that The qGL4 gene and its equivalent gene derived from Guangzhan 63-4S are qGL4 gene alleles with high expression efficiency; the qGL4 gene and its equivalent gene derived from Dodda are qGL4 gene alleles with low expression efficiency.
7. The method according to claim 4, characterized in that The qGL4 gene expression frame is introduced by genetic engineering method to improve the expression of qGL4 gene, or the expression amount of qGL4 gene is changed by knocking out or knocking down the qGL4 gene in the starting rice line.
8. The method according to claim 4, characterized in that The expression level of qGL4 gene is changed by physical mutagenesis or chemical mutagenesis.